Homologs in group_866

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03740 FBDBKF_03740 94.5 Morganella morganii S1 hyfB hydrogenase 4 subunit B
EHELCC_06795 EHELCC_06795 94.5 Morganella morganii S2 hyfB hydrogenase 4 subunit B
NLDBIP_07120 NLDBIP_07120 94.5 Morganella morganii S4 hyfB hydrogenase 4 subunit B
LHKJJB_06655 LHKJJB_06655 94.5 Morganella morganii S3 hyfB hydrogenase 4 subunit B
HKOGLL_04275 HKOGLL_04275 94.5 Morganella morganii S5 hyfB hydrogenase 4 subunit B
PMI_RS12495 PMI_RS12495 80.8 Proteus mirabilis HI4320 hyfB hydrogenase 4 subunit B

Distribution of the homologs in the orthogroup group_866

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_866

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P23482 0.0 779 61 2 672 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
P16429 3.65e-125 387 37 5 602 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
P9WIW3 1.54e-69 241 31 10 613 3 Rv0083 Uncharacterized protein Rv0083 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW2 1.54e-69 241 31 10 613 3 MT0090 Uncharacterized protein MT0090 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P77437 6.08e-42 163 29 6 361 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
Q9RGZ5 6.52e-41 163 28 11 452 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q9K2S2 1.83e-39 159 29 11 467 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
Q9ZCG0 1.12e-37 150 24 6 449 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q4L4W7 5.77e-36 148 29 13 433 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q68VV6 3.86e-35 142 24 7 453 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B1I6I5 1.21e-34 141 29 13 429 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
Q4UK26 1.55e-34 141 24 7 459 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P77416 2.03e-34 140 27 7 426 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
Q8CPU8 2.67e-34 143 26 16 464 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 2.67e-34 143 26 16 464 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P29925 1.02e-33 139 30 9 356 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
Q49W91 1.93e-33 140 27 14 488 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q92G96 2.21e-33 137 24 8 459 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1RKE5 7.48e-33 136 24 5 399 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
Q6GJ44 7.87e-33 136 25 9 434 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
Q7A725 2.09e-32 135 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 2.09e-32 135 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 2.09e-32 135 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9RGZ2 3.93e-32 134 24 11 487 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q9I0J0 4.18e-32 134 28 7 343 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WIW1 4.82e-32 135 30 12 424 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 4.82e-32 135 30 12 424 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B1X491 6.75e-32 135 27 13 455 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
Q8NXT1 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 7.33e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q0Q2J7 7.99e-32 133 24 10 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
Q99VZ2 1.44e-31 134 28 15 449 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 1.44e-31 134 28 15 449 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 1.44e-31 134 28 15 449 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 1.44e-31 134 28 15 449 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 1.44e-31 134 28 15 449 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
P31971 1.55e-31 134 28 16 472 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8NXT2 4.47e-31 133 27 13 422 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 4.47e-31 133 27 13 422 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
P60675 5.21e-31 133 27 16 459 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 5.21e-31 133 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 5.21e-31 133 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 5.21e-31 133 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 5.21e-31 133 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q0Q2K0 5.34e-31 133 27 13 422 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 5.34e-31 133 27 13 422 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 5.34e-31 133 27 13 422 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 5.34e-31 133 27 13 422 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 5.34e-31 133 27 13 422 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 5.34e-31 133 27 13 422 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q49VG9 5.66e-31 133 27 18 456 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P50974 6.04e-31 130 29 8 362 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
Q2YST2 6.21e-31 132 27 15 449 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P33607 1.06e-30 131 32 19 424 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q2YWT4 1.1e-30 132 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXF6 1.45e-30 131 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 1.45e-30 131 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 1.45e-30 131 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 1.45e-30 131 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 1.45e-30 131 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 1.45e-30 131 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 1.45e-30 131 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q9ZNG6 1.49e-30 131 27 16 459 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q85T01 1.66e-30 130 26 13 425 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q6GID6 1.93e-30 131 27 16 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q6GJ47 3.34e-30 130 27 16 452 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q35099 3.83e-30 129 29 11 346 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
Q52978 4.3e-30 130 26 17 503 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
Q4L446 1.76e-29 126 24 8 420 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
B0JS85 2.02e-29 126 27 5 336 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q55429 2.9e-29 127 30 11 356 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5HRA9 3.1e-29 125 24 9 439 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ47 3.14e-29 125 24 9 439 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9I0J1 3.18e-29 126 30 18 457 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DHX4 4.41e-29 125 36 1 188 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q4L4W4 4.53e-29 125 24 8 402 3 mnhD Na+/H+-antiporter, MnhD subunit Staphylococcus haemolyticus (strain JCSC1435)
Q8YM86 4.92e-29 125 27 5 340 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MAR0 5.89e-29 125 27 5 340 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P03916 6.28e-29 125 30 16 359 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
Q9ZCG1 1.07e-28 125 27 11 424 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
P20679 1.49e-28 124 24 24 618 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q35648 1.86e-28 124 30 16 359 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
P0AFE8 1.88e-28 123 27 8 343 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 1.88e-28 123 27 8 343 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
Q37617 1.9e-28 123 26 5 337 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Prototheca wickerhamii
Q4L443 2e-28 125 27 21 487 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
Q8SHP7 2.28e-28 124 26 14 427 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
P48919 2.35e-28 123 28 14 446 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
P03915 2.39e-28 124 29 14 372 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
F1SVK0 2.64e-28 124 27 18 448 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q1RKE6 3.39e-28 123 26 11 425 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
Q95885 3.97e-28 123 29 16 361 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
Q5HRB2 4.13e-28 124 27 12 397 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ50 4.16e-28 124 27 12 397 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q2JWW3 7.23e-28 121 25 3 336 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
Q3M9C7 7.72e-28 121 29 4 293 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P03917 9.09e-28 122 29 14 350 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
Q49VH2 1.12e-27 120 23 9 459 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4UK27 1.35e-27 122 27 11 424 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q6GID9 1.42e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
Q8YZV7 1.46e-27 120 28 4 293 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q10ZG8 1.52e-27 121 27 7 338 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
Q8M9U5 1.55e-27 122 27 14 441 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
B1XHP2 1.64e-27 120 26 10 445 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P72823 2.21e-27 120 26 4 340 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P60687 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 2.21e-27 120 23 6 368 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 2.21e-27 120 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6QU67 2.29e-27 121 25 13 426 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
Q2YWT7 2.38e-27 119 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2JPJ1 2.43e-27 120 25 3 336 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6V9D9 2.62e-27 121 26 16 428 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
Q34879 2.65e-27 120 29 14 359 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
Q5HHD6 2.73e-27 119 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
P26848 3.42e-27 119 23 5 342 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
Q6EW03 3.46e-27 121 26 13 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
Q92G97 3.47e-27 120 27 11 422 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8Z056 3.79e-27 119 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 3.79e-27 119 23 6 368 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
Q9TKV7 4.19e-27 120 26 13 449 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
A1XG02 5.12e-27 120 26 13 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
O05229 5.31e-27 118 26 5 336 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
Q9XAR5 5.46e-27 120 28 14 506 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
F1SVH9 6.16e-27 118 26 11 362 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O47497 6.86e-27 118 24 8 445 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
Q06GK2 7.29e-27 120 27 10 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
B1VKJ3 1.19e-26 119 28 14 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q85BG0 1.7e-26 117 25 9 378 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Anthoceros angustus
Q58705 1.77e-26 117 25 9 390 4 MJ1309 Uncharacterized protein MJ1309 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5N5W1 1.82e-26 117 33 1 189 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 1.82e-26 117 33 1 189 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q68VV7 2.14e-26 118 27 12 424 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A7Y3L2 2.52e-26 116 23 5 339 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ipomoea purpurea
P29924 4.9e-26 117 29 18 454 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
Q3MCB9 5.58e-26 115 23 7 413 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P11628 6.56e-26 116 26 16 427 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
Q9TDR1 6.81e-26 116 30 14 350 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
Q6YXQ3 6.83e-26 115 25 6 339 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Physcomitrium patens
Q34313 9.6e-26 116 27 17 441 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
Q8YQ78 9.62e-26 115 24 8 401 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B1XJL9 1.18e-25 115 26 7 358 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8HHD2 1.43e-25 115 26 16 426 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q0H8X0 1.52e-25 115 24 14 463 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
P93313 1.54e-25 114 24 6 346 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
P24978 1.56e-25 115 27 15 395 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
Q9B8C9 1.95e-25 114 26 14 441 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
P05510 2.17e-25 115 26 15 396 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P50365 2.88e-25 114 26 15 431 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
P50368 3.39e-25 114 28 17 419 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
Q32126 3.61e-25 114 28 13 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q9PMA7 3.74e-25 114 26 10 387 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P03920 4.32e-25 114 28 13 358 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
Q09MC9 4.37e-25 114 27 14 423 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
P41299 5.26e-25 113 30 14 333 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
Q0G9R5 5.28e-25 114 25 19 514 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
Q859V1 6.02e-25 114 28 10 351 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
P92699 6.15e-25 113 29 13 333 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
Q9TA19 6.69e-25 113 28 18 399 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
Q85FH9 6.82e-25 114 27 10 374 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q9TLC2 7.01e-25 114 28 11 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
A6H5N8 7.16e-25 114 28 9 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
A4QLP4 7.39e-25 114 28 15 417 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
P57262 7.44e-25 113 28 16 439 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9BBP6 7.95e-25 113 28 10 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
P06264 1.06e-24 113 28 12 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
Q576B4 1.07e-24 112 31 11 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
A4QJX9 1.08e-24 113 28 15 417 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
A4QKP2 1.17e-24 113 28 14 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
P50939 1.2e-24 113 27 16 451 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q9TKV8 1.21e-24 111 24 13 459 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
Q2LCP6 1.22e-24 112 26 17 441 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q9MUK8 1.24e-24 112 28 13 366 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q8M9U1 1.59e-24 111 23 4 343 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
A4QL68 1.65e-24 112 28 13 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
A4QLF6 1.66e-24 112 29 17 420 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
P27572 1.69e-24 111 24 6 346 2 ND4 NADH-ubiquinone oxidoreductase chain 4 Triticum aestivum
Q19V61 1.85e-24 111 25 6 344 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chlorokybus atmophyticus
Q9ZZY1 1.91e-24 111 26 11 358 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
Q8CPV1 2.11e-24 110 22 9 371 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O78756 2.19e-24 111 28 13 358 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
Q2PMN2 2.27e-24 110 28 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Glycine max
Q68RV9 2.34e-24 112 29 12 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q49KV1 2.39e-24 112 26 15 446 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q9M3J4 2.4e-24 112 27 14 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
Q5HQL3 2.42e-24 110 22 9 371 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B0Z5H4 2.46e-24 112 28 14 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 2.46e-24 112 28 14 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 2.46e-24 112 28 14 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 2.46e-24 112 28 14 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
P06263 2.51e-24 110 27 4 251 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Marchantia polymorpha
O47815 2.54e-24 111 29 11 296 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
P29388 2.65e-24 111 28 11 347 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
Q9MTI4 2.78e-24 112 28 14 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
A2T379 2.95e-24 112 28 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
P56752 3.02e-24 112 28 15 411 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
Q2PMM9 3.21e-24 111 28 11 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
Q32S08 3.28e-24 110 24 4 337 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Staurastrum punctulatum
P50367 3.7e-24 111 25 15 425 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
O63908 3.72e-24 110 31 17 337 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
Q76LN2 3.75e-24 110 28 18 395 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
Q32RH9 3.8e-24 111 24 14 491 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
A4QK67 3.86e-24 111 27 13 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
Q38PR2 3.99e-24 110 28 18 399 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
P51099 4.13e-24 111 28 11 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
P06262 4.27e-24 110 26 4 273 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tabacum
Q3C1Q4 4.27e-24 110 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana sylvestris
B3TN96 4.52e-24 111 27 15 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
Q33BX2 4.55e-24 109 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tomentosiformis
Q96069 4.7e-24 110 29 10 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
Q2I3G4 4.83e-24 110 30 16 337 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
Q37680 5.1e-24 110 27 11 348 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
Q37710 5.21e-24 110 28 10 321 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Artemia franciscana
P48920 5.23e-24 110 29 14 350 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
A4QKF4 5.3e-24 111 28 17 420 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
Q2QD43 5.81e-24 110 26 12 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
Q6YXQ6 5.83e-24 110 27 15 424 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
Q01561 6.61e-24 110 26 16 423 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
Q70XW6 7.33e-24 110 26 12 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
P51095 7.63e-24 110 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q32551 7.77e-24 110 28 11 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
B2XWI8 8.08e-24 110 30 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
Q2A7B8 8.28e-24 108 23 5 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum lycopersicum
P9WIW5 8.77e-24 109 27 5 310 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 8.77e-24 109 27 5 310 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A4GGE6 9.25e-24 108 25 4 273 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Phaseolus vulgaris
P46620 1.06e-23 110 26 12 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
A9QPJ1 1.08e-23 108 24 11 423 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
A2T383 1.16e-23 108 23 4 337 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
Q09FR3 1.17e-23 110 27 14 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
B1A981 1.21e-23 110 27 12 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
A4QJG3 1.23e-23 109 25 19 523 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
Q06R80 1.39e-23 108 29 2 212 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Jasminum nudiflorum
Q37372 1.53e-23 109 30 10 292 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
P03918 1.56e-23 108 30 11 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
A7Y3K7 1.61e-23 109 28 10 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
A9L9E4 1.63e-23 109 28 15 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
Q89AT5 1.7e-23 108 24 11 479 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B5LMS9 1.79e-23 109 27 14 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
B2LMQ1 1.79e-23 109 29 12 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
O03205 1.83e-23 108 31 14 300 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
Q94RJ2 1.86e-23 108 27 13 350 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
Q32880 1.95e-23 109 26 13 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
Q0G9R2 2.2e-23 107 23 4 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Daucus carota
Q2VED0 2.32e-23 107 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum tuberosum
Q8S8U7 2.36e-23 107 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Atropa belladonna
P03921 2.55e-23 108 30 13 299 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
Q6ENQ0 2.63e-23 108 26 13 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
Q0I6X0 2.66e-23 108 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
P26849 2.7e-23 108 27 12 352 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q32539 2.72e-23 108 28 11 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q2JTD6 2.72e-23 107 24 4 274 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-3-3Ab)
Q6L3E3 2.72e-23 108 26 13 408 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
B0C4B4 2.78e-23 107 25 4 274 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
P51098 2.96e-23 108 27 14 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
P38602 2.99e-23 108 27 17 418 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
A4GGE3 3.12e-23 108 26 12 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q33066 3.45e-23 108 25 13 415 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
Q32440 3.58e-23 108 26 14 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
Q49W88 3.63e-23 107 26 7 347 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q0H8X6 3.65e-23 107 23 6 333 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ustilago maydis (strain 521 / FGSC 9021)
Q8KX53 3.81e-23 107 22 8 441 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P51100 3.98e-23 108 28 11 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
Q2L960 4.19e-23 108 28 16 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q32384 4.45e-23 108 28 11 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
A6MMI0 4.45e-23 108 28 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
O79437 4.48e-23 107 26 12 352 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
Q1ACE9 4.7e-23 106 24 6 339 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chara vulgaris
Q3AGZ9 4.77e-23 107 21 7 423 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
Q3V4Y7 5.12e-23 107 27 13 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
Q09FZ9 5.26e-23 107 28 11 344 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
Q8S8V0 5.51e-23 107 27 14 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q7U413 5.68e-23 107 21 7 423 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
Q33BX5 5.7e-23 107 26 13 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
A9LYE7 6.11e-23 107 27 13 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
Q1HK80 6.18e-23 107 30 18 348 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
Q32131 6.47e-23 107 26 14 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
B1NWJ6 6.65e-23 107 28 13 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
A0ZZ82 6.74e-23 107 28 16 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
Q0G9H2 6.87e-23 107 27 13 363 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
Q09MC6 6.88e-23 106 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Citrus sinensis
Q32007 7.11e-23 107 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q31849 7.33e-23 107 26 14 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
A4QKY1 7.7e-23 107 28 15 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
P03919 7.76e-23 107 30 12 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
P18932 7.76e-23 106 28 9 327 1 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila melanogaster
Q32238 8.33e-23 107 26 14 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
Q8W8H5 8.76e-23 107 25 11 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
P51097 8.86e-23 107 26 14 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q5SCZ6 8.88e-23 105 25 3 305 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Huperzia lucidula
Q32091 9.13e-23 107 29 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q68RV6 9.33e-23 105 30 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Panax ginseng
A0A382 1.02e-22 107 29 14 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
Q32516 1.07e-22 107 27 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
Q06FL7 1.08e-22 107 24 17 511 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
Q95H46 1.11e-22 107 25 12 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
P51096 1.13e-22 107 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q8W9M6 1.34e-22 106 30 17 343 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q9MVL6 1.39e-22 106 27 15 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
Q9BBP3 1.5e-22 105 22 4 328 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lotus japonicus
A1EA56 1.55e-22 106 25 13 417 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q2VED3 1.57e-22 106 27 14 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
P15958 1.65e-22 106 27 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
A8Y9D4 1.66e-22 106 25 13 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
Q953I4 1.68e-22 105 28 13 349 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
P0C328 1.86e-22 106 26 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 1.86e-22 106 26 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 1.86e-22 106 26 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 1.86e-22 106 26 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
Q3B063 1.87e-22 105 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
A6MMZ5 2.08e-22 104 28 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Illicium oligandrum
Q1KXQ3 2.18e-22 104 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Helianthus annuus
Q09WW8 2.28e-22 104 29 4 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Morus indica
Q118H6 2.33e-22 104 25 4 306 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichodesmium erythraeum (strain IMS101)
Q06R83 2.38e-22 105 26 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q31952 2.44e-22 105 27 14 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q00542 2.47e-22 105 27 18 419 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
A6H5P2 2.88e-22 104 24 7 402 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cycas taitungensis
P48921 2.99e-22 105 30 18 331 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
Q0ZIX1 3.09e-22 105 26 13 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
Q2JK43 3.54e-22 104 24 5 303 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
P48656 3.73e-22 104 28 18 404 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
Q1KXG6 3.91e-22 103 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lactuca sativa
Q2MIE0 4.02e-22 105 28 12 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q1ACF3 4.36e-22 104 27 11 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
Q8DKY0 4.53e-22 103 22 4 366 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A8SEF0 4.64e-22 105 26 12 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
B2LMP8 5.12e-22 103 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Guizotia abyssinica
O78688 5.19e-22 104 28 19 419 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
P33510 5.25e-22 103 28 9 329 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles quadrimaculatus
P06265 5.37e-22 104 26 14 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q3C1N9 5.42e-22 104 26 14 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
A1XGU4 5.45e-22 104 27 13 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
Q33113 5.52e-22 104 26 13 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
A4QLY2 5.57e-22 104 27 16 420 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
Q32RL9 5.6e-22 103 23 4 337 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zygnema circumcarinatum
Q7VE41 5.6e-22 103 28 1 195 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A4QJP7 5.71e-22 104 26 23 526 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
Q9TLA3 5.74e-22 104 27 13 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
A6MMZ2 5.96e-22 104 28 13 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
Q85FH5 7.19e-22 103 23 4 337 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
Q7NP39 8.26e-22 103 27 2 218 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A6MMR6 9.67e-22 103 27 11 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
Q9MVK2 9.95e-22 103 27 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
Q9MUM8 1.08e-21 102 23 4 343 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Mesostigma viride
B0FWD3 1.14e-21 103 26 12 415 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Aedes aegypti
Q7YJT6 1.18e-21 103 27 14 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
A2CD41 1.24e-21 102 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q06GU9 1.27e-21 103 27 11 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
O21335 1.42e-21 102 30 11 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
Q14FB0 1.44e-21 103 25 13 414 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
Q36459 1.59e-21 102 27 18 405 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
A5GP41 1.64e-21 102 26 2 208 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
A9L9E7 1.74e-21 102 23 5 338 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lemna minor
P32421 1.76e-21 102 21 8 420 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P92669 1.82e-21 102 27 18 435 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
Q9ZZ57 1.85e-21 102 29 17 336 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
B0Z5H7 2.06e-21 101 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera parviflora
Q32S06 2.1e-21 102 28 11 360 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
A4GYW4 2.15e-21 102 26 12 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q35813 2.22e-21 102 30 12 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
Q36428 2.33e-21 102 28 7 289 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Locusta migratoria
B0JPG4 2.43e-21 101 22 10 444 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A9RAH0 2.46e-21 102 26 15 419 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P92485 2.56e-21 102 27 18 404 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
P11661 2.85e-21 102 28 12 297 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
B1VKI4 2.88e-21 101 22 5 339 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cryptomeria japonica
P18940 3.15e-21 102 29 15 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
Q7YJT3 3.58e-21 100 27 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Calycanthus floridus var. glaucus
Q9ZZM3 3.85e-21 101 30 14 299 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
A1XGU1 3.95e-21 100 22 5 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ranunculus macranthus
A4QJG6 4.23e-21 100 27 2 204 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema cordifolium
P10330 4.39e-21 101 27 11 347 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
B0Z4S5 4.42e-21 100 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera argillicola
A0A385 4.84e-21 100 22 5 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Coffea arabica
Q04050 5.27e-21 100 23 8 347 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Brassica campestris
P58419 5.48e-21 100 25 4 273 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera elata subsp. hookeri
B0Z593 5.49e-21 100 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera glazioviana
B0Z509 5.49e-21 100 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera biennis
Q7V4E4 5.6e-21 100 26 2 208 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
A4QJQ0 6.22e-21 100 27 2 204 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema grandiflorum
Q8K9X7 6.26e-21 100 27 12 364 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q70XV2 7.79e-21 100 24 6 329 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Amborella trichopoda
P11993 7.8e-21 100 26 10 320 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
P55782 7.86e-21 100 28 14 348 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
A4GYW6 1.09e-20 99 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus trichocarpa
Q95917 1.11e-20 99 26 9 361 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Polypterus ornatipinnis
Q5SCZ9 1.17e-20 100 25 10 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
Q14FA8 1.23e-20 99 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus alba
P51899 1.23e-20 98 27 11 328 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles arabiensis
P24979 1.3e-20 100 28 10 297 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
P34195 1.46e-20 99 30 16 338 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
A2BZX6 1.46e-20 99 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
P41309 1.56e-20 99 28 15 350 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
Q09FR0 1.58e-20 99 23 2 272 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nandina domestica
Q9ZZ44 1.6e-20 99 30 13 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
Q46HM4 1.61e-20 99 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
O79411 1.77e-20 99 30 13 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
O79422 2.02e-20 99 29 11 298 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma lanceolatum
Q34947 2.37e-20 99 27 13 387 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Lumbricus terrestris
P48176 2.47e-20 99 30 13 299 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
O03174 2.67e-20 99 28 15 375 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
P07706 3.05e-20 98 28 10 329 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila yakuba
Q4JQH7 3.22e-20 98 27 15 392 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
Q8WHX8 3.43e-20 97 22 5 349 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Psilotum nudum
P34854 3.61e-20 98 27 11 330 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles gambiae
A9BD08 3.85e-20 98 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
Q31D31 3.89e-20 98 23 6 339 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
O79678 3.89e-20 98 28 11 315 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
B1X5V5 4.15e-20 98 27 14 394 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
A1XG05 4.16e-20 97 21 5 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nuphar advena
A9LYF0 4.2e-20 97 22 5 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus var. americanus
Q09FZ6 4.27e-20 97 23 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Platanus occidentalis
B1NWJ9 4.67e-20 97 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Manihot esculenta
Q0G9G9 4.8e-20 97 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Liriodendron tulipifera
A2BUC6 4.86e-20 97 26 3 242 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9515)
A2BNU4 4.94e-20 97 23 6 339 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
A8G2F5 4.94e-20 97 23 6 339 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
P15552 5.17e-20 98 33 9 190 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
A8SEF4 5.25e-20 97 22 5 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ceratophyllum demersum
A6MMH7 5.64e-20 97 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chloranthus spicatus
Q6EW00 6.86e-20 97 24 4 274 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nymphaea alba
A6MM84 7.34e-20 97 26 13 367 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
F1SVL2 8.68e-20 96 24 8 355 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q3V4Y4 9.9e-20 96 22 5 338 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus
O21047 1.08e-19 96 27 5 255 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium discoideum
Q7V3C8 1.23e-19 96 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q5N060 1.31e-19 96 25 7 340 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 1.31e-19 96 25 7 340 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q06GU6 1.34e-19 96 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Drimys granadensis
P12776 1.35e-19 97 31 8 212 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
Q89AT6 1.37e-19 96 30 13 350 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A3PAL7 1.77e-19 95 22 6 339 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
Q06FQ4 1.9e-19 95 28 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Pelargonium hortorum
Q09WX1 2.03e-19 96 26 15 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q95918 2.23e-19 96 29 12 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
A5GQH5 2.4e-19 95 22 5 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
Q598S9 2.6e-19 94 26 8 301 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Caperea marginata
Q9TL56 4.56e-19 95 26 14 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
Q0ZIW8 4.68e-19 94 28 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Vitis vinifera
Q9MIY0 6.8e-19 94 27 18 363 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
A6MMR3 7.41e-19 94 22 6 340 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Dioscorea elephantipes
B1A984 9.63e-19 93 24 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Carica papaya
Q2L955 1.26e-18 93 26 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium hirsutum
A0ZZ85 1.26e-18 93 26 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium barbadense
A6LXP5 1.43e-18 92 22 14 494 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A4QKF7 1.56e-18 92 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Barbarea verna
P05508 1.72e-18 92 23 11 404 3 Mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Rattus norvegicus
O47430 2.42e-18 92 29 12 299 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma floridae
P26288 2.78e-18 92 26 2 204 1 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabidopsis thaliana
Q56227 2.84e-18 92 27 17 511 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q576B5 2.99e-18 91 26 9 306 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos indicus
P03910 3.3e-18 91 26 9 306 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos taurus
Q9M3J0 3.41e-18 91 21 5 338 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Spinacia oleracea
B3QY38 3.65e-18 91 27 12 355 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A1AVS5 3.78e-18 91 24 10 358 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
Q9JX92 3.86e-18 92 28 16 356 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9RUA0 3.98e-18 91 27 10 318 3 nuoN NADH-quinone oxidoreductase subunit N Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A4QKY4 4e-18 91 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Crucihimalaya wallichii
P48915 4.02e-18 91 24 2 270 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chondrus crispus
A4QLY5 4.15e-18 91 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nasturtium officinale
Q49KU8 5.03e-18 91 22 2 272 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Eucalyptus globulus subsp. globulus
A4QLF9 5.05e-18 91 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lepidium virginicum
Q9K1B0 5.33e-18 92 27 14 353 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P50366 5.97e-18 91 25 13 350 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
A4QKP5 6.03e-18 90 26 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Capsella bursa-pastoris
Q9B6D3 7.36e-18 91 22 14 470 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
B2JDL5 9.11e-18 90 25 15 397 3 nuoN NADH-quinone oxidoreductase subunit N Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
O79881 1.11e-17 89 25 7 293 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Sus scrofa
B8J1C7 1.21e-17 90 25 11 371 3 nuoN NADH-quinone oxidoreductase subunit N Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A4QK70 1.22e-17 90 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabis hirsuta
Q37375 1.58e-17 89 24 4 244 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Acanthamoeba castellanii
A4QJY2 1.9e-17 89 26 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Olimarabidopsis pumila
O79436 1.95e-17 89 24 8 355 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oryctolagus cuniculus
A6MM87 1.97e-17 89 26 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Buxus microphylla
A4G631 2.03e-17 89 25 8 337 3 nuoN NADH-quinone oxidoreductase subunit N Herminiimonas arsenicoxydans
A4QL71 2.09e-17 89 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Draba nemorosa
Q5Y4Q1 2.81e-17 88 25 9 304 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos mutus grunniens
P03913 3.24e-17 88 22 7 348 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Aspergillus amstelodami
P57263 3.45e-17 88 24 9 314 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q591M5 3.46e-17 88 25 7 295 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus simmonsi
Q9ZYM7 3.5e-17 89 26 10 337 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhipicephalus sanguineus
P41298 3.95e-17 88 25 8 301 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Balaenoptera musculus
Q35543 4.59e-17 88 26 13 330 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
Q37024 4.62e-17 89 25 15 423 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Wickerhamomyces canadensis
Q0C1D1 5.47e-17 87 27 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11130
Feature type CDS
Gene hyfB
Product hydrogenase 4 subunit B
Location 364578 - 366593 (strand: 1)
Length 2016 (nucleotides) / 671 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_866
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0651 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)
CP Formate hydrogenlyase subunit 3/Multisubunit Na+/H+ antiporter, MnhD subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12137 hydrogenase-4 component B [EC:1.-.-.-] - -

Protein Sequence

MTSLELLLWSVSLYTAGGFISLLFKQQEKMAIYVAGITAIIGGILGLFSAIPVLMSGETLTYFAQGPFPFAHFVVRLDGLAAFMVMVISLLVTVSALYSLNYVQEYIGRGAWSMGFFLNLFIASMVALVVMDNAFYFIILFEMMSLASWFLVIADQDEKSIRAGLLYFFIAHAGSVLIMIAFFLMWRESGSLDFDSFRQLTLSPAMASVVFLLGFFGFGAKAGMLPLHSWLPQAHPAAPSHASALMSGVMVKIGIFGIIKVGIDLLGATQGWWGIVVLAFGAVSSVLGVMYALAEHDIKRLLAWHTVENIGIILMGVGVGMVGMANDMPVLATIGLLGAIYHLLNHAVFKGLLFLGAGAVIYRVHTRDMDKMGGLAKLMPLTATAFLIGCMAISALPPLNGFVSEWYTYQSLFSMSHDGTFIMRISGPIAIVMLAITGALAAMCFVKVYGVSFCGGPRSEQATHAREVPWTMTTAMLILAAVCVLLGVGASVIAPVLAKVAMSLTAATDVTVVQGAMLIPDSASQAMISPVMTFVLLLGLPVIPLVIYLVFKGKQMDARRKGDAWACGYAWEKDMSVSAGGFTQPLRSMFAPLYRMRKQLDPSARLARALEVTTIGAGKVEPFWDEQIIYPLVRGINRFAKRIQCLQGGDFRLYCLYVVAALVVLLVVIAA

Flanking regions ( +/- flanking 50bp)

GCTATGCCGCCGGAATTCGACGTTTTTGTCTCACGACAGGAGAATCCATAATGACATCGCTTGAACTGCTCTTGTGGTCGGTTTCCCTGTATACCGCAGGGGGCTTTATTTCGCTGCTGTTTAAACAGCAGGAAAAAATGGCGATTTATGTGGCCGGTATCACTGCCATTATCGGCGGTATTCTTGGTTTATTCAGCGCCATCCCGGTACTGATGAGCGGAGAAACACTGACATATTTTGCTCAGGGTCCGTTCCCGTTTGCTCATTTTGTTGTTCGTCTTGATGGACTCGCCGCCTTTATGGTGATGGTGATTTCACTGCTTGTGACAGTCAGCGCCTTGTATTCCCTTAATTATGTACAGGAATATATCGGACGTGGAGCATGGAGCATGGGGTTCTTCCTGAACCTGTTTATTGCGTCCATGGTCGCCCTTGTCGTGATGGATAACGCATTCTACTTCATTATTCTATTTGAAATGATGTCGCTGGCGTCATGGTTCCTCGTGATAGCCGATCAGGATGAAAAATCAATCCGCGCCGGTCTGCTCTACTTCTTTATTGCGCATGCCGGTTCTGTGCTGATTATGATCGCCTTCTTCCTGATGTGGCGTGAAAGCGGCAGCCTGGACTTCGATTCCTTCCGCCAGCTTACGCTCTCTCCTGCAATGGCTTCTGTTGTTTTCCTGCTGGGTTTCTTCGGCTTCGGCGCAAAAGCGGGTATGTTGCCGCTGCACAGCTGGCTGCCACAGGCTCACCCGGCGGCACCGTCTCACGCATCTGCACTGATGTCCGGTGTCATGGTGAAAATCGGTATCTTCGGGATCATCAAAGTCGGTATTGACCTGCTGGGTGCGACTCAGGGCTGGTGGGGAATTGTTGTGCTCGCCTTTGGTGCGGTATCGTCTGTCCTCGGCGTAATGTATGCGCTGGCGGAGCACGATATCAAACGTCTGCTGGCATGGCATACCGTGGAAAATATCGGGATCATCCTGATGGGCGTGGGTGTTGGTATGGTCGGTATGGCAAATGATATGCCGGTACTGGCAACCATTGGTCTGCTCGGGGCTATCTACCACTTACTGAACCACGCGGTGTTTAAAGGATTACTGTTCCTTGGCGCGGGTGCGGTTATTTACCGCGTTCATACCCGTGACATGGATAAAATGGGCGGTCTGGCAAAACTGATGCCGCTGACAGCCACTGCATTCTTAATCGGTTGTATGGCTATTTCTGCATTGCCGCCGCTCAATGGCTTTGTCAGTGAGTGGTACACCTATCAGTCACTGTTCTCTATGAGTCATGACGGTACATTCATCATGCGCATCAGTGGTCCGATTGCGATTGTCATGCTGGCAATCACCGGGGCATTAGCTGCCATGTGTTTTGTGAAAGTATACGGTGTCAGTTTCTGTGGCGGTCCGCGCAGTGAACAGGCAACGCATGCCCGCGAAGTGCCGTGGACAATGACGACAGCAATGTTAATCCTGGCAGCGGTGTGTGTGCTGCTGGGTGTGGGTGCAAGCGTGATTGCGCCGGTGCTGGCAAAAGTGGCGATGTCACTGACCGCGGCAACGGATGTGACGGTTGTTCAGGGCGCGATGCTGATACCGGACAGTGCATCTCAGGCGATGATTTCACCGGTAATGACCTTTGTTCTTCTGCTGGGGCTGCCTGTTATCCCGCTGGTTATCTATCTTGTCTTTAAAGGCAAACAGATGGATGCGCGCCGTAAAGGTGACGCATGGGCGTGTGGTTATGCCTGGGAAAAAGATATGTCAGTCTCTGCCGGCGGGTTTACTCAACCGCTGCGCTCTATGTTCGCGCCGCTTTACCGCATGCGTAAACAGCTTGATCCTTCCGCCCGCCTGGCGCGTGCCTTAGAGGTGACGACCATTGGTGCCGGGAAAGTTGAGCCATTCTGGGATGAACAGATCATTTATCCGCTGGTCCGCGGTATTAACCGCTTTGCCAAACGCATTCAATGTCTCCAGGGCGGCGACTTCAGACTTTATTGTCTCTATGTCGTCGCCGCGCTGGTGGTCTTGCTTGTCGTGATTGCGGCGTAAGGAGAGAAACCATGTCGATTCAGGAAACACCAACATTGATGACGGGGTTC