Homologs in group_2520

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02190 FBDBKF_02190 100.0 Morganella morganii S1 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
EHELCC_02660 EHELCC_02660 100.0 Morganella morganii S2 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
NLDBIP_00800 NLDBIP_00800 100.0 Morganella morganii S4 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
LHKJJB_01235 LHKJJB_01235 100.0 Morganella morganii S3 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
F4V73_RS04560 F4V73_RS04560 91.0 Morganella psychrotolerans lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA

Distribution of the homologs in the orthogroup group_2520

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2520

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q2PBM3 0.0 717 67 0 513 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus temperata
Q2PBM0 0.0 717 68 1 513 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus luminescens
Q7N2D9 0.0 711 67 1 513 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JLQ0 0.0 711 69 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FMJ7 0.0 710 69 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66EY9 0.0 710 68 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3G1 0.0 710 68 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4TQL5 0.0 706 68 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
Q1CN15 0.0 706 68 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R074 0.0 706 68 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
Q0WJP9 0.0 706 68 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q1C138 0.0 706 68 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
A1JJ55 0.0 700 68 2 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P77257 0.0 655 65 1 498 1 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain K12)
B1XEA1 0.0 655 65 1 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain K12 / DH10B)
B1IRU7 0.0 652 65 1 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1LFA2 0.0 650 65 1 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain SMS-3-5 / SECEC)
A8A066 0.0 649 65 1 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli O9:H4 (strain HS)
Q83L12 0.0 647 64 1 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Shigella flexneri
Q0T4L9 0.0 647 64 1 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Shigella flexneri serotype 5b (strain 8401)
Q8XAY7 0.0 644 64 1 498 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli O157:H7
P0C886 0.0 639 63 1 495 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella choleraesuis (strain SC-B67)
A9MZG1 0.0 639 63 1 495 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJE7 0.0 639 63 1 495 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZKQ4 0.0 638 63 1 495 1 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z2X5 0.0 636 63 1 495 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella typhi
A6TEB8 0.0 606 60 1 494 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WER4 0.0 591 61 1 491 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Enterobacter sp. (strain 638)
A7ZLX1 1.33e-140 411 66 0 306 5 lsrA Putative autoinducer 2 import ATP-binding protein LsrA homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
A7ZLX1 9.73e-11 66 24 4 222 5 lsrA Putative autoinducer 2 import ATP-binding protein LsrA homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1AVD3 2.89e-120 366 40 6 510 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8RD43 2.36e-115 353 38 9 508 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3MB44 7.48e-115 352 40 5 505 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8CK44 6.73e-113 347 39 7 501 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q825P1 1.12e-112 346 38 5 498 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q92W60 1.29e-112 346 38 7 513 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q4KDI2 1.09e-111 344 40 7 507 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KDI2 6.6e-14 77 27 3 229 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q63FX9 1.12e-111 343 37 6 500 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q6HNE7 2.36e-111 342 37 6 500 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81V36 2.36e-111 342 37 6 500 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q9K6J9 2.84e-111 342 39 6 498 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1M360 3.76e-111 342 38 8 506 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M360 8.57e-12 71 26 6 255 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q81HW8 6.16e-110 338 37 6 500 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1J3P2 7.06e-110 338 38 5 496 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q73DH7 8.46e-110 338 37 7 502 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9CL63 9.25e-110 339 38 7 506 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q5KUX3 1.19e-109 338 38 10 510 3 rbsA Ribose import ATP-binding protein RbsA Geobacillus kaustophilus (strain HTA426)
Q87ZE0 3.2e-109 338 39 8 505 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87ZE0 1.07e-11 70 25 3 229 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1GHE5 5.76e-109 337 38 8 506 3 rbsA Ribose import ATP-binding protein RbsA Ruegeria sp. (strain TM1040)
Q0TPX5 1.16e-108 335 35 7 507 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8ENB3 1.65e-108 335 37 5 502 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8XJX3 1.85e-108 335 35 7 507 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q0BG60 2.11e-108 336 37 5 505 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BG60 4.71e-13 75 27 4 228 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q13LX0 2.76e-108 335 38 9 515 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q0SSJ0 4.38e-108 334 35 7 507 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q8Y003 1.15e-107 333 37 6 505 3 RSc1242 Putative ribose/galactose/methyl galactoside import ATP-binding protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y003 3.47e-11 69 26 3 229 3 RSc1242 Putative ribose/galactose/methyl galactoside import ATP-binding protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q92TS8 4.29e-107 332 37 6 507 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q92TS8 1.21e-12 73 27 3 229 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q9RDI1 5.66e-107 332 40 6 507 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q48GY7 1.78e-106 331 38 6 502 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48GY7 5.34e-13 75 26 6 271 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6DB87 2.4e-106 330 37 6 507 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9CF44 2.4e-106 329 37 5 498 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q5WC31 2.52e-106 330 37 5 499 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q82CM5 2.68e-106 330 39 8 514 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q2SMT0 5.94e-106 329 37 6 502 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q2SMT0 4.77e-12 72 26 9 263 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q13FD9 6.19e-106 328 37 6 507 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q13FD9 5e-14 78 27 5 252 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q13FD9 2.69e-09 63 23 4 227 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q1BX03 6.5e-106 329 37 6 505 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
Q1BX03 3.49e-13 75 27 7 259 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
A0K6Q0 6.5e-106 329 37 6 505 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
A0K6Q0 3.49e-13 75 27 7 259 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
Q1AXG5 8.95e-106 328 39 9 506 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AXG5 1.22e-17 89 26 5 244 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q39HA1 9.08e-106 329 37 5 505 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39HA1 2.84e-12 72 26 5 248 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8U9B0 9.15e-106 328 38 6 503 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1MAA2 9.9e-106 328 37 7 505 3 RL4654 Putative ribose/galactose/methyl galactoside import ATP-binding protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MAA2 1.12e-10 67 24 4 240 3 RL4654 Putative ribose/galactose/methyl galactoside import ATP-binding protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q891M1 1.18e-105 328 34 6 504 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 1.12e-13 77 24 3 224 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q0S9A4 1.26e-105 328 36 8 514 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q02XM9 1.63e-105 327 36 5 502 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q2K353 4.18e-105 327 38 7 505 3 RHE_CH03989 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K353 5.11e-11 68 26 5 240 3 RHE_CH03989 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8NR12 6.2e-105 327 36 6 525 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8UBN2 6.58e-105 326 38 7 508 3 Atu2819 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5PJX5 1.05e-104 325 37 7 507 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9KAG5 1.22e-104 326 36 8 511 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KAG5 4.89e-14 78 27 5 235 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q65E55 1.54e-104 325 36 4 501 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q3YVK8 1.62e-104 325 37 7 506 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
P04983 1.62e-104 325 37 7 506 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
Q0TAW0 1.62e-104 325 37 7 506 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P36947 1.64e-104 325 35 6 498 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P36947 3.33e-14 78 25 4 239 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
Q8X5Q4 1.8e-104 325 36 6 513 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q1R4I3 2.15e-104 325 37 6 506 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q8FBS3 3.34e-104 324 37 7 506 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1CDJ0 5.67e-104 323 37 5 506 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG00 5.67e-104 323 37 5 506 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q1C1B8 5.67e-104 323 37 5 506 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q664G2 6.67e-104 323 38 6 502 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q57HW1 7.01e-104 323 37 7 507 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q8ZKV9 8.97e-104 323 37 7 507 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4ZRC6 1.24e-103 323 37 4 501 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q4ZRC6 2.99e-13 75 26 4 252 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q8XAW7 1.86e-103 322 37 7 506 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q4QN44 3.83e-103 321 37 5 505 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
Q9KN37 6.57e-103 321 37 6 507 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8Z2R4 6.77e-103 321 37 7 507 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q8E7N9 7.98e-103 320 36 5 499 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q8UAK2 1.16e-102 320 37 6 505 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UAK2 3.72e-11 68 25 4 233 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1ARR5 1.57e-102 320 36 4 505 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q5KYQ7 1.95e-102 320 37 10 504 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 2.1e-15 82 25 7 252 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q6LH11 3.95e-102 319 36 5 509 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
P44735 6.54e-102 318 36 4 505 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1BWN5 1.07e-101 318 38 12 523 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia orbicola (strain AU 1054)
A0K718 1.07e-101 318 38 12 523 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia cenocepacia (strain HI2424)
Q3K3R2 1.33e-101 317 35 5 499 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5E4V6 1.72e-101 317 36 5 509 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3JHZ1 2e-101 317 38 9 505 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q3JHZ1 2.23e-10 66 27 7 233 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q63P06 4.37e-101 317 38 9 505 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q63P06 6.03e-11 68 27 7 233 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q8E281 1.02e-100 315 35 5 499 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q39GY8 1.32e-100 315 37 12 525 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2T8T6 1.41e-100 315 38 9 505 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T8T6 3.88e-09 62 25 7 229 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9CP98 3.86e-100 313 35 7 512 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q1BQ82 4.71e-100 314 38 11 522 3 Bcen_3328 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia orbicola (strain AU 1054)
A0B297 4.71e-100 314 38 11 522 3 Bcen2424_5039 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia cenocepacia (strain HI2424)
Q329G7 5.67e-100 313 37 7 501 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q399X3 7e-100 313 37 9 524 3 Bcep18194_B0624 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9X051 9.69e-100 313 35 10 530 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 3.07e-18 91 25 5 254 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 1.18e-09 64 25 5 231 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q21TR5 9.72e-100 313 40 9 502 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0BFU0 1.07e-99 313 37 12 519 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q9WXX0 4.12e-99 311 35 7 514 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0B775 7.63e-99 311 37 9 519 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q87H79 1.53e-98 310 35 7 506 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MEV1 5.43e-98 308 36 5 504 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q8D7T7 6.65e-98 308 35 5 504 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q2K204 9.65e-98 308 37 10 508 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K204 1.41e-11 70 27 5 235 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2SJ99 6.89e-97 305 36 7 518 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q2SJ99 6.58e-14 77 26 3 225 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q2SJ99 1.99e-13 76 26 6 240 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q2KAW9 8.88e-97 306 35 6 513 3 RHE_CH01212 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1M5X4 1.15e-96 305 34 4 502 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 2e-16 85 28 5 237 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q7NA79 1.66e-96 304 36 7 508 3 rbsA Ribose import ATP-binding protein RbsA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8RBQ1 1.77e-96 304 34 6 502 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RBQ1 8.32e-16 83 27 3 231 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RBQ1 3.57e-13 75 24 2 225 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q03CA4 2.32e-95 301 34 6 502 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q0BGD7 2.81e-95 301 38 10 505 3 Bamb_1228 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q11C01 3.72e-95 301 35 8 507 3 rbsA Ribose import ATP-binding protein RbsA Chelativorans sp. (strain BNC1)
Q6LK34 3.93e-95 300 36 7 509 3 mglA1 Galactose/methyl galactoside import ATP-binding protein MglA 1 Photobacterium profundum (strain SS9)
Q6LK34 4.21e-10 65 24 3 224 3 mglA1 Galactose/methyl galactoside import ATP-binding protein MglA 1 Photobacterium profundum (strain SS9)
Q8UA86 7.41e-95 300 35 8 516 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA86 2.82e-15 82 27 5 240 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6LUY1 1.03e-94 300 35 7 514 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 2.49e-10 66 25 5 224 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6BEX0 1.55e-94 299 35 8 512 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
Q6BEX0 5.38e-11 68 25 4 247 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
Q6BEX0 6.19e-11 68 24 6 248 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
P63299 1.92e-94 299 35 8 512 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
P63299 5.77e-11 68 25 4 247 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
P63299 6.58e-11 68 24 6 248 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
Q2K0S7 2.81e-94 299 34 6 506 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2RGX2 2.89e-94 298 37 9 510 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q92UI2 2.99e-94 298 35 8 505 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q92UI2 3.6e-14 78 31 8 237 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q2NUD6 3.48e-94 298 34 8 503 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Sodalis glossinidius (strain morsitans)
Q2NUD6 3.8e-11 68 23 3 234 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Sodalis glossinidius (strain morsitans)
Q8U949 4.13e-94 298 36 9 508 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7NTN6 1.29e-93 297 36 8 504 3 rbsA Ribose import ATP-binding protein RbsA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q92S10 1.37e-93 296 34 6 509 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q1BGC0 3.9e-93 296 37 8 506 3 Bcen_6474 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia orbicola (strain AU 1054)
A0KE25 3.9e-93 296 37 8 506 3 Bcen2424_6709 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia cenocepacia (strain HI2424)
Q896Y2 8.51e-93 295 33 7 509 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q896Y2 2.25e-13 75 24 4 229 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q896Y2 1.56e-12 73 25 6 228 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q0BIE1 1.03e-92 295 36 10 509 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0TQU8 1.39e-92 295 34 8 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TQU8 7.13e-17 87 23 3 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q3JNJ9 1.66e-92 294 35 10 508 3 araG Arabinose import ATP-binding protein AraG Burkholderia pseudomallei (strain 1710b)
Q8XKQ2 1.87e-92 294 34 9 508 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q8XKQ2 5.36e-17 87 23 3 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q63QQ7 2.19e-92 293 35 10 508 3 araG Arabinose import ATP-binding protein AraG Burkholderia pseudomallei (strain K96243)
Q164K3 4.77e-92 293 35 5 503 3 rbsA Ribose import ATP-binding protein RbsA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6VMN4 6.33e-92 292 33 8 515 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q7UU57 6.72e-92 293 34 5 504 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UU57 1.17e-12 73 25 7 254 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UU57 1.4e-12 73 25 4 228 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q31YV7 7.09e-92 292 33 6 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella boydii serotype 4 (strain Sb227)
Q31YV7 2.11e-12 72 25 2 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella boydii serotype 4 (strain Sb227)
P32721 7.75e-92 292 34 9 518 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
Q0TGT7 9.96e-92 292 34 7 507 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGT7 3.73e-13 75 27 5 229 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0ST95 1.08e-91 292 34 8 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q0ST95 3.45e-16 84 23 3 244 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q322L1 1.14e-91 292 34 7 507 3 araG Arabinose import ATP-binding protein AraG Shigella boydii serotype 4 (strain Sb227)
Q322L1 1e-12 73 27 5 229 3 araG Arabinose import ATP-binding protein AraG Shigella boydii serotype 4 (strain Sb227)
P23924 1.61e-91 291 33 8 506 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23924 5.43e-12 71 24 2 221 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q13U53 2.32e-91 291 35 10 510 3 araG Arabinose import ATP-binding protein AraG Paraburkholderia xenovorans (strain LB400)
Q13U53 4.98e-15 81 28 5 229 3 araG Arabinose import ATP-binding protein AraG Paraburkholderia xenovorans (strain LB400)
P0AAF3 2.44e-91 291 34 7 507 1 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain K12)
P0AAF3 9.18e-13 73 27 5 229 1 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain K12)
P0AAF4 2.44e-91 291 34 7 507 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF4 9.18e-13 73 27 5 229 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF5 2.44e-91 291 34 7 507 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O157:H7
P0AAF5 9.18e-13 73 27 5 229 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O157:H7
Q32HC7 3.48e-91 290 34 7 507 3 araG Arabinose import ATP-binding protein AraG Shigella dysenteriae serotype 1 (strain Sd197)
Q32HC7 9.76e-13 73 27 5 229 3 araG Arabinose import ATP-binding protein AraG Shigella dysenteriae serotype 1 (strain Sd197)
Q62GY9 3.49e-91 290 34 10 508 3 araG Arabinose import ATP-binding protein AraG Burkholderia mallei (strain ATCC 23344)
Q8D4H4 3.55e-91 290 33 9 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain CMCP6)
Q8D4H4 1.47e-09 63 22 5 227 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain CMCP6)
Q3Z057 3.64e-91 290 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella sonnei (strain Ss046)
Q3Z057 3.78e-12 72 25 2 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella sonnei (strain Ss046)
P0AAG9 3.64e-91 290 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri
P0AAG9 3.78e-12 72 25 2 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri
P0AAG8 3.64e-91 290 33 7 506 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain K12)
P0AAG8 3.78e-12 72 25 2 221 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain K12)
Q2SZC2 4.23e-91 290 35 8 498 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0T2X5 4.32e-91 290 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri serotype 5b (strain 8401)
Q0T2X5 6.25e-12 71 24 2 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri serotype 5b (strain 8401)
Q7MG07 4.34e-91 290 33 9 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain YJ016)
Q7MG07 1.47e-09 63 22 5 227 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain YJ016)
Q1RAN8 4.79e-91 290 34 7 507 3 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain UTI89 / UPEC)
Q1RAN8 3.83e-13 75 27 5 229 3 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain UTI89 / UPEC)
Q8FFU7 6.08e-91 290 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FFU7 3.82e-12 72 25 2 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFU2 6.08e-91 290 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TFU2 3.82e-12 72 25 2 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q39JR1 6.36e-91 290 35 11 508 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39JR1 1.34e-14 79 25 4 240 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q663Y5 6.64e-91 290 34 9 522 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDC0 6.64e-91 290 34 9 522 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CFR2 6.64e-91 290 34 9 522 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q1C0D5 6.64e-91 290 34 9 522 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q1BZA2 1.23e-90 289 35 10 509 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia orbicola (strain AU 1054)
A0K4E8 1.23e-90 289 35 10 509 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia cenocepacia (strain HI2424)
Q8X5D9 1.24e-90 289 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O157:H7
Q8X5D9 3.14e-12 72 25 2 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O157:H7
Q3Z2S7 1.27e-90 289 34 7 507 3 araG Arabinose import ATP-binding protein AraG Shigella sonnei (strain Ss046)
Q3Z2S7 9.76e-13 73 27 5 229 3 araG Arabinose import ATP-binding protein AraG Shigella sonnei (strain Ss046)
Q3J3V9 2.07e-90 288 35 11 507 3 rbsA Ribose import ATP-binding protein RbsA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q1JUP7 3.98e-90 288 33 7 506 3 araG Arabinose import ATP-binding protein AraG Azospirillum brasilense
Q1JUP7 2.52e-13 75 25 3 235 3 araG Arabinose import ATP-binding protein AraG Azospirillum brasilense
Q83KP2 6.36e-90 287 34 7 503 3 araG Arabinose import ATP-binding protein AraG Shigella flexneri
Q8REE1 6.76e-90 287 32 9 512 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8REE1 9.33e-12 70 22 6 258 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1R9S4 1.33e-89 286 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain UTI89 / UPEC)
Q1R9S4 3.65e-12 72 25 2 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain UTI89 / UPEC)
Q6D4W8 2.83e-89 286 34 8 505 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q39BJ8 3.29e-89 286 33 7 508 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39BJ8 1.51e-14 79 25 3 239 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q987E7 3.98e-89 285 35 7 510 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0I348 4.89e-89 285 35 10 513 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q6LG59 5.83e-89 285 33 10 508 3 mglA2 Galactose/methyl galactoside import ATP-binding protein MglA 2 Photobacterium profundum (strain SS9)
Q6LG59 2.87e-10 66 23 2 225 3 mglA2 Galactose/methyl galactoside import ATP-binding protein MglA 2 Photobacterium profundum (strain SS9)
Q1BJW2 6.13e-89 285 33 9 507 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
Q1BJW2 4.86e-13 75 24 3 235 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
A0B3Z7 6.13e-89 285 33 9 507 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
A0B3Z7 4.86e-13 75 24 3 235 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
Q66C83 8.53e-89 284 32 9 509 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66C83 4.24e-13 75 24 2 226 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGT1 8.53e-89 284 32 9 509 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CGT1 4.24e-13 75 24 2 226 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CHQ3 8.53e-89 284 32 9 509 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis
Q7CHQ3 4.24e-13 75 24 2 226 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis
Q1C9V1 8.53e-89 284 32 9 509 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C9V1 4.24e-13 75 24 2 226 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Antiqua)
Q9KSD1 1.09e-88 284 32 9 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KSD1 8.68e-11 67 23 5 238 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1BG93 1.13e-88 285 36 10 529 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
A0KE53 1.13e-88 285 36 10 529 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
Q2SW38 2.4e-88 283 36 10 522 3 xylG Xylose import ATP-binding protein XylG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0B5V4 3.11e-88 283 33 7 506 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B5V4 5.04e-13 75 24 3 239 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q576H3 5.51e-88 282 33 8 511 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q2YJE7 5.51e-88 282 33 8 511 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q88J90 6.03e-88 282 35 9 516 3 rbsA Ribose import ATP-binding protein RbsA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6DB03 7.84e-88 282 33 8 514 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q87FK7 1.06e-87 281 34 10 498 3 araG Arabinose import ATP-binding protein AraG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8XVS2 1.21e-87 281 35 8 513 3 araG Arabinose import ATP-binding protein AraG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XVS2 7.26e-14 77 29 8 241 3 araG Arabinose import ATP-binding protein AraG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P45046 2.86e-87 280 35 10 514 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q13RB6 2.98e-87 281 34 9 526 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q8YDN0 3.34e-87 280 33 8 511 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q398W2 4.01e-87 280 36 7 506 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P44884 4.06e-87 280 31 8 508 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44884 4.47e-12 72 23 4 252 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QM77 4.06e-87 280 31 8 508 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain 86-028NP)
Q4QM77 4.47e-12 72 23 4 252 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain 86-028NP)
Q65WJ1 5.29e-87 280 32 7 505 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q66AF5 6.55e-87 280 35 10 506 3 araG Arabinose import ATP-binding protein AraG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CIX6 6.55e-87 280 35 10 506 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WER5 6.55e-87 280 35 10 506 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis
Q1C7J0 6.55e-87 280 35 10 506 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Antiqua)
Q8G847 2.43e-86 278 34 7 496 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 7.77e-14 77 23 3 222 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q73KK2 2.62e-86 278 32 7 500 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8FUR8 2.64e-86 278 33 8 511 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
Q1BPL3 3.81e-86 278 36 6 506 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia orbicola (strain AU 1054)
A0B1M7 3.81e-86 278 36 6 506 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia cenocepacia (strain HI2424)
Q83J33 4.31e-86 278 34 11 522 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q0B1U4 6.46e-86 277 35 10 518 3 xylG Xylose import ATP-binding protein XylG Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q28P50 7.31e-86 277 33 6 503 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q2SVU4 7.94e-86 276 35 8 518 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVU4 4.88e-12 72 23 3 249 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1R528 1.31e-85 276 33 9 519 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q92MP8 1.43e-85 276 38 8 497 3 R02565 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium meliloti (strain 1021)
Q92MP8 5.25e-08 58 25 6 235 3 R02565 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium meliloti (strain 1021)
Q0B7X0 1.59e-85 276 35 7 514 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0SY86 3.59e-85 275 34 9 519 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q9CM08 4.27e-85 275 31 10 509 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Pasteurella multocida (strain Pm70)
Q9CM08 4.72e-10 65 22 3 249 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Pasteurella multocida (strain Pm70)
Q2T4S8 5.31e-85 275 33 7 506 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4S8 2e-14 79 25 3 239 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q31V51 7.64e-85 274 33 9 519 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8XDM1 7.64e-85 274 33 9 519 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q65UW1 8.01e-85 274 31 10 511 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UW1 3.39e-09 62 23 3 230 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9S472 1.03e-84 274 34 10 507 3 araG L-arabinose transport ATP-binding protein AraG Geobacillus stearothermophilus
Q9S472 3.87e-07 56 25 6 235 3 araG L-arabinose transport ATP-binding protein AraG Geobacillus stearothermophilus
Q1MBG4 1.31e-84 273 34 11 497 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MBG4 6.58e-13 74 27 5 228 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P37388 1.68e-84 273 33 9 519 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q8FCE2 1.73e-84 273 33 9 519 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 1.73e-84 273 33 9 519 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1MHS1 2.16e-84 273 33 9 519 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q48IS7 3.43e-84 272 34 10 518 3 araG Arabinose import ATP-binding protein AraG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9K7C3 4.47e-84 272 33 7 501 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8XPK6 5.8e-84 272 34 10 511 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XPK6 1.34e-14 79 29 5 231 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q56342 6.51e-84 271 32 7 505 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q3K8M7 7.82e-84 272 33 7 515 3 araG Arabinose import ATP-binding protein AraG Pseudomonas fluorescens (strain Pf0-1)
Q92W56 7.9e-84 271 32 9 515 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q4ZTW1 4.45e-83 270 33 10 518 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. syringae (strain B728a)
Q882I8 5.93e-83 269 34 10 506 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZSF3 7.36e-83 269 34 9 508 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. syringae (strain B728a)
Q880Z2 1.21e-82 269 35 11 510 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q880Z2 1.68e-13 76 26 4 239 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
D4GPW3 1.52e-82 270 34 11 525 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GPW3 4.93e-16 84 26 5 234 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GPW3 6.26e-12 71 28 5 250 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q5KYS1 2.23e-82 268 32 9 509 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q48J74 2.69e-82 268 34 10 509 3 xylG Xylose import ATP-binding protein XylG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48J74 1.58e-12 73 25 4 239 3 xylG Xylose import ATP-binding protein XylG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2K3Y7 3.47e-82 267 33 11 497 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K3Y7 5.7e-13 74 26 5 236 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3KDW2 3.87e-81 265 34 8 507 3 xylG Xylose import ATP-binding protein XylG Pseudomonas fluorescens (strain Pf0-1)
Q62K91 1.8e-80 263 35 6 507 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia mallei (strain ATCC 23344)
Q62K91 1.84e-12 73 25 5 252 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia mallei (strain ATCC 23344)
Q98K15 2.66e-80 263 32 8 528 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P77509 1.77e-79 260 33 13 516 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
Q1QYT1 7.44e-79 258 33 9 484 3 araG Arabinose import ATP-binding protein AraG Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1QYT1 4.96e-15 81 27 6 214 3 araG Arabinose import ATP-binding protein AraG Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2K9A3 9.62e-76 251 32 9 519 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3JSI8 1.28e-75 258 35 6 502 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia pseudomallei (strain 1710b)
Q3JSI8 2.13e-11 70 26 7 252 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia pseudomallei (strain 1710b)
O05253 2.42e-75 249 33 8 482 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 5.7e-14 77 26 5 229 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 3.05e-07 56 24 4 229 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
A2RKA7 6.84e-68 229 32 10 489 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
P55570 8.65e-64 219 32 14 510 3 NGR_a02480 Uncharacterized ABC transporter ATP-binding protein y4mK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P75516 3.65e-61 213 30 11 550 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75516 1.17e-08 61 22 4 249 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75516 5.72e-08 58 24 5 224 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47365 1.68e-57 203 29 12 541 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47365 9.84e-10 64 26 4 233 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47365 1.52e-06 54 24 4 211 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9F9B0 6.14e-32 126 30 3 254 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
Q9F9B0 1.17e-08 59 26 5 210 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
P0DTT6 9.95e-32 125 30 3 240 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P0DTT6 1.82e-13 73 23 2 228 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q0S0Z3 1.99e-30 124 32 4 219 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0S0Z3 4.45e-14 77 26 3 205 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0SBZ1 3.92e-30 124 32 4 219 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q0SBZ1 3.57e-13 74 27 4 207 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q0RYP7 1.4e-28 119 32 5 220 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q0RYP7 7.88e-13 73 27 4 207 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q73P93 3.19e-28 120 24 10 481 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 2.84e-11 69 24 3 218 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 3.42e-08 59 25 5 229 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q49WM4 2.46e-27 116 30 6 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49WM4 6.14e-10 64 22 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q72FW5 4.56e-27 115 32 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72FW5 3.3e-13 74 27 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q4L5B3 5.77e-27 115 32 8 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q4L5B3 6.84e-07 55 21 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q3KCC5 8.87e-27 114 33 5 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q3KCC5 5.71e-09 61 26 6 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q8ES39 1.08e-26 117 23 17 523 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q81CT8 1.09e-26 117 22 14 520 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 7.81e-12 71 25 3 201 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1RE96 5.05e-26 115 26 18 524 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q1RE96 5.47e-08 59 23 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q04G50 5.36e-26 112 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04G50 1.46e-09 63 21 8 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q03ZQ0 5.44e-26 112 32 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZQ0 2.53e-10 65 23 4 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8DUF7 5.96e-26 112 31 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DUF7 9.9e-12 70 23 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q0TJM0 7.83e-26 115 26 18 524 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJM0 6.13e-08 58 23 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q323W5 8.04e-26 115 26 18 527 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q323W5 1.39e-07 57 23 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
P21410 1.39e-25 110 34 5 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
P21410 1.53e-10 66 27 6 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q8FJL0 1.42e-25 114 26 18 527 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJL0 1.01e-07 58 23 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5HQ70 1.49e-25 111 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HQ70 1.16e-08 60 20 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q83LT3 1.76e-25 114 26 18 527 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q83LT3 1.23e-06 55 22 7 236 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q3Z3V4 1.81e-25 114 26 18 527 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
Q3Z3V4 1.47e-07 57 23 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
P75796 1.81e-25 114 26 18 527 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
P75796 1.41e-07 57 23 7 239 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
Q1CJS9 2.22e-25 110 33 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJS9 1.91e-12 72 27 5 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 2.22e-25 110 33 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q8ZCM2 1.91e-12 72 27 5 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 2.22e-25 110 33 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C607 1.91e-12 72 27 5 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q668Q3 2.24e-25 110 33 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668Q3 2.04e-12 72 27 5 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
A1A967 2.65e-25 113 26 18 524 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
A1A967 5e-07 56 23 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
Q32IB5 3.96e-25 112 26 19 527 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q32IB5 4.33e-08 59 24 6 239 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q1J6Q6 4.36e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1J6Q6 3.13e-12 71 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 4.36e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JGY7 3.13e-12 71 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 4.36e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JLT7 3.13e-12 71 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 4.36e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JBV6 3.13e-12 71 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5JEB0 4.83e-25 109 31 5 222 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JEB0 3.18e-14 77 31 6 205 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8X6W1 4.84e-25 112 26 18 527 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q8X6W1 8.67e-08 58 24 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q5XCA4 5.33e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5XCA4 2.55e-12 72 23 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ35 5.64e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ35 2.35e-12 72 23 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 5.64e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q48TP4 2.35e-12 72 23 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 5.64e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0CZ34 2.35e-12 72 23 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q7CN92 5.69e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7CN92 3.59e-12 71 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 5.69e-25 110 32 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q99ZS8 3.59e-12 71 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q39GT7 5.81e-25 108 30 4 222 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 1.85e-11 68 27 5 220 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0T6D3 6.84e-25 112 25 18 527 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q0T6D3 1.24e-06 55 22 7 236 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q8PUE7 7.63e-25 111 25 17 477 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 1.49e-11 70 25 6 222 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8CPN0 1e-24 108 29 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CPN0 6.97e-08 58 20 7 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A9CKL2 1.06e-24 111 27 22 526 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 3.21e-14 79 26 10 287 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 1.44e-10 67 29 8 214 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8DZJ0 1.13e-24 108 32 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DZJ0 9.99e-12 70 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.13e-24 108 32 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q8E554 9.99e-12 70 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.13e-24 108 32 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K0Y6 9.99e-12 70 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8U4K3 1.45e-24 108 31 5 222 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4K3 5.01e-13 73 30 6 209 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q1GB17 2.11e-24 107 31 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1GB17 2.57e-10 65 22 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P37624 2.23e-24 111 23 12 499 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 5.2e-13 75 23 6 284 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q6F0V4 2.93e-24 107 33 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q6F0V4 2.31e-12 72 25 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q73XU8 3.34e-24 107 31 3 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73XU8 4.98e-08 58 25 5 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A3CMQ7 3.36e-24 107 31 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
A3CMQ7 1.14e-12 73 24 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q04BG2 4.37e-24 107 31 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q04BG2 3.42e-10 65 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q58663 4.7e-24 104 27 1 233 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58663 2.05e-07 55 23 4 209 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P9WQM1 5.44e-24 106 32 4 210 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM1 9.31e-09 60 24 4 205 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 5.44e-24 106 32 4 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQM0 9.31e-09 60 24 4 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 5.44e-24 106 32 4 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4W3 9.31e-09 60 24 4 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8ELR4 5.7e-24 107 27 7 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ELR4 6.66e-12 70 20 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P44531 6.05e-24 105 28 3 222 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44531 4.28e-12 70 26 6 215 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8KLG1 6.41e-24 105 30 3 207 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 6.6e-14 76 29 6 220 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8XXY9 6.78e-24 105 30 4 230 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 1.88e-15 80 30 8 261 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P33916 6.8e-24 108 25 17 505 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 1.13e-10 67 27 8 225 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P96063 7.2e-24 106 31 3 208 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P96063 1.11e-10 67 25 6 207 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P94440 7.55e-24 105 27 3 232 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 1.38e-12 72 27 8 222 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q6MCV4 7.68e-24 106 31 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q6MCV4 3.52e-12 71 25 5 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q38VW6 7.85e-24 106 31 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q38VW6 2.75e-11 68 23 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
P0A9S9 1.02e-23 103 30 6 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S9 3.12e-13 73 28 5 213 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 1.02e-23 103 30 6 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S7 3.12e-13 73 28 5 213 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 1.02e-23 103 30 6 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
P0A9S8 3.12e-13 73 28 5 213 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
P23703 1.14e-23 105 31 5 216 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 1.8e-11 68 29 6 205 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5PFQ7 1.24e-23 105 31 3 208 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PFQ7 9.33e-11 67 25 6 207 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5L222 1.24e-23 105 30 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 1.07e-12 72 22 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q1BWI2 1.31e-23 104 28 3 246 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 1.22e-11 69 28 5 226 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
P56344 1.32e-23 102 30 3 217 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P56344 6.31e-09 60 22 5 214 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q57SD6 1.44e-23 105 31 3 208 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q57SD6 2.27e-10 65 24 6 207 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q8Z8W8 1.53e-23 105 30 3 211 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q8Z8W8 1.01e-10 67 25 6 207 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q4KC87 1.74e-23 105 33 4 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KC87 1.29e-09 63 27 7 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q14Q07 1.8e-23 105 33 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 6.39e-12 70 23 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8DPC2 1.9e-23 105 31 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DPC2 9.1e-12 70 21 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.9e-23 105 31 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97Q42 9.1e-12 70 21 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.9e-23 105 31 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04JW0 9.1e-12 70 21 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q92WJ0 2.66e-23 104 28 3 218 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q92WJ0 4.49e-13 73 27 5 228 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
P21629 3.34e-23 102 28 4 253 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P21629 8.87e-14 74 26 5 210 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7AH43 3.41e-23 104 27 4 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q7AH43 1.28e-14 79 29 6 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
P31134 3.52e-23 104 30 5 226 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P31134 3.47e-12 71 24 5 224 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
O28881 3.8e-23 102 25 2 228 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28881 4.16e-05 48 21 6 232 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q03JH1 4.24e-23 104 31 7 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q03JH1 2.75e-13 75 24 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q7A169 4.45e-23 103 31 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q7A169 1.41e-06 54 21 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 4.45e-23 103 31 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GAB5 1.41e-06 54 21 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 4.45e-23 103 31 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q6GHY6 1.41e-06 54 21 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 4.45e-23 103 31 6 239 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q7A679 1.41e-06 54 21 4 195 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 4.45e-23 103 31 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99V03 1.41e-06 54 21 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 4.45e-23 103 31 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q5HGY5 1.41e-06 54 21 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 4.45e-23 103 31 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YX74 1.41e-06 54 21 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 4.45e-23 103 31 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2G2A7 1.41e-06 54 21 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 4.45e-23 103 31 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q2FHY1 1.41e-06 54 21 4 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q1QE80 4.48e-23 104 30 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QE80 1.38e-11 70 24 6 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q5LYN4 4.57e-23 104 31 7 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5LYN4 2.34e-13 75 24 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5M397 4.88e-23 104 31 7 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M397 2.22e-13 75 24 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A1TXH7 5.22e-23 103 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TXH7 1.51e-08 60 23 4 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q7N6Z2 5.44e-23 103 32 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N6Z2 9.72e-11 67 24 4 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q88ZJ6 6.11e-23 103 32 6 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZJ6 2.82e-16 84 25 5 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q63TX3 7.19e-23 102 29 3 221 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 4.33e-13 73 28 6 242 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q65S66 7.35e-23 103 28 4 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65S66 4.42e-13 73 26 6 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8Z7H7 7.39e-23 103 29 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q8Z7H7 8.79e-11 67 24 5 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q5PMK1 7.82e-23 103 29 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PMK1 7.61e-11 67 24 5 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9HY19 7.91e-23 103 30 4 215 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HY19 2.77e-17 87 31 7 220 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3JSQ0 7.91e-23 102 29 3 221 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 4.46e-13 73 28 6 242 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 7.91e-23 102 29 3 221 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 4.46e-13 73 28 6 242 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q02R79 8.06e-23 103 30 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02R79 2.72e-17 87 31 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1RD28 9.27e-23 103 29 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
Q1RD28 7.48e-11 67 23 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 9.27e-23 103 29 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
A1AA20 7.48e-11 67 23 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q5FA19 9.28e-23 103 33 6 214 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 3.64e-13 74 28 7 222 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q32EY4 9.45e-23 103 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q32EY4 4.33e-11 68 24 5 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
P40790 1e-22 103 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40790 8.63e-11 67 24 5 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 1e-22 103 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q57QC8 8.63e-11 67 24 5 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q57293 1.15e-22 102 27 3 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q57293 1.17e-13 75 26 6 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
P24693 1.22e-22 100 28 2 230 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P24693 5.56e-12 69 28 5 194 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
Q6D2F6 1.29e-22 102 33 5 212 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D2F6 1.47e-11 69 26 5 207 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8TQW9 1.49e-22 104 23 13 478 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQW9 2.59e-16 85 28 7 237 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q0I2Z4 1.5e-22 102 27 3 221 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q0I2Z4 6.64e-14 76 27 6 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
P69877 1.6e-22 102 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69877 6.96e-11 67 23 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.6e-22 102 30 5 224 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69874 6.96e-11 67 23 4 201 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.6e-22 102 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69875 6.96e-11 67 23 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.6e-22 102 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIU8 6.96e-11 67 23 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.6e-22 102 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
P69876 6.96e-11 67 23 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q0AGF4 1.67e-22 102 28 5 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0AGF4 1.15e-09 63 25 5 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q7NQN5 1.79e-22 102 31 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NQN5 1.42e-11 69 28 5 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2SVP3 1.95e-22 101 28 3 221 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 1.47e-13 75 28 6 241 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q73R11 2.21e-22 103 24 17 510 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A0PY57 2.41e-22 101 28 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
A0PY57 1.99e-14 78 25 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
P74548 2.64e-22 101 32 4 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74548 7.86e-10 64 24 5 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5FL41 2.83e-22 101 28 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5FL41 5.9e-10 64 20 4 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q47C66 3.23e-22 98 32 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q47C66 3.23e-11 66 30 5 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q82JY6 3.8e-22 101 30 7 272 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82JY6 7.33e-13 73 30 6 196 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9CM80 4.13e-22 100 26 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q9CM80 1.52e-13 75 26 6 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q2W1R8 4.14e-22 101 32 6 211 3 modC Molybdenum import ATP-binding protein ModC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W1R8 2.49e-09 62 28 7 223 3 modC Molybdenum import ATP-binding protein ModC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q7NWX3 4.31e-22 101 28 6 273 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 3.45e-12 71 28 5 200 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1B8V9 4.34e-22 101 29 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
Q1B8V9 1.49e-09 63 24 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 4.34e-22 101 29 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
A1UG51 1.49e-09 63 24 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
P72335 4.53e-22 100 30 2 206 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 1.29e-12 72 27 4 233 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
O28882 5.55e-22 98 28 3 208 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28882 1.19e-07 56 23 6 210 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P33982 5.68e-22 99 27 1 215 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P33982 1.29e-17 86 29 4 201 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q93D97 5.97e-22 102 22 17 522 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93D97 4.79e-06 52 25 6 221 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q74K65 6.21e-22 100 28 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74K65 8.72e-13 73 23 5 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q30V33 6.55e-22 100 27 5 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q30V33 9.57e-15 79 28 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
P37009 6.74e-22 100 27 4 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P37009 2.76e-13 74 28 6 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q3Z2Z3 6.96e-22 100 29 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q3Z2Z3 3.65e-11 68 23 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 6.96e-22 100 29 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q31ZK0 3.65e-11 68 23 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
P25885 7.18e-22 98 26 1 223 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
P25885 7.05e-18 87 28 3 212 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
Q0T5R2 7.3e-22 100 30 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q0T5R2 1.4e-10 66 22 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q82TL6 7.96e-22 100 29 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82TL6 7.56e-10 64 23 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q2K2X0 8.63e-22 100 31 4 194 3 modC Molybdenum import ATP-binding protein ModC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K2X0 4.78e-06 52 24 4 194 3 modC Molybdenum import ATP-binding protein ModC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1WVI7 8.86e-22 100 29 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q1WVI7 2.46e-15 81 24 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q6HLQ9 9.26e-22 99 27 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HLQ9 1.45e-09 63 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6LR20 9.33e-22 100 26 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q6LR20 1.34e-08 60 24 5 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
P0A193 9.63e-22 97 29 5 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A193 1.46e-11 68 27 7 218 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 9.63e-22 97 29 5 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
P0A194 1.46e-11 68 27 7 218 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
Q63E84 9.81e-22 99 27 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q63E84 1.29e-09 63 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 9.81e-22 99 27 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73BM0 1.29e-09 63 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 9.81e-22 99 27 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
A0RBB0 1.29e-09 63 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q81GC1 1.07e-21 99 28 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GC1 8.21e-10 63 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2SSS4 1.11e-21 99 30 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 3.75e-15 80 25 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
O86751 1.22e-21 99 34 4 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O86751 2.56e-13 74 31 7 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5E586 1.35e-21 100 28 3 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E586 4.27e-10 65 24 5 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1LKJ2 1.43e-21 98 29 3 227 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 5.2e-13 73 30 4 212 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q81TH8 1.61e-21 99 27 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q81TH8 7.29e-10 63 26 7 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q6D4E2 1.62e-21 99 29 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4E2 7.58e-09 61 22 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6MU19 1.86e-21 99 29 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 2.62e-15 80 25 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
P0A191 2.14e-21 96 23 2 232 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A191 4.47e-14 75 26 2 203 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 2.14e-21 96 23 2 232 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
P0A192 4.47e-14 75 26 2 203 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
Q9I6T2 2.16e-21 99 28 3 214 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6T2 7.5e-10 64 24 6 208 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7MKU3 2.37e-21 99 26 4 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q7MKU3 4.96e-09 62 24 4 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 2.37e-21 99 26 4 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8D9J4 4.96e-09 62 24 4 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q03AH0 2.43e-21 99 28 4 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03AH0 3.49e-13 74 25 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q609Q1 2.68e-21 98 31 4 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 4.61e-10 64 27 7 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q4W575 2.85e-21 98 32 6 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 1.62e-12 72 28 7 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 2.85e-21 98 32 6 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 1.62e-12 72 28 7 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q93DX8 2.93e-21 96 28 4 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q93DX8 9.31e-14 75 27 4 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q6LKD4 2.95e-21 98 26 3 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q6LKD4 3.9e-14 77 27 9 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q1MA70 3e-21 98 30 3 192 3 modC Molybdenum import ATP-binding protein ModC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MA70 2.32e-07 56 26 4 199 3 modC Molybdenum import ATP-binding protein ModC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P44513 3.04e-21 98 33 8 222 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44513 3.89e-14 77 27 7 227 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8FYU9 3.33e-21 96 29 5 237 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8FYU9 0.000391 45 20 5 227 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 3.33e-21 96 29 5 237 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YJ04 0.000391 45 20 5 227 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q4QP85 4.1e-21 98 33 8 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q4QP85 2.26e-14 78 27 7 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q60AI1 4.16e-21 98 29 3 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q60AI1 5.6e-12 70 26 3 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5X627 4.18e-21 98 29 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5X627 1.03e-14 79 24 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q578K3 4.42e-21 98 27 4 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q578K3 1.66e-11 69 25 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 4.42e-21 98 27 4 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q2YKX3 1.66e-11 69 25 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q7N8B9 4.51e-21 98 27 4 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N8B9 5.03e-15 80 29 6 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P45171 4.87e-21 98 25 4 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45171 4.97e-14 77 24 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KS33 5.26e-21 98 25 4 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KS33 1.19e-10 67 23 5 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8PHQ3 5.28e-21 96 32 4 212 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q8PHQ3 4.57e-08 58 27 7 205 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q18AM3 5.31e-21 97 28 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q18AM3 1.58e-11 69 22 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
O31339 5.41e-21 97 29 5 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
O31339 1.55e-11 69 25 5 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
P45073 5.5e-21 95 25 1 231 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45073 1.45e-16 82 27 4 203 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1M7W6 6.19e-21 97 30 4 207 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 1.71e-12 72 28 4 204 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P14788 6.27e-21 97 31 5 217 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14788 1.24e-11 69 26 6 207 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8UCD5 6.37e-21 97 32 5 200 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UCD5 1.58e-09 63 28 6 205 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KLQ5 6.45e-21 97 26 3 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLQ5 1.51e-14 78 26 5 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9X196 7.08e-21 97 29 4 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X196 2.8e-10 65 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q042G7 8.11e-21 97 29 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q042G7 2.73e-12 72 23 5 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q98G43 9.08e-21 97 29 5 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98G43 2e-08 59 23 6 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P54537 9.24e-21 94 28 3 226 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 1.21e-09 62 24 4 206 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q608V9 9.39e-21 97 34 7 204 3 modC Molybdenum import ATP-binding protein ModC Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q608V9 4.94e-08 58 26 6 205 3 modC Molybdenum import ATP-binding protein ModC Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8YCG3 1e-20 97 27 4 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YCG3 5.91e-12 70 25 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2K8C8 1.01e-20 97 27 5 240 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K8C8 2.72e-10 65 25 5 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q830W6 1.11e-20 97 28 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q830W6 1.17e-15 82 23 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q9CP06 1.15e-20 97 24 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9CP06 4.06e-12 71 23 7 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q897I2 1.2e-20 97 23 11 359 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 1.16e-13 76 28 3 205 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 0.000109 48 29 2 93 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
A3DDF6 1.25e-20 96 30 4 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DDF6 2.33e-08 59 24 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q6F9A8 1.27e-20 96 30 5 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F9A8 3.22e-10 65 25 7 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q65T42 1.33e-20 96 30 4 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65T42 2.67e-10 65 24 6 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q03PF2 1.45e-20 97 28 5 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PF2 9.99e-16 82 26 5 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8U6M1 1.51e-20 96 28 6 236 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U6M1 1.19e-11 69 26 4 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q668K6 1.53e-20 96 33 4 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668K6 1.08e-08 60 25 6 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q87PH3 1.54e-20 97 26 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87PH3 3.63e-09 62 24 4 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5LT05 1.73e-20 96 29 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LT05 3.48e-06 52 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q81GU1 1.82e-20 96 29 5 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GU1 8.33e-12 70 25 5 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2YAD6 1.88e-20 96 29 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2YAD6 2.47e-11 68 27 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_01275
Feature type CDS
Gene lsrA
Product autoinducer 2 ABC transporter ATP-binding protein LsrA
Location 232691 - 234253 (strand: -1)
Length 1563 (nucleotides) / 520 (amino acids)

Contig

Accession ZDB_679
Length 398279 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2520
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1129 Carbohydrate transport and metabolism (G) G ABC-type sugar transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10558 AI-2 transport system ATP-binding protein ABC transporters
Quorum sensing
-

Protein Sequence

MSEKQHPIQPLLTARGIAKQFSGVVVLKHIDFTLLPGQVHALLGGNGAGKSTLMKIIAGIEQPDAGTLTLEGQEISHLTPAKAHQLGLYLVPQEPLLFPNLSVQENILFRLPKHQAGKTKLQQMLTSLRCNFDLSARAGSLNVADQQLVEIMRGLMRDSRILILDEPTASLTPAETERLFERVRELQQQSVGIVFISHKLPEIHAIADYLSVMRDGNIALAGPAKQFSTDEIIQAITPEAKKKPLSETQKLWLDLSATRNSPQDDTPVLDVRNACGEGFRNISFVVNPGEVVGLAGVVGAGRTELAETLYGLRPLIAGEVFLNGDNLRGVSSEKRLTRGLVCLPEDRQASGLFLDAPLTWNIGALVHNHQGLLVNRSRDDALLERYRRALNIKFSDGQQTVRTLSGGNQQKILIAKCLEANPSLLIIDEPTRGVDVGARNDIYQLIQSIAQQNVAILLISSDLDEVVALADRVLVMHQGEFSGELQHNELNTDTIMHMAFGEHRPQTETESSPLQEAASC

Flanking regions ( +/- flanking 50bp)

TTAACCACATAACATCCGGCAGCAATACCCATAACACCAGAGGTGCCGTTATGTCAGAGAAGCAACACCCGATTCAGCCGCTGCTCACCGCCCGCGGAATAGCCAAACAGTTCTCCGGTGTGGTTGTCCTCAAACACATCGATTTCACACTGTTGCCGGGACAGGTTCATGCACTGCTGGGCGGCAACGGCGCGGGAAAATCCACGCTGATGAAAATTATTGCAGGGATTGAACAGCCGGATGCAGGCACCCTGACGCTGGAAGGTCAGGAGATATCGCACCTGACTCCGGCGAAAGCCCATCAGCTGGGACTGTATCTGGTTCCGCAGGAGCCGCTGCTGTTCCCGAATCTGTCTGTGCAGGAAAACATTCTGTTCCGTCTGCCGAAACATCAGGCGGGCAAAACCAAATTACAGCAGATGCTGACTTCACTGCGCTGCAATTTTGATCTCAGTGCGCGGGCGGGCAGCCTGAATGTGGCGGATCAGCAGCTGGTGGAGATCATGCGCGGTCTGATGCGGGATTCCCGCATCCTTATTCTTGATGAACCGACAGCATCTCTGACCCCCGCCGAAACCGAACGCCTGTTTGAGCGGGTGCGGGAATTACAGCAGCAGAGTGTCGGGATTGTCTTTATCTCTCATAAACTACCGGAAATACATGCCATTGCCGATTATCTGAGCGTGATGCGTGACGGCAATATTGCGCTGGCCGGTCCGGCAAAACAGTTTTCCACTGATGAAATCATTCAGGCCATCACACCTGAAGCGAAGAAAAAGCCGCTGTCAGAGACGCAGAAGCTCTGGCTGGATCTGTCCGCCACCCGTAACAGTCCGCAGGATGATACGCCGGTGCTGGATGTCCGTAATGCGTGCGGCGAAGGATTCCGTAACATCAGTTTTGTTGTCAACCCGGGGGAAGTGGTCGGGCTGGCCGGTGTCGTCGGCGCCGGCCGGACCGAACTCGCAGAAACATTATACGGGCTGCGCCCGCTGATCGCCGGAGAGGTTTTCCTCAACGGTGACAATCTGCGCGGTGTCAGCAGTGAAAAACGCCTCACCCGGGGGCTGGTCTGTTTACCTGAAGACCGTCAGGCCTCCGGACTTTTTCTTGATGCCCCGCTCACCTGGAATATCGGTGCGCTGGTGCATAACCACCAGGGGCTGCTGGTCAACCGCTCGCGGGATGATGCATTGCTCGAGCGTTACCGCCGCGCCCTCAATATTAAATTCAGTGACGGACAACAGACGGTACGCACGCTGTCCGGCGGTAATCAGCAAAAGATCCTGATCGCCAAATGCCTCGAAGCCAATCCGTCACTGCTGATTATTGATGAACCGACACGCGGCGTGGATGTCGGCGCCCGTAATGACATTTATCAGCTGATACAAAGTATCGCACAGCAGAATGTGGCAATTTTACTGATCTCCTCTGACCTCGATGAAGTGGTGGCGCTGGCTGACCGCGTGCTGGTGATGCATCAGGGGGAATTCTCCGGGGAATTGCAGCACAACGAGCTGAACACCGACACCATTATGCATATGGCGTTCGGCGAACACCGCCCGCAGACAGAAACAGAAAGCAGCCCGTTACAGGAGGCCGCATCATGCTGAAATATATCCAGAATAACCGTGAAGTAACGGCACTGCTTGCTATTCTCTGC