Homologs in group_185

Help

8 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07340 FBDBKF_07340 38.2 Morganella morganii S1 ompA porin OmpA
EHELCC_03630 EHELCC_03630 38.2 Morganella morganii S2 ompA porin OmpA
NLDBIP_03630 NLDBIP_03630 38.2 Morganella morganii S4 ompA porin OmpA
LHKJJB_09460 LHKJJB_09460 38.2 Morganella morganii S3 ompA porin OmpA
HKOGLL_09515 HKOGLL_09515 38.2 Morganella morganii S5 ompA porin OmpA
F4V73_RS01525 F4V73_RS01525 38.8 Morganella psychrotolerans ompA porin OmpA
F4V73_RS19125 F4V73_RS19125 43.6 Morganella psychrotolerans - OmpA family protein
PMI_RS03855 PMI_RS03855 40.2 Proteus mirabilis HI4320 ompA porin OmpA

Distribution of the homologs in the orthogroup group_185

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_185

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DJO6 1.59e-26 103 48 3 123 3 ompA Outer membrane protein A (Fragment) Shimwellia blattae
I2BAK7 4.07e-26 104 48 3 125 3 ompA Outer membrane protein A Shimwellia blattae (strain ATCC 29907 / DSM 4481 / JCM 1650 / NBRC 105725 / CDC 9005-74)
P0C8Z2 5.71e-26 102 47 3 123 3 ompA Outer membrane protein A (Fragment) Escherichia fergusonii
P24016 5.83e-26 102 47 3 123 3 ompA Outer membrane protein A (Fragment) Citrobacter freundii
P24754 7.61e-26 102 47 3 123 3 ompA Outer membrane protein A (Fragment) Atlantibacter hermannii
P02936 1.71e-25 103 47 3 125 3 ompA Outer membrane protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z7S0 1.71e-25 103 47 3 125 3 ompA Outer membrane protein A Salmonella typhi
P02935 1.71e-25 103 48 3 125 3 ompA Outer membrane protein A Shigella dysenteriae
B7LNW7 1.71e-25 103 48 3 125 3 ompA Outer membrane protein A Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P24017 1.72e-25 103 48 3 125 1 ompA Outer membrane protein A Klebsiella pneumoniae
A0A2S4N3N0 1.77e-25 103 48 3 125 1 ompA Outer membrane protein A Shigella flexneri
P0A910 1.81e-25 102 48 3 125 1 ompA Outer membrane protein A Escherichia coli (strain K12)
P0A911 1.81e-25 102 48 3 125 3 ompA Outer membrane protein A Escherichia coli O157:H7
P09146 1.83e-25 103 45 3 133 3 ompA Outer membrane protein A Klebsiella aerogenes
P38399 1.89e-22 95 44 3 125 1 ompA Outer membrane protein A Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZG77 1.89e-22 95 44 3 125 1 ompA Outer membrane protein A Yersinia pestis
P38368 2.56e-18 83 34 4 141 1 ompA Outer membrane protein P5 Haemophilus influenzae
P45996 7.69e-18 82 35 4 139 1 ompA Outer membrane protein P5 Haemophilus influenzae
P43840 8.29e-18 82 34 4 141 3 ompA Outer membrane protein P5 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P07050 4.52e-17 78 37 4 138 3 None Outer membrane protein P.III Neisseria gonorrhoeae
P24755 2.42e-16 77 38 4 129 3 ompA Outer membrane protein A (Fragment) Serratia odorifera
P04845 3.49e-16 77 40 5 128 3 ompA Outer membrane protein A Serratia marcescens
P0A0V3 3.88e-16 76 36 4 138 1 rmpM Outer membrane protein class 4 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P0A0V2 9.34e-16 75 36 4 138 3 rmpM Outer membrane protein class 4 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P57414 1.12e-13 70 36 3 115 3 ompA Outer membrane protein A Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9L4 2.49e-13 69 32 3 135 3 ompA Outer membrane protein A Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q05146 2.23e-10 60 30 5 138 3 ompA Outer membrane protein A Bordetella avium
P37726 6.84e-10 60 39 4 97 1 oprF Outer membrane porin F Pseudomonas fluorescens
P22263 1.1e-09 59 35 6 113 3 oprF Outer membrane porin F Pseudomonas syringae pv. syringae
A0A160PB22 1.27e-09 58 35 2 110 1 tpgA Trimeric autotransporter adhesin- and peptidoglycan-associated protein A Acinetobacter sp. (strain Tol 5)
Q89AJ5 2.27e-09 57 41 2 79 3 pal Peptidoglycan-associated lipoprotein Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P13794 1.58e-08 56 33 4 113 1 oprF Outer membrane porin F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q51886 2.99e-08 53 30 6 138 3 pal Peptidoglycan-associated lipoprotein Pasteurella multocida (strain Pm70)
Q7NFT5 4.57e-07 52 36 4 91 1 psaB Photosystem I P700 chlorophyll a apoprotein A2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P10324 4.54e-06 47 28 4 138 1 pal Peptidoglycan-associated lipoprotein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9I4L6 6.97e-06 47 33 2 81 1 yfiB Outer-membrane lipoprotein YfiB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A914 2.35e-05 45 43 1 53 3 pal Peptidoglycan-associated lipoprotein Shigella flexneri
P0A912 2.35e-05 45 43 1 53 1 pal Peptidoglycan-associated lipoprotein Escherichia coli (strain K12)
P0A913 2.35e-05 45 43 1 53 3 pal Peptidoglycan-associated lipoprotein Escherichia coli O157:H7
P0A3S8 0.000133 43 28 3 102 1 pal Peptidoglycan-associated lipoprotein Brucella suis biovar 1 (strain 1330)
P0A3S7 0.000133 43 28 3 102 1 pal Peptidoglycan-associated lipoprotein Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P0A3S9 0.000133 43 28 3 102 1 pal Peptidoglycan-associated lipoprotein Brucella abortus biovar 1 (strain 9-941)
Q98F85 0.000429 42 33 3 93 3 pal Peptidoglycan-associated lipoprotein Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_20375
Feature type CDS
Gene ompA
Product OmpA family protein
Location 57 - 575 (strand: -1)
Length 519 (nucleotides) / 172 (amino acids)

Contig

Accession contig_52
Length 4348 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_185
Orthogroup size 9
N. genomes 7

Actions

Genomic region

Domains

PF00691 OmpA family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2885 Cell wall/membrane/envelope biogenesis (M) M Outer membrane protein OmpA and related peptidoglycan-associated (lipo)proteins

Protein Sequence

MRYFFKFLRITGIIGVILMLTACADFHDVDHRWCPPKSSEVESVQEIVNLKVDTLFSFDGAKFENIQPSGHEQLNSLVAQLINSYTKIDNIVVEGYTDRLGSEAYNQSLSQKRAETVKYYLQSKGINTSITAVGRGESKLAINCQNYNNMAQLIDCLQPDRRVVVRISGAKR

Flanking regions ( +/- flanking 50bp)

TTTACTGCTGTATAACCAGTACCGTTTCGTATAGATAAGGATTTGTACAGATGAGATATTTTTTTAAGTTCCTACGAATTACCGGTATCATTGGAGTAATACTTATGCTGACCGCCTGTGCTGACTTCCATGACGTCGATCACAGATGGTGTCCACCAAAAAGCTCAGAGGTAGAATCAGTACAAGAAATAGTCAATTTGAAAGTAGATACATTATTTAGCTTTGATGGAGCCAAGTTTGAAAATATTCAACCTTCTGGTCATGAACAACTCAATAGTTTGGTTGCACAATTGATTAATAGTTATACCAAAATTGATAATATTGTAGTTGAAGGTTATACGGATCGACTAGGCTCAGAGGCTTATAATCAAAGTTTATCTCAAAAGCGTGCTGAAACCGTAAAATATTATTTGCAATCTAAAGGTATCAATACATCTATAACGGCCGTTGGTCGCGGAGAAAGCAAATTAGCTATAAACTGCCAAAATTATAATAATATGGCTCAGTTAATTGATTGTCTACAACCAGATCGTAGAGTTGTAGTACGTATTTCAGGTGCAAAACGCTGACTAATATAAAGTCTAACAGAATTAATTCTGTTAGACCTTTATTATTAGTC