Homologs in group_3704
2 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| F4V73_RS16850 | F4V73_RS16850 | 34.4 | Morganella psychrotolerans | - | OmpA family protein |
| F4V73_RS19125 | F4V73_RS19125 | 43.6 | Morganella psychrotolerans | - | OmpA family protein |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| P0DJO6 | 1.59e-26 | 103 | 48 | 3 | 123 | 3 | ompA | Outer membrane protein A (Fragment) | Shimwellia blattae |
| I2BAK7 | 4.07e-26 | 104 | 48 | 3 | 125 | 3 | ompA | Outer membrane protein A | Shimwellia blattae (strain ATCC 29907 / DSM 4481 / JCM 1650 / NBRC 105725 / CDC 9005-74) |
| P0C8Z2 | 5.71e-26 | 102 | 47 | 3 | 123 | 3 | ompA | Outer membrane protein A (Fragment) | Escherichia fergusonii |
| P24016 | 5.83e-26 | 102 | 47 | 3 | 123 | 3 | ompA | Outer membrane protein A (Fragment) | Citrobacter freundii |
| P24754 | 7.61e-26 | 102 | 47 | 3 | 123 | 3 | ompA | Outer membrane protein A (Fragment) | Atlantibacter hermannii |
| P02936 | 1.71e-25 | 103 | 47 | 3 | 125 | 3 | ompA | Outer membrane protein A | Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) |
| Q8Z7S0 | 1.71e-25 | 103 | 47 | 3 | 125 | 3 | ompA | Outer membrane protein A | Salmonella typhi |
| P02935 | 1.71e-25 | 103 | 48 | 3 | 125 | 3 | ompA | Outer membrane protein A | Shigella dysenteriae |
| B7LNW7 | 1.71e-25 | 103 | 48 | 3 | 125 | 3 | ompA | Outer membrane protein A | Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73) |
| P24017 | 1.72e-25 | 103 | 48 | 3 | 125 | 1 | ompA | Outer membrane protein A | Klebsiella pneumoniae |
| A0A2S4N3N0 | 1.77e-25 | 103 | 48 | 3 | 125 | 1 | ompA | Outer membrane protein A | Shigella flexneri |
| P0A910 | 1.81e-25 | 102 | 48 | 3 | 125 | 1 | ompA | Outer membrane protein A | Escherichia coli (strain K12) |
| P0A911 | 1.81e-25 | 102 | 48 | 3 | 125 | 3 | ompA | Outer membrane protein A | Escherichia coli O157:H7 |
| P09146 | 1.83e-25 | 103 | 45 | 3 | 133 | 3 | ompA | Outer membrane protein A | Klebsiella aerogenes |
| P38399 | 1.89e-22 | 95 | 44 | 3 | 125 | 1 | ompA | Outer membrane protein A | Yersinia pseudotuberculosis serotype I (strain IP32953) |
| Q8ZG77 | 1.89e-22 | 95 | 44 | 3 | 125 | 1 | ompA | Outer membrane protein A | Yersinia pestis |
| P38368 | 2.56e-18 | 83 | 34 | 4 | 141 | 1 | ompA | Outer membrane protein P5 | Haemophilus influenzae |
| P45996 | 7.69e-18 | 82 | 35 | 4 | 139 | 1 | ompA | Outer membrane protein P5 | Haemophilus influenzae |
| P43840 | 8.29e-18 | 82 | 34 | 4 | 141 | 3 | ompA | Outer membrane protein P5 | Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) |
| P07050 | 4.52e-17 | 78 | 37 | 4 | 138 | 3 | None | Outer membrane protein P.III | Neisseria gonorrhoeae |
| P24755 | 2.42e-16 | 77 | 38 | 4 | 129 | 3 | ompA | Outer membrane protein A (Fragment) | Serratia odorifera |
| P04845 | 3.49e-16 | 77 | 40 | 5 | 128 | 3 | ompA | Outer membrane protein A | Serratia marcescens |
| P0A0V3 | 3.88e-16 | 76 | 36 | 4 | 138 | 1 | rmpM | Outer membrane protein class 4 | Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58) |
| P0A0V2 | 9.34e-16 | 75 | 36 | 4 | 138 | 3 | rmpM | Outer membrane protein class 4 | Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491) |
| P57414 | 1.12e-13 | 70 | 36 | 3 | 115 | 3 | ompA | Outer membrane protein A | Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS) |
| Q8K9L4 | 2.49e-13 | 69 | 32 | 3 | 135 | 3 | ompA | Outer membrane protein A | Buchnera aphidicola subsp. Schizaphis graminum (strain Sg) |
| Q05146 | 2.23e-10 | 60 | 30 | 5 | 138 | 3 | ompA | Outer membrane protein A | Bordetella avium |
| P37726 | 6.84e-10 | 60 | 39 | 4 | 97 | 1 | oprF | Outer membrane porin F | Pseudomonas fluorescens |
| P22263 | 1.1e-09 | 59 | 35 | 6 | 113 | 3 | oprF | Outer membrane porin F | Pseudomonas syringae pv. syringae |
| A0A160PB22 | 1.27e-09 | 58 | 35 | 2 | 110 | 1 | tpgA | Trimeric autotransporter adhesin- and peptidoglycan-associated protein A | Acinetobacter sp. (strain Tol 5) |
| Q89AJ5 | 2.27e-09 | 57 | 41 | 2 | 79 | 3 | pal | Peptidoglycan-associated lipoprotein | Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp) |
| P13794 | 1.58e-08 | 56 | 33 | 4 | 113 | 1 | oprF | Outer membrane porin F | Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) |
| Q51886 | 2.99e-08 | 53 | 30 | 6 | 138 | 3 | pal | Peptidoglycan-associated lipoprotein | Pasteurella multocida (strain Pm70) |
| Q7NFT5 | 4.57e-07 | 52 | 36 | 4 | 91 | 1 | psaB | Photosystem I P700 chlorophyll a apoprotein A2 | Gloeobacter violaceus (strain ATCC 29082 / PCC 7421) |
| P10324 | 4.54e-06 | 47 | 28 | 4 | 138 | 1 | pal | Peptidoglycan-associated lipoprotein | Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) |
| Q9I4L6 | 6.97e-06 | 47 | 33 | 2 | 81 | 1 | yfiB | Outer-membrane lipoprotein YfiB | Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) |
| P0A914 | 2.35e-05 | 45 | 43 | 1 | 53 | 3 | pal | Peptidoglycan-associated lipoprotein | Shigella flexneri |
| P0A912 | 2.35e-05 | 45 | 43 | 1 | 53 | 1 | pal | Peptidoglycan-associated lipoprotein | Escherichia coli (strain K12) |
| P0A913 | 2.35e-05 | 45 | 43 | 1 | 53 | 3 | pal | Peptidoglycan-associated lipoprotein | Escherichia coli O157:H7 |
| P0A3S8 | 0.000133 | 43 | 28 | 3 | 102 | 1 | pal | Peptidoglycan-associated lipoprotein | Brucella suis biovar 1 (strain 1330) |
| P0A3S7 | 0.000133 | 43 | 28 | 3 | 102 | 1 | pal | Peptidoglycan-associated lipoprotein | Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M) |
| P0A3S9 | 0.000133 | 43 | 28 | 3 | 102 | 1 | pal | Peptidoglycan-associated lipoprotein | Brucella abortus biovar 1 (strain 9-941) |
| Q98F85 | 0.000429 | 42 | 33 | 3 | 93 | 3 | pal | Peptidoglycan-associated lipoprotein | Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099) |
| Source | Morganella morganii S1 |
|---|---|
| Locus tag | FBDBKF_20375 |
| Feature type | CDS |
| Gene | ompA |
| Product | OmpA family protein |
| Location | 57 - 575 (strand: -1) |
| Length | 519 (nucleotides) / 172 (amino acids) |
| In genomic island | - |
| Accession | contig_52 |
|---|---|
| Length | 4348 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3704 | |
|---|---|---|
| Orthogroup size | 3 | |
| N. genomes | 2 |
MRYFFKFLRITGIIGVILMLTACADFHDVDHRWCPPKSSEVESVQEIVNLKVDTLFSFDGAKFENIQPSGHEQLNSLVAQLINSYTKIDNIVVEGYTDRLGSEAYNQSLSQKRAETVKYYLQSKGINTSITAVGRGESKLAINCQNYNNMAQLIDCLQPDRRVVVRISGAKR
TTTACTGCTGTATAACCAGTACCGTTTCGTATAGATAAGGATTTGTACAGATGAGATATTTTTTTAAGTTCCTACGAATTACCGGTATCATTGGAGTAATACTTATGCTGACCGCCTGTGCTGACTTCCATGACGTCGATCACAGATGGTGTCCACCAAAAAGCTCAGAGGTAGAATCAGTACAAGAAATAGTCAATTTGAAAGTAGATACATTATTTAGCTTTGATGGAGCCAAGTTTGAAAATATTCAACCTTCTGGTCATGAACAACTCAATAGTTTGGTTGCACAATTGATTAATAGTTATACCAAAATTGATAATATTGTAGTTGAAGGTTATACGGATCGACTAGGCTCAGAGGCTTATAATCAAAGTTTATCTCAAAAGCGTGCTGAAACCGTAAAATATTATTTGCAATCTAAAGGTATCAATACATCTATAACGGCCGTTGGTCGCGGAGAAAGCAAATTAGCTATAAACTGCCAAAATTATAATAATATGGCTCAGTTAATTGATTGTCTACAACCAGATCGTAGAGTTGTAGTACGTATTTCAGGTGCAAAACGCTGACTAATATAAAGTCTAACAGAATTAATTCTGTTAGACCTTTATTATTAGTC
