Homologs in group_2207

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_19540 EHELCC_19540 100.0 Morganella morganii S2 fadA acetyl-CoA C-acyltransferase FadA
NLDBIP_16910 NLDBIP_16910 100.0 Morganella morganii S4 fadA acetyl-CoA C-acyltransferase FadA
LHKJJB_16560 LHKJJB_16560 100.0 Morganella morganii S3 fadA acetyl-CoA C-acyltransferase FadA
HKOGLL_17525 HKOGLL_17525 100.0 Morganella morganii S5 fadA acetyl-CoA C-acyltransferase FadA
F4V73_RS18360 F4V73_RS18360 83.8 Morganella psychrotolerans fadA acetyl-CoA C-acyltransferase FadA
PMI_RS17635 PMI_RS17635 66.6 Proteus mirabilis HI4320 fadA acetyl-CoA C-acyltransferase FadA

Distribution of the homologs in the orthogroup group_2207

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2207

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MZ91 0.0 525 65 1 387 3 fadA 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q66FR9 0.0 515 65 1 387 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR28 0.0 515 65 1 387 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CNA0 0.0 515 65 1 387 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAM9 0.0 515 65 1 387 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis
Q1C2C3 0.0 515 65 1 387 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FDF1 0.0 515 65 1 387 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JIG3 2.03e-179 506 63 1 387 3 fadA 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4WFX5 5.85e-177 500 62 1 387 3 fadA 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
P0A2H7 9.16e-177 500 62 1 387 1 fadA 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2H8 9.16e-177 500 62 1 387 3 fadA 3-ketoacyl-CoA thiolase Salmonella typhi
Q5PKQ3 9.16e-177 500 62 1 387 3 fadA 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8G8D0 9.99e-177 500 63 1 387 3 fadA 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
A8ACZ3 9.25e-176 497 62 1 389 3 fadA 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q57HM7 9.83e-176 497 62 1 387 3 fadA 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
B2VFE0 3.24e-175 496 62 1 387 3 fadA 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6TGM3 3.53e-175 496 62 1 387 3 fadA 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7LTZ0 4.72e-174 493 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7MQM5 4.98e-174 493 62 1 387 3 fadA 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
A1AI32 1.33e-173 492 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
Q3YVC2 1.49e-173 492 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
Q8FBI3 1.54e-173 492 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAL1 2.71e-173 491 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R467 6.16e-173 490 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q32A20 1.15e-172 489 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
A8A6V0 1.35e-172 489 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
Q8X8J4 2.7e-172 488 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
A7ZU50 5.03e-172 488 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31UE3 5.19e-172 488 61 1 387 3 fadA 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
Q83PG2 7.29e-172 488 60 1 387 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri
Q0SZ35 7.29e-172 488 60 1 387 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
P21151 1.55e-171 486 60 1 387 1 fadA 3-ketoacyl-CoA thiolase FadA Escherichia coli (strain K12)
Q5QXH8 2.95e-171 486 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q9F0Y6 5.1e-171 485 60 1 387 3 fadA 3-ketoacyl-CoA thiolase Enterobacter cloacae
A0KEL0 1.57e-170 484 60 1 387 3 fadA 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4STF3 3.27e-170 483 60 1 387 3 fadA 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
Q6LW07 1.78e-169 481 60 1 387 3 fadA 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
Q6DAP6 3.67e-169 481 61 1 386 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4Y1B5 4.39e-168 478 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WH99 4.39e-168 478 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
A3CYJ3 4.95e-168 478 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q08A40 1.11e-167 477 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
A3Q8U3 1.63e-167 476 60 1 386 3 fadA 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
C6DI66 2.52e-167 476 60 1 387 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1RDW3 3.14e-167 476 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
A1S1I7 1.27e-166 474 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8EKS0 1.88e-166 474 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0I0T4 2.24e-166 473 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
Q12TB5 2.53e-166 473 60 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B5FEW7 3.88e-166 473 58 1 386 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
Q15ZF4 7.95e-166 472 59 2 387 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5E8X7 9.29e-166 472 58 1 386 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0HPB8 1.16e-165 472 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
A0KR49 1.16e-165 472 59 1 387 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
Q3IJ24 1.17e-164 469 60 1 388 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
B6EGU1 8.76e-164 467 57 1 386 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio salmonicida (strain LFI1238)
Q8DDK5 1.56e-163 466 60 1 386 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
Q7MQI0 1.82e-163 466 60 1 386 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
A5F464 2.42e-163 466 60 1 386 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6FF69 5.07e-163 465 59 1 383 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A3M1H9 1.14e-162 464 59 1 383 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VE46 1.43e-162 464 59 1 383 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AYE)
B0VLX5 1.43e-162 464 59 1 383 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain SDF)
B2I2J8 1.43e-162 464 59 1 383 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ACICU)
B7I3P0 1.43e-162 464 59 1 383 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB0057)
B7H1I1 1.43e-162 464 59 1 383 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB307-0294)
Q9KNI0 5.45e-162 462 60 1 386 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4FQC7 6.19e-162 462 57 1 385 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1Q8K0 3.08e-161 461 56 1 385 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A5WH98 5.17e-160 457 58 1 385 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter sp. (strain PRwf-1)
Q87TP0 1.03e-159 457 59 1 384 3 fadA 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0VNZ7 1.95e-157 451 56 1 386 3 fadA 3-ketoacyl-CoA thiolase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P28790 2.23e-156 448 57 1 384 1 fadA 3-ketoacyl-CoA thiolase Pseudomonas fragi
Q48GW4 4.58e-156 447 57 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2SD23 4.68e-156 447 56 1 384 3 fadA 3-ketoacyl-CoA thiolase Hahella chejuensis (strain KCTC 2396)
Q489W4 4.75e-155 445 55 2 387 3 fadA 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q4ZRA1 5.53e-155 445 56 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. syringae (strain B728a)
Q87ZB3 3.99e-154 442 56 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1TZR8 6.59e-154 442 56 1 376 3 fadA 3-ketoacyl-CoA thiolase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q21KB1 1.65e-153 441 56 1 384 3 fadA 3-ketoacyl-CoA thiolase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q02PH7 1.69e-153 441 55 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V383 1.69e-153 441 55 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain PA7)
Q9HZJ3 3.32e-153 440 55 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5W6G9 8.87e-153 439 56 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q93Q11 1.04e-152 439 55 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas oleovorans
Q88L01 1.86e-152 438 56 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A4XSM9 2.06e-152 438 55 1 383 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas mendocina (strain ymp)
Q1I7D5 2.29e-152 438 56 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas entomophila (strain L48)
Q9R9W0 6.54e-152 437 55 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida
A4VKA4 1.18e-151 436 55 1 383 3 fadA 3-ketoacyl-CoA thiolase Stutzerimonas stutzeri (strain A1501)
A6VVM8 1.52e-151 436 58 1 384 3 fadA 3-ketoacyl-CoA thiolase Marinomonas sp. (strain MWYL1)
Q4KFC3 1e-150 434 54 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K9D9 1.13e-150 434 55 1 384 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain Pf0-1)
Q1QUW9 2.16e-146 423 55 1 385 3 fadA 3-ketoacyl-CoA thiolase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q43935 1.64e-106 322 45 7 406 3 catF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q43974 2.04e-106 322 45 7 406 1 pcaF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
O32177 1.28e-100 306 43 4 393 2 fadA 3-ketoacyl-CoA thiolase Bacillus subtilis (strain 168)
P0C7L2 1.73e-100 306 45 7 406 1 paaJ 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase Escherichia coli (strain K12)
P0C7L3 2.32e-100 306 45 7 406 3 paaJ Beta-ketoadipyl-CoA thiolase Escherichia coli
Q5HIU0 3e-93 288 41 7 400 3 SACOL0426 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain COL)
Q2G124 1.09e-92 286 41 7 400 3 SAOUHSC_00336 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJQ9 1.09e-92 286 41 7 400 3 SAUSA300_0355 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain USA300)
P44873 1.19e-92 286 42 7 400 3 atoB Acetyl-CoA acetyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6GJW4 1.39e-92 286 41 7 400 3 SAR0351 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MRSA252)
P45363 1.52e-92 286 40 7 402 3 phaA Acetyl-CoA acetyltransferase Thiocystis violacea
Q8NY95 1.71e-92 286 41 7 400 3 MW0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MW2)
Q6GCB8 1.71e-92 286 41 7 400 3 SAS0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MSSA476)
Q9I6R0 3.44e-92 285 42 7 404 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7A7L2 3.39e-91 282 40 7 400 1 SA0342 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain N315)
Q99WM3 3.39e-91 282 40 7 400 3 SAV0354 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YVF5 7.3e-91 281 40 7 400 3 SAB0304 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8VPF1 2.6e-90 280 41 8 404 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas knackmussii (strain DSM 6978 / CCUG 54928 / LMG 23759 / B13)
Q51956 3.26e-90 280 42 7 406 3 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas putida
Q18AR0 8.7e-88 273 39 7 398 1 thlA Acetyl-CoA acetyltransferase Clostridioides difficile (strain 630)
P45359 2.47e-87 272 39 7 399 1 thlA Acetyl-CoA acetyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8CQN7 3.05e-87 272 39 8 399 3 SE_2384 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HS07 3.05e-87 272 39 8 399 3 SERP0032 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P50174 1.08e-86 271 40 7 395 3 phaA Acetyl-CoA acetyltransferase Rhizobium meliloti (strain 1021)
P76461 5.17e-86 269 43 6 400 1 atoB Acetyl-CoA acetyltransferase Escherichia coli (strain K12)
Q9ZHI1 6.95e-86 269 41 6 396 3 phaA Acetyl-CoA acetyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8LF48 7.64e-86 270 39 6 393 1 KAT1 3-ketoacyl-CoA thiolase 1, peroxisomal Arabidopsis thaliana
P45369 1.1e-85 268 39 8 399 3 phaA Acetyl-CoA acetyltransferase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
P14611 1.26e-85 268 39 6 398 1 phaA Acetyl-CoA acetyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P07097 8.32e-85 266 39 7 394 1 phaA Acetyl-CoA acetyltransferase Shinella zoogloeoides
Q46939 8.08e-84 263 41 6 398 3 yqeF Probable acetyl-CoA acetyltransferase Escherichia coli (strain K12)
Q9I2A8 1.27e-83 263 39 6 398 1 atoB Acetyl-CoA acetyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q56WD9 2.61e-83 264 39 6 393 1 PED1 3-ketoacyl-CoA thiolase 2, peroxisomal Arabidopsis thaliana
Q0AVM3 9.46e-83 261 40 8 397 1 Swol_1934 Acetyl-CoA acetyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P54810 6.98e-82 258 39 7 397 3 phaA Acetyl-CoA acetyltransferase Paracoccus denitrificans
P09110 3.83e-80 255 40 8 389 1 ACAA1 3-ketoacyl-CoA thiolase, peroxisomal Homo sapiens
Q570C8 6.78e-80 255 38 6 395 1 KAT5 3-ketoacyl-CoA thiolase 5, peroxisomal Arabidopsis thaliana
Q921H8 9.98e-80 254 40 8 392 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Mus musculus
C8YNG6 4.96e-79 253 39 6 393 1 KAT1 3-ketoacyl CoA thiolase 1, peroxisomal Petunia hybrida
O53871 5.8e-79 251 36 6 409 1 fadA Putative acyltransferase Rv0859 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8VCH0 2.7e-78 250 40 8 392 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Mus musculus
Q0KBP1 3.35e-78 249 37 5 401 1 bktB Beta-ketothiolase BktB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P07871 1.22e-77 248 40 8 392 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Rattus norvegicus
P13437 2.2e-77 247 37 6 397 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Rattus norvegicus
P21775 5.68e-77 247 40 8 392 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Rattus norvegicus
P42765 1.75e-76 244 36 6 394 1 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Homo sapiens
Q5RES5 4.56e-76 243 36 6 397 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Pongo abelii
Q9BWD1 5.48e-76 243 37 7 397 1 ACAT2 Acetyl-CoA acetyltransferase, cytosolic Homo sapiens
Q3T0R7 6.72e-76 243 35 6 397 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Bos taurus
Q8BWT1 9.04e-75 240 36 6 397 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Mus musculus
I6XHI4 3.55e-74 238 38 9 400 1 fadA5 Steroid 3-ketoacyl-CoA thiolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P33291 3.96e-74 239 38 8 394 3 None 3-ketoacyl-CoA thiolase B, peroxisomal Candida tropicalis
I6XHJ3 7.49e-74 238 36 7 398 1 fadA6 Steroid 3-ketoacyl-CoA thiolase FadA6 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P33290 4.68e-71 231 38 8 394 3 None 3-ketoacyl-CoA thiolase A, peroxisomal Candida tropicalis
P45855 1.11e-70 229 35 7 398 1 mmgA Acetyl-CoA acetyltransferase Bacillus subtilis (strain 168)
Q5XI22 1.31e-70 229 37 7 397 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Rattus norvegicus
Q8SVA6 5.72e-69 225 35 8 387 1 FOX3 3-ketoacyl-CoA thiolase, peroxisomal Encephalitozoon cuniculi (strain GB-M1)
Q8CAY6 1.47e-67 221 36 7 397 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Mus musculus
P27796 1.24e-66 220 36 8 397 1 POT1 3-ketoacyl-CoA thiolase, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q05493 4.33e-62 208 35 7 395 3 POT1 3-ketoacyl-CoA thiolase, peroxisomal Yarrowia lipolytica (strain CLIB 122 / E 150)
P73825 4.6e-62 207 37 8 403 3 phaA Acetyl-CoA acetyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
I1RY81 1.01e-61 206 34 9 401 2 ERG10 Acetyl-CoA acetyltransferase ERG10, cytosolic Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9UQW6 1.07e-61 206 35 7 398 2 erg10 Acetyl-CoA acetyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12598 3.99e-61 205 33 6 404 1 PACTA Acetyl-CoA acetyltransferase IA Candida tropicalis
A0A1D8PH52 8.74e-61 204 34 6 402 2 ERG10 Acetyl-CoA acetyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q6L8K7 9.41e-61 204 34 10 406 3 PAT1 Acetyl-CoA acetyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q4WCL5 1.45e-60 203 34 8 402 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0YA65 1.45e-60 203 34 8 402 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Q04677 1.68e-60 203 33 6 406 1 PACTB Acetyl-CoA acetyltransferase IB Candida tropicalis
P41338 6.57e-59 199 32 7 401 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4WLA8 7.24e-59 200 33 11 402 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0XMC1 7.24e-59 200 33 11 402 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Q9FIK7 7.3e-59 199 34 5 379 1 ACCT1 Acetyl-CoA acetyltransferase 1 Arabidopsis thaliana
O46629 1.14e-57 198 32 10 433 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Bos taurus
Q8S4Y1 1.2e-57 196 35 6 377 1 ACCT2 Acetyl-CoA acetyltransferase 2 Arabidopsis thaliana
B2TWV5 5.52e-57 195 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
I1RMA2 6.44e-57 195 33 9 404 3 FG05087 Acetyl-CoA acetyltransferase FG05087, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P10551 9.54e-57 193 32 6 400 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces pastorianus (strain ATCC 76670 / Carlsberg bottom yeast no.2 / CBS 1503 / CLIB 180 / NBRC 10610 / NRRL Y-1525)
A4SMT9 1.17e-56 194 33 9 432 3 fadI 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
B7LLC9 2.55e-56 193 32 9 416 3 fadI 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A0R1Y7 2.6e-56 192 34 6 394 1 MSMEG_4920 Probable acetyl-CoA acetyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B6I6Q5 3.08e-56 193 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SE11)
B7M6M3 3.08e-56 193 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O8 (strain IAI1)
A7ZPF9 3.08e-56 193 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
P76503 3.18e-56 193 32 10 415 1 fadI 3-ketoacyl-CoA thiolase FadI Escherichia coli (strain K12)
B1X9L5 3.18e-56 193 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / DH10B)
C4ZVN3 3.18e-56 193 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / MC4100 / BW2952)
B1IXA4 3.46e-56 193 32 9 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B5YXY5 3.77e-56 193 32 9 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCN9 3.77e-56 193 32 9 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
P34255 3.77e-56 193 31 11 431 3 B0303.3 Probable 3-ketoacyl-CoA thiolase Caenorhabditis elegans
B7LBJ6 3.97e-56 193 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain 55989 / EAEC)
Q31YB6 5.51e-56 192 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
B7N5V3 6.19e-56 192 32 10 429 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8A2L1 8.77e-56 192 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
Q0T2E5 9.05e-56 192 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
Q8FFG3 1.02e-55 192 32 10 429 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UFZ9 1.03e-55 192 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q7A1P9 1.1e-55 190 32 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MW2)
Q7A768 1.1e-55 190 32 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain N315)
Q7A2W9 1.1e-55 190 32 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9KWK4 1.1e-55 190 32 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu3 / ATCC 700698)
B7NP25 1.13e-55 192 32 10 429 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q86AD9 1.14e-55 191 32 7 399 2 DDB_G0271544 Probable acetyl-CoA acetyltransferase Dictyostelium discoideum
Q6GJ93 1.27e-55 190 31 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MRSA252)
Q3YZM1 1.38e-55 191 32 10 415 3 fadI 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
B1LME8 1.93e-55 191 32 10 429 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SMS-3-5 / SECEC)
Q6GBR1 2.12e-55 189 32 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MSSA476)
Q3IEE3 2.47e-55 191 32 11 417 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
A0KK76 2.8e-55 191 32 9 432 3 fadI 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q83K95 3.57e-55 190 31 10 415 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri
A9MJ36 3.57e-55 190 31 10 416 3 fadI 3-ketoacyl-CoA thiolase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q6NU46 3.79e-55 190 32 7 397 2 acat1-a Acetyl-CoA acetyltransferase A, mitochondrial Xenopus laevis
B7MY17 4.74e-55 190 31 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O81 (strain ED1a)
A8ADP1 7.15e-55 189 32 10 416 3 fadI 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q1R971 1.16e-54 189 31 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q0TFA5 1.16e-54 189 31 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADI9 1.16e-54 189 31 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
B7MGV8 1.16e-54 189 31 10 415 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q99JY0 1.85e-54 189 32 11 434 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Mus musculus
Q5HIA0 1.86e-54 187 31 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain COL)
Q32DJ3 8.77e-54 187 31 9 415 3 fadI 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
P55084 1.02e-53 187 31 10 433 1 HADHB Trifunctional enzyme subunit beta, mitochondrial Homo sapiens
Q5R1W7 1.08e-53 187 31 10 433 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Pan troglodytes
Q8HXX4 1.16e-53 187 31 10 433 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Macaca fascicularis
B5XVW1 1.68e-53 186 31 10 416 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae (strain 342)
Q57LW5 1.95e-53 186 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
A6TC20 2.88e-53 185 32 10 417 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q60587 3.01e-53 186 31 11 434 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Rattus norvegicus
A4WCW7 3.1e-53 185 31 9 416 3 fadI 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
Q6GN02 3.93e-53 184 32 7 397 2 acat1-b Acetyl-CoA acetyltransferase B, mitochondrial Xenopus laevis
Q22100 8.44e-53 183 30 7 393 1 kat-1 Acetyl-CoA acetyltransferase homolog, mitochondrial Caenorhabditis elegans
P17764 1.29e-52 183 32 7 397 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Rattus norvegicus
C0PZX5 1.45e-52 184 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi C (strain RKS4594)
B4SZR1 1.53e-52 183 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella newport (strain SL254)
B4TQC3 1.57e-52 183 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella schwarzengrund (strain CVM19633)
Q8Z4Y9 2.08e-52 183 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhi
Q6AZA0 2.33e-52 182 31 7 396 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Danio rerio
B4TCA9 2.56e-52 183 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella heidelberg (strain SL476)
Q5PCX7 2.7e-52 183 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZNA6 2.91e-52 182 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5R3S0 4.34e-52 182 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella enteritidis PT4 (strain P125109)
B5FPN2 4.34e-52 182 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella dublin (strain CT_02021853)
B5EZS0 4.34e-52 182 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella agona (strain SL483)
Q4L3Q1 5.78e-52 181 35 6 332 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus haemolyticus (strain JCSC1435)
B5BBA0 6.67e-52 182 31 10 419 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain AKU_12601)
Q29RZ0 7.68e-52 181 31 7 397 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Bos taurus
Q8QZT1 1.17e-51 181 31 7 397 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Mus musculus
A9N452 1.53e-51 181 30 9 418 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8HXY6 1.83e-51 180 30 7 397 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Macaca fascicularis
A7MH80 1.95e-51 181 31 11 420 3 fadI 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
Q5BKN8 1.99e-51 180 31 7 397 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Xenopus tropicalis
B1JGG1 2.23e-51 180 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668V0 2.23e-51 180 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM83 2.23e-51 180 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CHK1 2.23e-51 180 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD46 2.23e-51 180 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis
B2K8J6 2.23e-51 180 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C659 2.23e-51 180 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK0 2.23e-51 180 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P24752 3.82e-51 179 30 7 397 1 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Homo sapiens
Q47ZB6 5.44e-51 179 31 9 415 3 fadI 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A9R7W9 7.53e-51 179 32 10 402 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Angola)
A1JK23 2.06e-50 178 31 10 403 3 fadI 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GH87 3.2e-50 177 31 10 417 3 fadI 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
A1RI91 4.47e-50 177 29 9 434 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
A9KTW7 4.52e-50 177 29 9 431 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS195)
A3D685 4.52e-50 177 29 9 431 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EE97 4.52e-50 177 29 9 431 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS223)
O07618 5.77e-50 175 34 9 365 2 yhfS Putative acetyl-CoA C-acetyltransferase YhfS Bacillus subtilis (strain 168)
Q8CTR0 5.96e-50 175 30 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A6WQ26 6.52e-50 176 29 9 431 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
P46707 7.08e-50 175 33 6 399 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium leprae (strain TN)
A4Y898 1.11e-49 176 29 10 436 3 fadI 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q5HRH3 1.57e-49 174 30 7 395 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B8CPY7 2.97e-49 175 30 10 418 3 fadI 3-ketoacyl-CoA thiolase Shewanella piezotolerans (strain WP3 / JCM 13877)
B0TL22 3.01e-49 175 29 9 416 3 fadI 3-ketoacyl-CoA thiolase Shewanella halifaxensis (strain HAW-EB4)
P9WG68 6e-49 173 34 6 392 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66927 6e-49 173 34 6 392 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A8H5T2 6.12e-49 174 30 10 418 3 fadI 3-ketoacyl-CoA thiolase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q5QXN5 6.79e-49 174 30 11 423 3 fadI 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B4RTU9 7.86e-49 174 31 11 420 3 fadI 3-ketoacyl-CoA thiolase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
P9WG69 1.16e-48 172 34 6 396 1 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7MIS4 6.84e-48 171 32 11 417 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
B1KKT1 7.35e-48 171 30 11 420 3 fadI 3-ketoacyl-CoA thiolase Shewanella woodyi (strain ATCC 51908 / MS32)
Q6LTK4 9.06e-48 171 30 10 418 3 fadI 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
Q07ZP7 1.12e-47 171 30 9 416 3 fadI 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
A1S7L7 1.63e-47 170 30 10 419 3 fadI 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q87MM2 1.9e-47 170 32 11 421 3 fadI 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DB48 3.14e-47 169 32 11 417 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
Q12P12 8.09e-47 168 30 8 413 3 fadI 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q7N287 8.71e-47 168 30 10 430 3 fadI 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q15VA3 8.98e-47 168 31 10 418 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
C6DAL8 1.31e-46 168 31 10 405 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D2L6 2.25e-46 167 31 10 405 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A3QFP4 3.34e-46 167 29 9 416 3 fadI 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0HWN4 4.15e-46 166 29 9 418 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
Q0HKD2 4.15e-46 166 29 9 418 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
A0KV75 4.15e-46 166 29 9 418 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
Q8ECP6 4.51e-46 166 29 9 418 3 fadI 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8FTR6 7.43e-46 166 29 10 420 3 fadI 3-ketoacyl-CoA thiolase Shewanella sediminis (strain HAW-EB3)
B2VJ10 1.8e-45 165 30 9 402 3 fadI 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5FGB5 7.73e-45 163 29 11 417 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
A5F2P1 1.13e-44 162 30 11 420 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KT59 1.53e-44 162 30 11 420 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5E3U0 3.32e-43 159 29 11 420 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
P11915 4.93e-14 77 25 10 298 1 Scp2 Sterol carrier protein 2 Rattus norvegicus
O62742 6.18e-14 76 26 10 298 1 SCP2 Sterol carrier protein 2 Oryctolagus cuniculus
P32020 1.86e-13 75 26 10 298 1 Scp2 Sterol carrier protein 2 Mus musculus
Q07598 2.41e-11 68 25 11 298 2 SCP2 Sterol carrier protein 2 (Fragment) Gallus gallus
P07857 9.56e-11 67 26 10 298 1 SCP2 Sterol carrier protein 2 Bos taurus
P22307 3.21e-09 62 26 12 307 1 SCP2 Sterol carrier protein 2 Homo sapiens
P45362 1.92e-08 55 38 2 98 3 thi Acetyl-CoA acetyltransferase (Fragment) Clostridioides difficile
G5EDP2 5.95e-08 57 22 14 319 1 daf-22 Non-specific lipid-transfer protein-like 2 Caenorhabditis elegans
Q58944 9.83e-08 57 22 15 406 4 MJ1549 Uncharacterized protein MJ1549 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O26884 1.36e-06 53 22 13 381 4 MTH_793 Uncharacterized protein MTH_793 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9R9J1 0.000686 45 42 1 56 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_16890
Feature type CDS
Gene fadA
Product acetyl-CoA C-acyltransferase FadA
Location 6622 - 7788 (strand: 1)
Length 1167 (nucleotides) / 388 (amino acids)

Contig

Accession contig_26
Length 47760 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2207
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00108 Thiolase, N-terminal domain
PF02803 Thiolase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0183 Lipid transport and metabolism (I) I Acetyl-CoA acetyltransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MEKVMIIDGLRTSMGRSKNGIFRHVRADTLSAEVMSAVIKRNNINAADIDDIIWGCVQQTGEQGFNIARHAALLTEIPHTVPAVTVNRLCGSSMQALHDAARQIQTGDGKLALAGGVEHMGHIPMTQGIDINPAAALHTAKASGMMGLTAEALARQFSVSRESQDEFALRSHQRAAQAFRDSRFSREIHPVQGHNQAGVPVIATRDETVRDNGSLAELSSLRPVFDPISGTVTAGNSSAISDGASVTLLAGEHYAREHGLSPRAVIQAMSVTGCEPALMGYGPVQATQAVLKKAGLTLADIDVIELNEAFAAQALACLKGMGLSDCYDDKVNLHGGAIALGHPLGCSGTRIINSLLTVMEQRDAQFGLATMCIGFGQGIATVIERVRS

Flanking regions ( +/- flanking 50bp)

TTATTATCCGCAACCGGATAGTCACCCTGTTACTGCACAGTGAGGTTTATATGGAAAAAGTCATGATAATTGATGGTCTCCGCACCTCAATGGGCCGCTCAAAAAACGGTATATTCCGGCATGTCCGTGCGGACACACTCTCAGCAGAAGTGATGAGTGCAGTGATAAAGCGTAACAATATCAATGCAGCCGATATTGATGACATTATCTGGGGGTGTGTGCAGCAGACCGGGGAACAGGGGTTTAACATAGCCCGTCATGCCGCCCTGCTGACAGAGATCCCGCACACCGTGCCTGCCGTCACTGTGAACCGCCTGTGCGGTTCATCAATGCAGGCCCTGCATGATGCCGCCCGCCAGATTCAGACCGGTGACGGTAAACTGGCACTTGCAGGAGGTGTTGAACATATGGGTCATATCCCGATGACACAGGGTATCGATATCAATCCGGCTGCCGCACTGCACACGGCCAAAGCGTCCGGCATGATGGGGCTGACAGCCGAAGCACTGGCACGACAGTTTTCTGTCAGCCGTGAGTCACAGGATGAATTTGCTCTGCGTTCACATCAGCGGGCCGCACAGGCATTCCGTGATAGCAGATTCAGCCGTGAAATCCATCCGGTTCAGGGTCATAACCAGGCCGGAGTACCTGTCATTGCCACCCGGGATGAAACCGTACGCGATAACGGCAGTCTTGCTGAACTTTCGTCATTGCGTCCGGTATTTGATCCGATCAGCGGCACAGTCACCGCCGGTAATTCCTCAGCAATTTCAGATGGTGCATCCGTAACTCTGCTGGCCGGGGAGCACTATGCCCGTGAGCATGGTTTATCTCCGCGGGCGGTGATTCAGGCGATGAGTGTTACCGGCTGTGAACCGGCACTGATGGGATACGGACCGGTACAGGCAACACAGGCAGTTCTGAAAAAGGCCGGGCTGACGCTGGCAGATATTGATGTTATCGAACTGAACGAAGCATTTGCGGCACAGGCACTTGCCTGCCTGAAAGGTATGGGATTATCTGACTGTTATGATGACAAAGTGAATCTGCATGGCGGCGCGATTGCACTCGGGCATCCGCTCGGCTGTTCCGGCACCCGGATTATCAATTCACTGCTGACGGTCATGGAGCAGCGGGATGCGCAGTTCGGCCTGGCAACGATGTGTATTGGTTTCGGTCAGGGGATAGCAACCGTGATTGAACGTGTCCGCAGCTGATCACTGAGAACGTTATAAATAACAGCGACGTTTTCTGCTTCATCACACGG