Homologs in group_386

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_15610 EHELCC_15610 100.0 Morganella morganii S2 fepD ABC-type Fe3+-siderophore transport system, permease component
NLDBIP_16140 NLDBIP_16140 100.0 Morganella morganii S4 fepD ABC-type Fe3+-siderophore transport system, permease component
LHKJJB_15700 LHKJJB_15700 100.0 Morganella morganii S3 fepD ABC-type Fe3+-siderophore transport system, permease component
HKOGLL_14820 HKOGLL_14820 100.0 Morganella morganii S5 fepD ABC-type Fe3+-siderophore transport system, permease component
F4V73_RS07605 F4V73_RS07605 91.3 Morganella psychrotolerans - iron ABC transporter permease
PMI_RS01110 PMI_RS01110 77.8 Proteus mirabilis HI4320 - iron ABC transporter permease
PMI_RS14630 PMI_RS14630 30.1 Proteus mirabilis HI4320 - iron chelate uptake ABC transporter family permease subunit

Distribution of the homologs in the orthogroup group_386

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_386

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q57552 3.49e-63 208 33 5 349 3 MJ0087 Putative ABC transporter permease protein MJ0087 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q56992 3.24e-48 169 36 3 311 1 hmuU Hemin transport system permease protein HmuU Yersinia pestis
Q7MLE7 3.9e-42 152 35 2 275 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain YJ016)
Q8D927 1.86e-41 151 35 2 275 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain CMCP6)
O34451 1.05e-40 149 36 6 290 3 yvrB Uncharacterized ABC transporter permease protein YvrB Bacillus subtilis (strain 168)
A1JPQ9 4.27e-40 147 33 3 297 3 btuC Vitamin B12 import system permease protein BtuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6TAH6 6.31e-40 147 34 4 291 3 btuC Vitamin B12 import system permease protein BtuC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q6LQ76 1.27e-38 143 33 7 333 3 btuC Vitamin B12 import system permease protein BtuC Photobacterium profundum (strain SS9)
B1JJ25 1.46e-37 140 32 5 295 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669Z9 1.46e-37 140 32 5 295 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype I (strain IP32953)
A9R099 1.46e-37 140 32 5 295 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX4 1.46e-37 140 32 5 295 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pestis
B2K660 1.46e-37 140 32 5 295 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHG9 1.46e-37 140 32 5 295 3 btuC Vitamin B12 import system permease protein BtuC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q9ZKW2 6.77e-37 139 34 10 339 3 jhp_0822 Probable iron chelatin transport system permease protein jhp_0822 Helicobacter pylori (strain J99 / ATCC 700824)
O05731 2.41e-36 137 33 10 339 3 HP_0889 Probable iron chelatin transport system permease protein HP_0889 Helicobacter pylori (strain ATCC 700392 / 26695)
Q57130 3.32e-36 137 30 5 328 1 molB Molybdate import system permease protein MolB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6D656 5.17e-36 136 33 3 282 3 btuC Vitamin B12 import system permease protein BtuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q87Q39 2.58e-35 134 32 3 261 3 btuC Vitamin B12 import system permease protein BtuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A8GDR2 8.96e-35 133 31 3 297 3 btuC Vitamin B12 import system permease protein BtuC Serratia proteamaculans (strain 568)
Q8Z6I5 1.07e-34 133 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhi
A8AHA4 1.22e-34 132 32 6 334 3 btuC Vitamin B12 import system permease protein BtuC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MFB6 1.37e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4T4N5 1.44e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella newport (strain SL254)
B5RAW6 1.44e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVW1 1.44e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella enteritidis PT4 (strain P125109)
Q8ZPS8 1.83e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUF7 1.83e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella schwarzengrund (strain CVM19633)
A9N235 1.83e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TGH8 1.83e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella heidelberg (strain SL476)
B5FJA1 1.83e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella dublin (strain CT_02021853)
B5F7F5 1.83e-34 132 34 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella agona (strain SL483)
Q9KSL2 1.99e-34 132 31 4 340 3 btuC Vitamin B12 import system permease protein BtuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q3Z259 2.11e-34 132 33 4 280 3 btuC Vitamin B12 import system permease protein BtuC Shigella sonnei (strain Ss046)
Q57PU6 6.07e-34 130 33 4 294 3 btuC Vitamin B12 import system permease protein BtuC Salmonella choleraesuis (strain SC-B67)
B7LQ78 7.7e-34 130 32 5 335 3 btuC Vitamin B12 import system permease protein BtuC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P40411 3.23e-33 129 29 5 315 1 feuC Iron-uptake system permease protein FeuC Bacillus subtilis (strain 168)
B5BA35 3.24e-33 129 33 3 293 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain AKU_12601)
Q5PH87 3.24e-33 129 33 3 293 3 btuC Vitamin B12 import system permease protein BtuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P15029 3.7e-33 128 32 4 296 1 fecD Fe(3+) dicitrate transport system permease protein FecD Escherichia coli (strain K12)
Q7N3Q3 5.35e-33 128 32 2 280 3 btuC Vitamin B12 import system permease protein BtuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O34832 7.15e-33 128 32 5 329 3 yfmE Fe(3+)-citrate import system permease protein YfmE Bacillus subtilis (strain 168)
P49936 1.42e-32 128 31 6 321 3 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Bacillus subtilis (strain 168)
B7L6I4 8.58e-32 125 33 5 296 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain 55989 / EAEC)
Q8FH26 1.42e-31 124 33 4 293 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MVJ0 1.85e-31 124 33 4 293 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O81 (strain ED1a)
B2U360 1.89e-31 124 34 4 282 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1IPL6 2.03e-31 124 34 4 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q3 2.03e-31 124 34 4 282 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O9:H4 (strain HS)
B7M1C0 2.71e-31 124 33 5 294 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O8 (strain IAI1)
A7ZMH9 2.71e-31 124 33 5 294 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32FI8 3.33e-31 123 33 4 294 3 btuC Vitamin B12 import system permease protein BtuC Shigella dysenteriae serotype 1 (strain Sd197)
Q7C1M5 3.47e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri
Q1RB84 3.73e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain UTI89 / UPEC)
B1LE19 3.73e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SMS-3-5 / SECEC)
P06609 3.73e-31 123 34 4 280 1 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12)
A1ABP7 3.73e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O1:K1 / APEC
B1XG18 3.73e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / DH10B)
C4ZYH3 3.73e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain K12 / MC4100 / BW2952)
B7NT65 3.73e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MAS2 3.73e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0THB7 4.01e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7US50 4.05e-31 123 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5YPZ9 4.53e-31 123 33 5 294 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4L7 4.53e-31 123 33 5 294 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O157:H7
B7N549 4.77e-31 123 33 5 294 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B6I8R6 5.92e-31 123 33 4 280 3 btuC Vitamin B12 import system permease protein BtuC Escherichia coli (strain SE11)
Q0T4S1 6.29e-31 122 34 4 280 3 btuC Vitamin B12 import system permease protein BtuC Shigella flexneri serotype 5b (strain 8401)
Q321G8 4.36e-30 120 33 4 282 3 btuC Vitamin B12 import system permease protein BtuC Shigella boydii serotype 4 (strain Sb227)
P40410 6.36e-30 120 31 9 320 1 feuB Iron-uptake system permease protein FeuB Bacillus subtilis (strain 168)
O31569 3.12e-28 115 30 5 319 1 yfhA Probable siderophore transport system permease protein YfhA Bacillus subtilis (strain 168)
P15030 5.3e-28 115 32 7 292 1 fecC Fe(3+) dicitrate transport system permease protein FecC Escherichia coli (strain K12)
O31568 5.5e-28 115 32 5 318 1 yfiZ Probable siderophore transport system permease protein YfiZ Bacillus subtilis (strain 168)
P23876 6.14e-28 115 34 5 306 1 fepD Ferric enterobactin transport system permease protein FepD Escherichia coli (strain K12)
O34933 9.61e-28 114 31 12 348 3 yfmD Fe(3+)-citrate import system permease protein YfmD Bacillus subtilis (strain 168)
P49937 1.65e-27 114 31 7 300 3 fhuG Iron(3+)-hydroxamate import system permease protein FhuG Bacillus subtilis (strain 168)
Q81L64 2.69e-25 110 29 7 326 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q81L64 4.96e-23 103 30 8 312 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q58286 2.93e-24 105 30 7 265 3 MJ0876 Putative ABC transporter permease protein MJ0876 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q47085 1.37e-23 103 31 8 327 3 cbrB Achromobactin transport system permease protein CbrB Dickeya dadantii (strain 3937)
Q9HQ19 2.53e-23 102 33 6 283 1 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G3 2.53e-23 102 33 6 283 3 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P06972 2.45e-21 99 30 5 276 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
P06972 2.02e-10 65 28 6 243 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Escherichia coli (strain K12)
O87656 3.41e-20 95 30 5 276 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87656 1.23e-11 69 28 5 266 1 fhuB Iron(3+)-hydroxamate import system permease protein FhuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2YX91 1.32e-18 89 27 6 319 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain bovine RF122 / ET3-1)
P23877 1.41e-18 89 32 9 301 1 fepG Ferric enterobactin transport system permease protein FepG Escherichia coli (strain K12)
Q6GHV2 2.36e-17 85 27 6 319 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MRSA252)
Q7A651 2.36e-17 85 27 6 319 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain N315)
Q99UX0 2.36e-17 85 27 6 319 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QG35 2.36e-17 85 27 6 319 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Newman)
Q5HGV0 2.36e-17 85 27 6 319 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain COL)
Q2FHU7 2.36e-17 85 27 6 319 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain USA300)
A7X154 2.36e-17 85 27 6 319 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain Mu3 / ATCC 700698)
P94418 4.89e-17 84 26 5 283 1 yclN Petrobactin import system permease protein YclN Bacillus subtilis (strain 168)
Q8NX64 7.85e-17 83 26 5 317 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MW2)
Q6GA81 7.85e-17 83 26 5 317 3 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain MSSA476)
P37738 2.21e-15 79 27 6 277 1 fatD Ferric-anguibactin transport system permease protein FatD Vibrio anguillarum (strain ATCC 68554 / 775)
Q2FZE5 1.09e-14 77 27 7 319 2 isdF Probable heme-iron transport system permease protein IsdF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q47086 2.94e-14 76 28 6 303 3 cbrC Achromobactin transport system permease protein CbrC Dickeya dadantii (strain 3937)
Q58287 6.73e-14 70 41 2 89 3 MJ0877 Putative ABC transporter permease protein MJ0877 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q81XB1 3.25e-13 73 27 6 279 1 fatD Petrobactin import system permease protein FatD Bacillus anthracis
Q81XB2 2.87e-08 58 26 11 292 1 fatC Petrobactin import system permease protein FatC Bacillus anthracis
P94419 3.16e-06 52 21 8 301 1 yclO Petrobactin import system permease protein YclO Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_14805
Feature type CDS
Gene fepD
Product ABC-type Fe3+-siderophore transport system, permease component
Location 61348 - 62445 (strand: -1)
Length 1098 (nucleotides) / 365 (amino acids)

Contig

Accession contig_19
Length 86773 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_386
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01032 FecCD transport family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0609 Inorganic ion transport and metabolism (P) P ABC-type Fe3+-siderophore transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02015 iron complex transport system permease protein - -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG044280 iron ABC transporter permease VF1252 Nutritional/Metabolic factor

Protein Sequence

MSITTEAMLQTKPEQAGSELSCDVKSHYRRVLRRRLMWMFAVVAVILCTVVLDFTMGPSGLTLDALWQTLVSPESVSAGTRVIVWEIRLPYALMAVVVGMSLGLAGAEMQTILNNPLASPFTLGVSNAASFGAALAIVLGIGIPGVPDQWFVSANAFIFALFSALMLDGITRWTRVATSGVVLFGIAMVFTFNALVSMMQFIATEDTLQGLVFWTMGSLARATWVKLGVMTLAFAILLPISMSNSWKLTALRLGEDRAVSFGINVRRLRLGTLLRISILTALAVAFVGPIAFIGLVAPHIARMMFGEDHRFYLPASALIGALVLSMASIASKNLIPGVIIPVGIVTSLVGVPFFLSMILRHKGSM

Flanking regions ( +/- flanking 50bp)

ATACTGGGTCAGCGGTAAATAATTTTAAGTAGTCAGCAGGTATTTGAATAATGAGTATTACCACAGAAGCAATGCTACAGACGAAGCCGGAACAGGCAGGCAGTGAATTAAGCTGTGATGTGAAATCACATTACCGGCGTGTACTGCGCAGGCGGCTGATGTGGATGTTTGCGGTGGTTGCGGTAATACTCTGTACCGTGGTGCTCGATTTCACCATGGGGCCGTCCGGGCTGACCCTTGATGCACTCTGGCAGACCCTGGTGTCGCCGGAAAGTGTATCCGCGGGCACCCGTGTGATTGTCTGGGAAATACGTCTGCCGTATGCCCTGATGGCCGTGGTGGTCGGCATGTCTCTCGGTCTTGCCGGGGCAGAGATGCAGACCATCCTCAATAACCCGCTGGCGAGTCCGTTTACCCTCGGCGTCTCCAACGCCGCATCGTTTGGTGCGGCGCTGGCGATAGTCCTCGGAATTGGTATTCCGGGCGTACCGGATCAGTGGTTTGTCTCCGCAAACGCCTTTATTTTTGCCCTGTTTTCCGCGCTGATGCTTGACGGCATCACCCGCTGGACACGAGTGGCAACCTCCGGTGTGGTGTTATTCGGTATCGCAATGGTCTTTACCTTTAACGCTCTGGTATCAATGATGCAGTTTATCGCTACGGAAGACACCTTACAGGGGCTGGTTTTCTGGACGATGGGCAGCCTGGCGCGCGCCACCTGGGTGAAACTGGGGGTGATGACGCTGGCCTTTGCCATTCTGCTGCCGATTTCCATGAGTAACTCGTGGAAGCTGACCGCACTGCGCCTCGGCGAAGATCGCGCTGTCAGTTTTGGTATTAACGTGCGCCGTCTGCGTCTCGGTACGTTGCTGCGCATCAGTATTCTGACCGCGCTGGCGGTGGCTTTTGTCGGCCCGATTGCGTTTATCGGCCTGGTCGCGCCGCACATTGCCCGCATGATGTTCGGTGAGGATCACCGTTTCTATCTGCCGGCGAGTGCATTAATCGGGGCGCTGGTATTGTCGATGGCATCCATTGCCTCGAAAAACCTGATTCCGGGCGTGATTATTCCGGTCGGTATTGTGACATCACTGGTAGGTGTGCCGTTCTTCCTGAGCATGATCCTGCGTCATAAAGGGAGCATGTAAGATGGATTTGAATGCAATGTCTGCTCAGAGCGGGTTACAGATTAAACACT