Homologs in group_352

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14805 FBDBKF_14805 30.1 Morganella morganii S1 fepD ABC-type Fe3+-siderophore transport system, permease component
EHELCC_15610 EHELCC_15610 30.1 Morganella morganii S2 fepD ABC-type Fe3+-siderophore transport system, permease component
NLDBIP_16140 NLDBIP_16140 30.1 Morganella morganii S4 fepD ABC-type Fe3+-siderophore transport system, permease component
LHKJJB_15700 LHKJJB_15700 30.1 Morganella morganii S3 fepD ABC-type Fe3+-siderophore transport system, permease component
HKOGLL_14820 HKOGLL_14820 30.1 Morganella morganii S5 fepD ABC-type Fe3+-siderophore transport system, permease component
F4V73_RS07605 F4V73_RS07605 29.7 Morganella psychrotolerans - iron ABC transporter permease
PMI_RS01110 PMI_RS01110 29.4 Proteus mirabilis HI4320 - iron ABC transporter permease

Distribution of the homologs in the orthogroup group_352

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_352

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P94419 1.36e-78 245 42 1 307 1 yclO Petrobactin import system permease protein YclO Bacillus subtilis (strain 168)
Q81XB2 3.9e-58 194 36 2 283 1 fatC Petrobactin import system permease protein FatC Bacillus anthracis
P37737 3.91e-49 169 31 1 299 1 fatC Ferric-anguibactin transport system permease protein FatC Vibrio anguillarum (strain ATCC 68554 / 775)
P49937 6.32e-10 63 26 10 282 3 fhuG Iron(3+)-hydroxamate import system permease protein FhuG Bacillus subtilis (strain 168)
Q56992 2.12e-09 61 24 5 276 1 hmuU Hemin transport system permease protein HmuU Yersinia pestis
A6TAH6 3.13e-09 60 25 9 274 3 btuC Vitamin B12 import system permease protein BtuC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q58287 3.61e-09 57 31 0 93 3 MJ0877 Putative ABC transporter permease protein MJ0877 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P40411 2.97e-08 58 19 9 278 1 feuC Iron-uptake system permease protein FeuC Bacillus subtilis (strain 168)
Q58286 9.59e-08 56 22 10 293 3 MJ0876 Putative ABC transporter permease protein MJ0876 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q57552 1.31e-07 56 22 4 277 3 MJ0087 Putative ABC transporter permease protein MJ0087 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P94418 1.91e-07 55 23 9 291 1 yclN Petrobactin import system permease protein YclN Bacillus subtilis (strain 168)
P15029 2.51e-07 55 31 3 117 1 fecD Fe(3+) dicitrate transport system permease protein FecD Escherichia coli (strain K12)
Q9KSL2 8.52e-07 53 33 3 115 3 btuC Vitamin B12 import system permease protein BtuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87Q39 2.03e-06 52 30 4 133 3 btuC Vitamin B12 import system permease protein BtuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P23876 4.11e-06 51 26 7 265 1 fepD Ferric enterobactin transport system permease protein FepD Escherichia coli (strain K12)
Q57130 1.05e-05 50 25 5 239 1 molB Molybdate import system permease protein MolB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7MLE7 1.18e-05 50 28 2 115 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain YJ016)
P40410 1.52e-05 49 27 11 268 1 feuB Iron-uptake system permease protein FeuB Bacillus subtilis (strain 168)
P15030 2.05e-05 49 33 3 109 1 fecC Fe(3+) dicitrate transport system permease protein FecC Escherichia coli (strain K12)
Q8D927 2.55e-05 48 29 2 115 3 btuC Vitamin B12 import system permease protein BtuC Vibrio vulnificus (strain CMCP6)
A8GDR2 5.59e-05 48 30 2 115 3 btuC Vitamin B12 import system permease protein BtuC Serratia proteamaculans (strain 568)
Q81L64 8.58e-05 48 26 10 268 1 fpuB Petrobactin import system permease protein FpuB Bacillus anthracis
Q3Z259 0.000219 46 24 9 274 3 btuC Vitamin B12 import system permease protein BtuC Shigella sonnei (strain Ss046)
Q9HQ19 0.000417 45 26 2 135 1 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G3 0.000417 45 26 2 135 3 btuC Cobalamin import system permease protein BtuC Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B7LQ78 0.00062 44 23 9 229 3 btuC Vitamin B12 import system permease protein BtuC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
O31568 0.000715 44 20 7 259 1 yfiZ Probable siderophore transport system permease protein YfiZ Bacillus subtilis (strain 168)
Q81XB1 0.000749 44 35 0 78 1 fatD Petrobactin import system permease protein FatD Bacillus anthracis

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14630
Feature type CDS
Gene -
Product iron chelate uptake ABC transporter family permease subunit
Location 3242060 - 3243067 (strand: 1)
Length 1008 (nucleotides) / 335 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_352
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01032 FecCD transport family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4605 Inorganic ion transport and metabolism (P) P ABC-type enterochelin transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K25283 iron-siderophore transport system permease protein - -

Protein Sequence

MQKVNSSMISKYTGAVQPKKVRLSPMARIWLLLGVSLLAIALFMTINLNGNISYILTHRAYIILTMIIVAFAAGVSTILFQTIANNRILTPSLMGLEALFVLLQTLFIFFEGDMPASWMANLTKFFLESALLVLFSVVLYRWLFSSVRFNINLVLMIGIILGTLFRSSATLLQRLMDPNEFSVLQSRMFATFTRATPDLILCALAIIVVVGVLLWRMRYSFDVMALGQANAINLGINYRKQTTYILLLISVLVAVSTALVGPLTFLGLIVANLAYHISGSSQHRFLMPVAFLLGTIALIGGQLILEYGLKMTGTLSVVIEFIGGMFFIYLVLRRL

Flanking regions ( +/- flanking 50bp)

GGCGGTAGGTGCTGTGATCTTCCTTTTCTTACTACTGAAGCAGCAACGTTATGCAAAAAGTTAATTCATCCATGATTAGCAAATATACTGGCGCTGTTCAACCTAAGAAAGTGCGCCTCTCACCTATGGCGCGTATTTGGCTCTTACTTGGCGTCTCATTATTAGCCATTGCGCTGTTTATGACGATCAACCTAAACGGTAATATCTCTTATATTCTGACACACCGCGCTTATATTATTCTGACGATGATCATCGTCGCCTTTGCGGCAGGCGTTTCTACTATACTGTTTCAGACTATCGCCAATAACCGCATTCTTACTCCTTCATTAATGGGCTTAGAAGCTCTGTTTGTATTGCTACAAACGCTCTTTATCTTTTTTGAAGGGGATATGCCCGCCTCTTGGATGGCCAATCTGACGAAGTTCTTTTTAGAGTCGGCCTTATTAGTGTTATTTTCGGTGGTTCTATATCGTTGGCTATTTAGTTCAGTACGCTTTAATATCAATTTAGTCCTTATGATTGGTATTATTTTAGGCACCCTATTTCGTAGCAGTGCAACGCTATTACAACGCCTCATGGACCCAAATGAGTTTTCTGTCTTACAAAGCCGTATGTTTGCGACATTTACTCGAGCCACTCCTGATCTTATCTTATGTGCATTAGCCATTATTGTCGTCGTCGGCGTATTACTTTGGCGTATGCGTTATAGTTTTGATGTGATGGCCTTAGGTCAGGCGAATGCGATTAATCTTGGTATTAATTATCGTAAGCAAACGACTTATATTCTATTACTTATCTCTGTTCTGGTTGCGGTATCAACAGCATTAGTAGGGCCGTTGACATTTTTAGGCTTAATTGTTGCTAATCTGGCTTATCATATTAGTGGTAGCAGTCAGCACCGCTTTTTAATGCCTGTGGCATTCTTATTAGGCACTATCGCACTGATTGGCGGACAATTGATTTTAGAGTATGGCTTAAAAATGACAGGTACTCTCTCTGTTGTGATTGAGTTTATTGGTGGTATGTTCTTTATTTATTTGGTATTAAGAAGACTTTAATATGATTGAAATCAGTAAGATATCAAAACGTTATCAAGACACAACAGTGC