Homologs in group_256

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06190 FBDBKF_06190 27.9 Morganella morganii S1 thyA thymidylate synthase
EHELCC_09235 EHELCC_09235 27.9 Morganella morganii S2 thyA thymidylate synthase
NLDBIP_09615 NLDBIP_09615 27.9 Morganella morganii S4 thyA thymidylate synthase
LHKJJB_08140 LHKJJB_08140 27.9 Morganella morganii S3 thyA thymidylate synthase
HKOGLL_07690 HKOGLL_07690 27.9 Morganella morganii S5 thyA thymidylate synthase
F4V73_RS15725 F4V73_RS15725 43.9 Morganella psychrotolerans thyA thymidylate synthase
PMI_RS11465 PMI_RS11465 31.7 Proteus mirabilis HI4320 - thymidylate synthase

Distribution of the homologs in the orthogroup group_256

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_256

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q83BG2 1.11e-54 183 31 7 341 3 thyA Thymidylate synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9N980 1.11e-54 183 31 7 341 3 thyA Thymidylate synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KF61 1.11e-54 183 31 7 341 3 thyA Thymidylate synthase Coxiella burnetii (strain Dugway 5J108-111)
C0ZI91 8.4e-53 179 32 8 355 3 thyA Thymidylate synthase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q5KZ25 1.66e-52 178 31 8 355 3 thyA Thymidylate synthase Geobacillus kaustophilus (strain HTA426)
Q47II1 1.35e-51 176 32 7 338 3 thyA Thymidylate synthase Dechloromonas aromatica (strain RCB)
A4INY1 2.74e-51 175 31 9 355 3 thyA Thymidylate synthase Geobacillus thermodenitrificans (strain NG80-2)
B7LNI2 3.81e-51 174 31 8 355 3 thyA Thymidylate synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7N8U4 4.52e-51 174 32 8 354 3 thyA Thymidylate synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7MR31 8.58e-51 173 31 8 355 3 thyA Thymidylate synthase Cronobacter sakazakii (strain ATCC BAA-894)
A1SJ31 1.27e-50 173 30 9 355 3 thyA Thymidylate synthase Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q31XG0 1.42e-50 173 31 8 355 3 thyA Thymidylate synthase Shigella boydii serotype 4 (strain Sb227)
Q3YY33 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Shigella sonnei (strain Ss046)
Q1R7I6 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli (strain UTI89 / UPEC)
B7N759 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A884 1.45e-50 173 31 8 355 1 thyA Thymidylate synthase Escherichia coli (strain K12)
P0A885 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TE05 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AF39 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O1:K1 / APEC
C4ZZX9 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LY83 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O8 (strain IAI1)
B7MZC6 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O81 (strain ED1a)
B7NVX2 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P0A886 1.45e-50 173 31 8 355 1 thyA Thymidylate synthase Escherichia coli O157:H7
B7LF04 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli (strain 55989 / EAEC)
B7MLH3 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UHP4 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQT3 1.45e-50 173 31 8 355 3 thyA Thymidylate synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
A4SIW7 1.93e-50 172 31 8 354 3 thyA Thymidylate synthase Aeromonas salmonicida (strain A449)
Q8Z412 2.1e-50 172 32 8 355 3 thyA Thymidylate synthase Salmonella typhi
P48464 2.39e-50 172 31 8 355 2 thyA Thymidylate synthase Shigella flexneri
Q0T137 2.39e-50 172 31 8 355 3 thyA Thymidylate synthase Shigella flexneri serotype 5b (strain 8401)
B8GN06 3.27e-50 172 33 12 372 3 thyA Thymidylate synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B1IU17 3.47e-50 172 31 8 355 3 thyA Thymidylate synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3W0 3.47e-50 172 31 8 355 3 thyA Thymidylate synthase Escherichia coli O9:H4 (strain HS)
Q32C94 4.44e-50 172 31 8 355 3 thyA Thymidylate synthase Shigella dysenteriae serotype 1 (strain Sd197)
A0KG32 4.68e-50 171 31 9 357 3 thyA Thymidylate synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1JPC9 5.73e-50 171 31 8 354 3 thyA Thymidylate synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8ZMA9 6.05e-50 171 31 8 355 3 thyA Thymidylate synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N2L7 6.05e-50 171 31 8 355 3 thyA Thymidylate synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PEN6 6.05e-50 171 31 8 355 3 thyA Thymidylate synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57KB6 6.05e-50 171 31 8 355 3 thyA Thymidylate synthase Salmonella choleraesuis (strain SC-B67)
C0PXI9 6.73e-50 171 31 8 355 3 thyA Thymidylate synthase Salmonella paratyphi C (strain RKS4594)
Q5X119 1.05e-49 171 30 8 355 3 thyA Thymidylate synthase Legionella pneumophila (strain Paris)
Q5ZRL3 1.28e-49 170 30 8 355 3 thyA Thymidylate synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
C6DAE9 1.4e-49 170 31 8 355 3 thyA Thymidylate synthase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D8I6 1.74e-49 170 31 8 355 3 thyA Thymidylate synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q667F9 2.34e-49 170 31 8 354 3 thyA Thymidylate synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FFE0 2.34e-49 170 31 8 354 3 thyA Thymidylate synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1W5A4 2.72e-49 170 29 8 354 3 thyA Thymidylate synthase Acidovorax sp. (strain JS42)
Q1BA64 3.3e-49 169 31 9 354 3 thyA Thymidylate synthase Mycobacterium sp. (strain MCS)
A1UEU8 3.3e-49 169 31 9 354 3 thyA Thymidylate synthase Mycobacterium sp. (strain KMS)
A3PYA8 3.3e-49 169 31 9 354 3 thyA Thymidylate synthase Mycobacterium sp. (strain JLS)
A6TDG3 3.37e-49 169 31 8 355 3 thyA Thymidylate synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A5II41 3.95e-49 169 30 8 355 3 thyA Thymidylate synthase Legionella pneumophila (strain Corby)
Q1LK81 5.21e-49 169 30 8 347 3 thyA Thymidylate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P54081 5.38e-49 169 31 8 355 3 thyA2 Thymidylate synthase 2 Bacillus amyloliquefaciens
A8AP42 5.44e-49 169 30 8 355 3 thyA Thymidylate synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4TLC5 5.61e-49 169 31 8 355 3 thyA Thymidylate synthase Yersinia pestis (strain Pestoides F)
Q1CFB5 5.61e-49 169 31 8 355 3 thyA Thymidylate synthase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZHV1 5.61e-49 169 31 8 355 3 thyA Thymidylate synthase Yersinia pestis
Q1CAR9 5.61e-49 169 31 8 355 3 thyA Thymidylate synthase Yersinia pestis bv. Antiqua (strain Antiqua)
Q89G35 6.59e-49 169 30 8 354 3 thyA Thymidylate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6MID2 7.41e-49 168 31 10 356 3 thyA Thymidylate synthase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A1AWQ8 8.97e-49 168 30 7 350 3 thyA Thymidylate synthase Ruthia magnifica subsp. Calyptogena magnifica
Q0K889 1.12e-48 168 31 8 347 3 thyA Thymidylate synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q3BX87 1.58e-48 167 31 7 354 3 thyA Thymidylate synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B7GI39 1.83e-48 167 30 9 355 3 thyA Thymidylate synthase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q6REU8 2.2e-48 167 30 8 355 3 thyA Thymidylate synthase Xenorhabdus nematophila (strain ATCC 19061 / DSM 3370 / CCUG 14189 / LMG 1036 / NCIMB 9965 / AN6)
A0QVR9 2.2e-48 167 31 9 357 3 thyA Thymidylate synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0JZC7 2.57e-48 167 33 6 313 3 thyA Thymidylate synthase Arthrobacter sp. (strain FB24)
Q4JX59 3.72e-48 167 30 8 357 3 thyA Thymidylate synthase Corynebacterium jeikeium (strain K411)
Q5GWB5 3.74e-48 167 32 6 339 3 thyA Thymidylate synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZH9 3.74e-48 167 32 6 339 3 thyA Thymidylate synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A4TCI9 4.04e-48 166 31 9 354 3 thyA Thymidylate synthase Mycolicibacterium gilvum (strain PYR-GCK)
A8GIH7 4.16e-48 166 30 8 355 3 thyA Thymidylate synthase Serratia proteamaculans (strain 568)
A4WE03 4.58e-48 166 30 8 355 3 thyA Thymidylate synthase Enterobacter sp. (strain 638)
Q5WSU5 4.73e-48 166 30 8 355 3 thyA Thymidylate synthase Legionella pneumophila (strain Lens)
A7Z5T3 4.93e-48 166 31 8 355 3 thyA Thymidylate synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
C5BH86 5.54e-48 166 31 9 353 3 thyA Thymidylate synthase Edwardsiella ictaluri (strain 93-146)
Q87BT4 7.8e-48 166 31 7 341 3 thyA Thymidylate synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8PP46 8.86e-48 166 31 7 354 3 thyA Thymidylate synthase Xanthomonas axonopodis pv. citri (strain 306)
Q5YPL7 1.26e-47 165 30 10 364 3 thyA Thymidylate synthase Nocardia farcinica (strain IFM 10152)
A5EVG5 1.75e-47 164 30 8 342 3 thyA Thymidylate synthase Dichelobacter nodosus (strain VCS1703A)
Q2K6G8 2.26e-47 164 31 7 337 3 thyA Thymidylate synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2W7P4 3.11e-47 164 29 8 354 3 thyA Thymidylate synthase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q1ME82 5.24e-47 164 31 7 337 3 thyA Thymidylate synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B6JB67 8.01e-47 163 29 8 354 3 thyA Thymidylate synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A5CWK3 8.45e-47 163 29 6 337 3 thyA Thymidylate synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
C1DK16 1.09e-46 163 31 7 339 3 thyA Thymidylate synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C5DAR2 1.11e-46 163 29 9 355 3 thyA Thymidylate synthase Geobacillus sp. (strain WCH70)
Q11VK5 2.06e-46 162 29 8 355 3 thyA Thymidylate synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q2NRH3 2.5e-46 162 31 7 337 3 thyA Thymidylate synthase Sodalis glossinidius (strain morsitans)
B8IF20 3.06e-46 162 29 7 355 3 thyA Thymidylate synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q9PB13 4.39e-46 161 30 7 341 3 thyA Thymidylate synthase Xylella fastidiosa (strain 9a5c)
A4YZC4 9.84e-46 160 29 8 354 3 thyA Thymidylate synthase Bradyrhizobium sp. (strain ORS 278)
Q2IYG7 1.01e-45 160 29 8 354 3 thyA Thymidylate synthase Rhodopseudomonas palustris (strain HaA2)
A0PQG7 1.07e-45 160 30 10 362 3 thyA Thymidylate synthase Mycobacterium ulcerans (strain Agy99)
C1D4I5 1.46e-45 160 30 8 355 3 thyA Thymidylate synthase Laribacter hongkongensis (strain HLHK9)
Q92NQ5 1.67e-45 160 29 8 354 3 thyA Thymidylate synthase Rhizobium meliloti (strain 1021)
C1D070 1.9e-45 159 30 7 339 3 thyA Thymidylate synthase Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
A3D1U3 2.05e-45 159 30 10 359 3 thyA Thymidylate synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
C4L1C9 2.25e-45 159 29 7 337 3 thyA Thymidylate synthase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q7NZ95 2.64e-45 159 30 8 356 3 thyA Thymidylate synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B7KQG2 2.67e-45 159 29 7 355 3 thyA Thymidylate synthase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A2SHH0 2.71e-45 160 32 7 313 3 thyA Thymidylate synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
P9WFR9 3.24e-45 159 31 8 339 1 thyA Thymidylate synthase ThyA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFR8 3.24e-45 159 31 8 339 3 thyA Thymidylate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6B7 3.24e-45 159 31 8 339 3 thyA Thymidylate synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AFM7 3.24e-45 159 31 8 339 3 thyA Thymidylate synthase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KMA6 3.24e-45 159 31 8 339 3 thyA Thymidylate synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67045 3.24e-45 159 31 8 339 3 thyA Thymidylate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1QJT8 3.63e-45 159 29 8 356 3 thyA Thymidylate synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q134B1 3.95e-45 159 29 8 354 3 thyA Thymidylate synthase Rhodopseudomonas palustris (strain BisB5)
Q6G2S8 4.13e-45 159 28 8 355 3 thyA Thymidylate synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A6UB24 4.17e-45 159 30 8 356 3 thyA Thymidylate synthase Sinorhizobium medicae (strain WSM419)
P67043 4.21e-45 159 29 8 355 3 thyA Thymidylate synthase Brucella suis biovar 1 (strain 1330)
B0CHI7 4.21e-45 159 29 8 355 3 thyA Thymidylate synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
P67042 4.21e-45 159 29 8 355 1 thyA Thymidylate synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RE38 4.21e-45 159 29 8 355 3 thyA Thymidylate synthase Brucella melitensis biotype 2 (strain ATCC 23457)
Q57CA9 4.21e-45 159 29 8 355 3 thyA Thymidylate synthase Brucella abortus biovar 1 (strain 9-941)
Q2YS22 4.21e-45 159 29 8 355 3 thyA Thymidylate synthase Brucella abortus (strain 2308)
A1R8Y7 4.57e-45 159 30 7 339 3 thyA Thymidylate synthase Paenarthrobacter aurescens (strain TC1)
C4K7G3 6.11e-45 158 29 7 354 3 thyA Thymidylate synthase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q3SQ36 6.24e-45 158 29 8 356 3 thyA Thymidylate synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B8EBR5 6.44e-45 158 28 8 354 3 thyA Thymidylate synthase Shewanella baltica (strain OS223)
A9L5M3 6.87e-45 158 29 10 359 3 thyA Thymidylate synthase Shewanella baltica (strain OS195)
A6WKP4 6.87e-45 158 29 10 359 3 thyA Thymidylate synthase Shewanella baltica (strain OS185)
A5VRE7 7.88e-45 158 29 8 355 3 thyA Thymidylate synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A0QIU1 9.55e-45 158 30 9 354 3 thyA Thymidylate synthase Mycobacterium avium (strain 104)
Q82WU3 9.85e-45 157 29 8 343 3 thyA Thymidylate synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A0KZP5 1.33e-44 157 28 8 354 3 thyA Thymidylate synthase Shewanella sp. (strain ANA-3)
Q73VZ2 1.33e-44 157 29 9 354 3 thyA Thymidylate synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q6N447 1.4e-44 157 29 8 354 3 thyA Thymidylate synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6A761 1.62e-44 157 29 8 354 3 thyA Thymidylate synthase Cutibacterium acnes (strain DSM 16379 / KPA171202)
A1RME0 1.67e-44 157 28 8 354 3 thyA Thymidylate synthase Shewanella sp. (strain W3-18-1)
A4Y4J1 1.67e-44 157 28 8 354 3 thyA Thymidylate synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6UYE6 1.84e-44 157 30 7 339 3 thyA Thymidylate synthase Pseudomonas aeruginosa (strain PA7)
A5FJV8 1.92e-44 157 29 7 350 3 thyA Thymidylate synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A1VQZ6 2.46e-44 157 29 7 354 3 thyA Thymidylate synthase Polaromonas naphthalenivorans (strain CJ2)
Q8EH94 2.48e-44 157 30 9 356 3 thyA Thymidylate synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q211X8 2.48e-44 157 28 7 356 3 thyA Thymidylate synthase Rhodopseudomonas palustris (strain BisB18)
A1KVB3 2.53e-44 157 30 8 340 3 thyA Thymidylate synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M657 2.64e-44 156 29 8 355 3 thyA Thymidylate synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
B9JXQ5 2.84e-44 156 29 8 356 3 thyA Thymidylate synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q0HSH8 3.23e-44 156 29 9 356 3 thyA Thymidylate synthase Shewanella sp. (strain MR-7)
Q0HG85 3.23e-44 156 29 9 356 3 thyA Thymidylate synthase Shewanella sp. (strain MR-4)
Q0SEI1 4.31e-44 156 28 9 354 3 thyA Thymidylate synthase Rhodococcus jostii (strain RHA1)
Q21U56 4.93e-44 156 29 7 337 3 thyA Thymidylate synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q6AFI0 5.71e-44 156 30 7 339 3 thyA Thymidylate synthase Leifsonia xyli subsp. xyli (strain CTCB07)
Q5F732 6.23e-44 155 30 8 340 3 thyA Thymidylate synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9I6F1 6.86e-44 155 30 7 339 3 thyA Thymidylate synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02U73 6.86e-44 155 30 7 339 3 thyA Thymidylate synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V2Q5 6.86e-44 155 30 7 339 3 thyA Thymidylate synthase Pseudomonas aeruginosa (strain LESB58)
Q8Y0U6 7.15e-44 155 29 7 337 3 thyA Thymidylate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9JY72 7.38e-44 155 30 8 340 3 thyA Thymidylate synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5EPD3 7.46e-44 155 29 8 354 3 thyA Thymidylate synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B8I0T8 8.38e-44 155 29 8 354 3 thyA Thymidylate synthase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q9JT57 1.19e-43 155 30 8 340 3 thyA Thymidylate synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A6WZV4 1.39e-43 155 29 8 355 3 thyA Thymidylate synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A1TM53 2.01e-43 155 29 7 354 3 thyA Thymidylate synthase Paracidovorax citrulli (strain AAC00-1)
A0LY29 3.13e-43 154 29 9 369 3 thyA Thymidylate synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A1S3W8 4.42e-43 153 30 8 340 3 thyA Thymidylate synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q12KG8 5.76e-43 153 27 7 354 3 thyA Thymidylate synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8A639 6.08e-43 153 29 8 355 3 thyA Thymidylate synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5L9L6 3.75e-42 151 29 8 355 3 thyA Thymidylate synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64PV5 4.26e-42 150 29 8 355 3 thyA Thymidylate synthase Bacteroides fragilis (strain YCH46)
Q0ABR1 5.09e-42 150 30 6 339 3 thyA Thymidylate synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A8FEB9 8.73e-42 150 28 8 355 3 thyA Thymidylate synthase Bacillus pumilus (strain SAFR-032)
A6LIC2 1.26e-41 149 28 7 355 3 thyA Thymidylate synthase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A6GWH3 1.51e-41 149 27 6 354 3 thyA Thymidylate synthase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q12CI6 1.8e-41 150 29 6 337 3 thyA Thymidylate synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
O33380 6.67e-41 147 29 9 341 3 thyA Thymidylate synthase Neisseria gonorrhoeae
Q3JEI2 3.33e-40 146 27 8 354 3 thyA Thymidylate synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A4SVT7 7.91e-40 145 27 7 354 3 thyA Thymidylate synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
P12461 8.64e-40 146 28 13 376 3 TMP1 Thymidylate synthase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8FR47 1.57e-39 144 29 9 354 3 thyA Thymidylate synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A6L1Q8 1.86e-39 144 28 9 355 3 thyA Thymidylate synthase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A1U3D8 2.16e-39 144 27 8 369 3 thyA Thymidylate synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1GFV4 7.73e-39 142 29 9 354 3 thyA Thymidylate synthase Ruegeria sp. (strain TM1040)
Q1LSU0 1.23e-37 139 27 8 355 3 thyA Thymidylate synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q0VM06 2.91e-37 138 28 8 350 3 thyA Thymidylate synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
E0U0H8 3.99e-37 137 39 4 178 3 thyA2 Thymidylate synthase 2 Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
E0U0H8 3.68e-09 60 33 1 107 3 thyA2 Thymidylate synthase 2 Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
C5BMA3 4.62e-37 138 27 8 337 3 thyA Thymidylate synthase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q31I55 1.25e-36 137 27 7 345 3 thyA Thymidylate synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q168V8 2.36e-36 136 29 11 356 3 thyA Thymidylate synthase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8NS38 3.49e-36 135 27 9 354 1 thyA Thymidylate synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QCI7 3.49e-36 135 27 9 354 3 thyA Thymidylate synthase Corynebacterium glutamicum (strain R)
P06785 6.05e-36 135 27 11 370 1 CDC21 Thymidylate synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5P233 8.6e-36 134 26 8 355 3 thyA Thymidylate synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
P11044 1.19e-35 134 39 4 178 1 thyA2 Thymidylate synthase 2 Bacillus subtilis (strain 168)
P11044 4.77e-09 60 33 1 107 1 thyA2 Thymidylate synthase 2 Bacillus subtilis (strain 168)
C0QWM9 1.8e-35 133 39 5 178 3 thyA Thymidylate synthase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
C0QWM9 1.08e-08 59 33 3 106 3 thyA Thymidylate synthase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q6FZ91 3.38e-35 132 26 9 356 3 thyA Thymidylate synthase Bartonella quintana (strain Toulouse)
A6WGF9 8.7e-35 132 38 4 180 3 thyA Thymidylate synthase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A6WGF9 4.95e-11 66 35 1 107 3 thyA Thymidylate synthase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q8PCE7 1.19e-34 131 28 10 354 3 thyA Thymidylate synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UR35 1.19e-34 131 28 10 354 3 thyA Thymidylate synthase Xanthomonas campestris pv. campestris (strain 8004)
Q9A6H0 1.4e-34 131 38 3 167 3 thyA Thymidylate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9A6H0 1.08e-11 68 34 2 107 3 thyA Thymidylate synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7MTB5 1.67e-34 130 30 7 265 3 thyA Thymidylate synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q7MTB5 4.32e-11 66 33 1 107 3 thyA Thymidylate synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
O81395 4.17e-34 135 27 11 367 2 DRTS Bifunctional dihydrofolate reductase-thymidylate synthase Zea mays
B0TYI1 6.49e-34 129 26 8 337 3 thyA Thymidylate synthase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
P0CS12 7.61e-34 130 28 12 367 1 TMP1 Thymidylate synthase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CS13 7.61e-34 130 28 12 367 3 TMP1 Thymidylate synthase Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A1KAF7 8.25e-34 129 39 3 162 3 thyA Thymidylate synthase Azoarcus sp. (strain BH72)
A1KAF7 2.17e-12 70 35 1 107 3 thyA Thymidylate synthase Azoarcus sp. (strain BH72)
Q11HI0 8.97e-34 129 39 3 167 3 thyA Thymidylate synthase Chelativorans sp. (strain BNC1)
Q11HI0 1.06e-11 68 26 7 244 3 thyA Thymidylate synthase Chelativorans sp. (strain BNC1)
Q9K7B5 9.06e-34 129 30 6 268 3 thyA Thymidylate synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K7B5 9.15e-11 65 33 1 107 3 thyA Thymidylate synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q27828 1.4e-33 132 27 12 373 3 GSPATT00019973001 Bifunctional dihydrofolate reductase-thymidylate synthase Paramecium tetraurelia
A1T7P4 1.53e-33 128 38 3 177 3 thyA Thymidylate synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1T7P4 6.6e-12 68 36 2 107 3 thyA Thymidylate synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P13100 1.58e-33 129 26 12 373 1 THYA Thymidylate synthase Pneumocystis carinii
A9IW82 1.78e-33 128 26 9 355 3 thyA Thymidylate synthase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q5WDS1 1.8e-33 128 36 3 179 3 thyA Thymidylate synthase Shouchella clausii (strain KSM-K16)
Q5WDS1 5.49e-08 57 29 1 107 3 thyA Thymidylate synthase Shouchella clausii (strain KSM-K16)
Q0C504 2.79e-33 127 39 4 177 3 thyA Thymidylate synthase Hyphomonas neptunium (strain ATCC 15444)
Q0C504 4.97e-11 65 36 2 107 3 thyA Thymidylate synthase Hyphomonas neptunium (strain ATCC 15444)
B9JH03 3.02e-33 129 28 10 366 3 thyA Thymidylate synthase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q4JQW2 4.31e-33 128 25 10 374 1 ORF13 Thymidylate synthase Varicella-zoster virus (strain Oka vaccine)
P09249 4.31e-33 128 25 10 374 3 ORF13 Thymidylate synthase Varicella-zoster virus (strain Dumas)
Q6F145 4.54e-33 127 26 9 385 3 thyA Thymidylate synthase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A4IXE8 4.63e-33 127 25 7 337 3 thyA Thymidylate synthase Francisella tularensis subsp. tularensis (strain WY96-3418)
A0Q7B4 4.63e-33 127 25 7 337 3 thyA Thymidylate synthase Francisella tularensis subsp. novicida (strain U112)
A9MS82 6.97e-33 126 37 5 188 3 thyA Thymidylate synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A9MS82 1.8e-15 79 35 2 130 3 thyA Thymidylate synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q27783 2.21e-32 130 26 10 371 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Trypanosoma brucei brucei
Q0BMM0 2.62e-32 125 25 7 344 3 thyA Thymidylate synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A486 2.62e-32 125 25 7 344 3 thyA Thymidylate synthase Francisella tularensis subsp. holarctica (strain LVS)
A7NB78 2.62e-32 125 25 7 344 3 thyA Thymidylate synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q8UDS3 4.25e-32 124 25 8 356 3 thyA Thymidylate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5NFK5 5.04e-32 124 25 7 337 3 thyA Thymidylate synthase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14H07 5.04e-32 124 25 7 337 3 thyA Thymidylate synthase Francisella tularensis subsp. tularensis (strain FSC 198)
Q9UTI7 8.19e-32 129 25 10 375 3 SPAC15E1.04 Probable thymidylate synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
C3PEY5 9.25e-32 124 38 4 180 3 thyA Thymidylate synthase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
C3PEY5 3.07e-10 63 26 5 202 3 thyA Thymidylate synthase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q05763 3.02e-31 127 26 11 367 2 THY-2 Bifunctional dihydrofolate reductase-thymidylate synthase 2 Arabidopsis thaliana
Q2QRX6 3.22e-31 127 27 11 352 3 Os12g0446900 Putative bifunctional dihydrofolate reductase-thymidylate synthase Oryza sativa subsp. japonica
C3K3Q8 3.51e-31 122 26 8 356 3 thyA Thymidylate synthase Pseudomonas fluorescens (strain SBW25)
A1WYP9 3.6e-31 122 27 10 355 3 thyA Thymidylate synthase Halorhodospira halophila (strain DSM 244 / SL1)
Q8EQG0 3.81e-31 123 24 10 407 3 thyA Thymidylate synthase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P07382 4.27e-31 126 25 11 379 1 LmjF06.0860 Bifunctional dihydrofolate reductase-thymidylate synthase Leishmania major
Q1Q8B2 7.84e-31 122 24 11 374 3 thyA Thymidylate synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A7GP90 9.2e-31 122 25 7 387 3 thyA Thymidylate synthase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
P16126 1.02e-30 125 26 11 379 3 None Bifunctional dihydrofolate reductase-thymidylate synthase Leishmania amazonensis
Q7UID0 1.41e-30 120 36 3 177 3 thyA Thymidylate synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UID0 4.95e-15 77 38 1 107 3 thyA Thymidylate synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q3SH96 1.42e-30 120 38 3 168 3 thyA Thymidylate synthase Thiobacillus denitrificans (strain ATCC 25259)
Q3SH96 3.68e-13 72 33 2 130 3 thyA Thymidylate synthase Thiobacillus denitrificans (strain ATCC 25259)
Q98KH9 2.22e-30 120 35 4 183 3 thyA Thymidylate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98KH9 5.07e-11 65 33 1 107 3 thyA Thymidylate synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8D2N4 2.49e-30 120 38 1 136 3 thyA Thymidylate synthase Wigglesworthia glossinidia brevipalpis
Q8D2N4 1.26e-09 62 29 3 132 3 thyA Thymidylate synthase Wigglesworthia glossinidia brevipalpis
Q9CBW0 2.8e-30 119 36 4 185 3 thyA Thymidylate synthase Mycobacterium leprae (strain TN)
Q9CBW0 2.18e-11 67 32 2 107 3 thyA Thymidylate synthase Mycobacterium leprae (strain TN)
Q8G3T9 5.59e-30 119 27 10 355 3 thyA Thymidylate synthase Bifidobacterium longum (strain NCC 2705)
A7HVX4 6.5e-30 119 34 3 178 3 thyA Thymidylate synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A7HVX4 4.13e-13 72 33 2 130 3 thyA Thymidylate synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q9P4T7 8.82e-30 119 26 12 374 3 tms1 Thymidylate synthase Agaricus bisporus
Q8K9C3 1.1e-29 118 34 5 177 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9C3 3.97e-13 72 32 1 112 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
C3MEE8 1.19e-29 119 25 7 365 3 thyA Thymidylate synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q0AHA4 1.37e-29 117 35 3 163 3 thyA Thymidylate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0AHA4 4.34e-12 69 31 2 130 3 thyA Thymidylate synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P51820 5.28e-29 120 25 11 367 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Glycine max
A4Y044 6.27e-29 116 31 4 206 3 thyA Thymidylate synthase Pseudomonas mendocina (strain ymp)
A4Y044 9.24e-14 73 35 1 107 3 thyA Thymidylate synthase Pseudomonas mendocina (strain ymp)
P57515 7.1e-29 115 32 3 177 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57515 2.41e-12 70 35 1 103 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q88W05 7.8e-29 117 24 7 379 3 thyA Thymidylate synthase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q1QUD9 7.95e-29 115 30 6 253 3 thyA Thymidylate synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1QUD9 4.95e-12 68 36 1 107 3 thyA Thymidylate synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B8D7X0 8.11e-29 115 32 3 177 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D7X0 2.32e-12 70 35 1 103 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8ELI3 8.52e-29 115 34 4 178 3 thyA Thymidylate synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B8ELI3 3.47e-11 66 35 1 109 3 thyA Thymidylate synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B8D9L8 8.54e-29 115 32 3 177 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8D9L8 2.24e-12 70 34 1 107 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q6NIF2 1.33e-28 115 30 7 224 3 thyA Thymidylate synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
P59427 1.36e-28 115 25 10 355 3 thyA Thymidylate synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q21NW5 1.75e-28 115 24 9 350 3 thyA Thymidylate synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C1KWH4 2.3e-28 115 25 7 372 3 thyA Thymidylate synthase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q9RAM7 2.39e-28 114 30 5 223 3 thyA1 Thymidylate synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9RAM7 1.05e-14 76 40 3 110 3 thyA1 Thymidylate synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A0AJY0 2.63e-28 115 25 7 372 3 thyA Thymidylate synthase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q71YE1 3.19e-28 115 25 7 372 3 thyA Thymidylate synthase Listeria monocytogenes serotype 4b (strain F2365)
B8DDM8 4.38e-28 115 24 7 400 3 thyA Thymidylate synthase Listeria monocytogenes serotype 4a (strain HCC23)
A4VGL9 4.42e-28 114 31 4 206 3 thyA Thymidylate synthase Stutzerimonas stutzeri (strain A1501)
A4VGL9 2.33e-13 72 35 1 107 3 thyA Thymidylate synthase Stutzerimonas stutzeri (strain A1501)
O76511 4.84e-28 115 25 6 325 1 Ts Thymidylate synthase Drosophila melanogaster
Q92AD4 6.25e-28 114 24 7 400 3 thyA Thymidylate synthase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y626 6.78e-28 114 24 7 400 3 thyA Thymidylate synthase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P45350 7.15e-28 117 26 12 364 2 None Bifunctional dihydrofolate reductase-thymidylate synthase Daucus carota
A1UTA5 8.44e-28 113 33 4 178 3 thyA Thymidylate synthase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A1UTA5 3.48e-13 72 35 1 107 3 thyA Thymidylate synthase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q97EV3 2.58e-27 111 24 9 358 3 thyA Thymidylate synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q03YZ8 3.56e-27 112 26 12 389 3 thyA Thymidylate synthase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q603S2 4.54e-26 108 32 3 179 3 thyA Thymidylate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q603S2 3.69e-12 69 35 3 132 3 thyA Thymidylate synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2SA17 8.48e-26 107 32 3 168 3 thyA Thymidylate synthase Hahella chejuensis (strain KCTC 2396)
Q2SA17 5.09e-15 77 40 1 107 3 thyA Thymidylate synthase Hahella chejuensis (strain KCTC 2396)
O96650 8.56e-26 108 25 12 370 2 None Thymidylate synthase Ascaris suum
Q834R3 1.31e-25 108 25 13 385 1 thyA Thymidylate synthase Enterococcus faecalis (strain ATCC 700802 / V583)
Q27793 1.6e-25 110 24 10 369 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Trypanosoma cruzi
Q88CN9 2.53e-25 107 25 10 387 3 thyA Thymidylate synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B7I4U0 5.26e-25 105 25 11 349 1 thyA Thymidylate synthase Acinetobacter baumannii (strain AB0057)
B7H0P4 5.26e-25 105 25 11 349 3 thyA Thymidylate synthase Acinetobacter baumannii (strain AB307-0294)
A5WAK1 8.4e-25 105 26 14 370 3 thyA Thymidylate synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q23695 4.18e-24 106 24 13 371 3 None Bifunctional dihydrofolate reductase-thymidylate synthase Crithidia fasciculata
Q9Z671 4.19e-24 103 28 4 209 3 thyA Thymidylate synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q9Z671 4.35e-10 63 33 1 107 3 thyA Thymidylate synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q044A1 6.62e-24 103 26 9 360 3 thyA Thymidylate synthase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q9WBI3 1.32e-23 102 23 9 371 3 IIV6-225R Probable thymidylate synthase 225R Invertebrate iridescent virus 6
Q6FER7 1.37e-23 102 25 11 349 3 thyA Thymidylate synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q039F7 3.1e-23 101 24 8 404 3 thyA Thymidylate synthase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q6YQT0 6.47e-23 100 22 6 367 3 thyA Thymidylate synthase Onion yellows phytoplasma (strain OY-M)
Q74IU3 2.27e-22 99 25 11 382 3 thyA Thymidylate synthase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q2NJ46 2.73e-22 98 21 7 385 3 thyA Thymidylate synthase Aster yellows witches'-broom phytoplasma (strain AYWB)
Q1GTH6 3.03e-22 99 32 3 188 3 thyA Thymidylate synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A5WHY0 3.67e-22 98 29 5 191 3 thyA Thymidylate synthase Psychrobacter sp. (strain PRwf-1)
A5WHY0 2.62e-17 84 42 1 107 3 thyA Thymidylate synthase Psychrobacter sp. (strain PRwf-1)
Q4A611 4.86e-22 97 27 4 206 3 thyA Thymidylate synthase Mycoplasmopsis synoviae (strain 53)
Q4A611 1.91e-12 70 31 1 132 3 thyA Thymidylate synthase Mycoplasmopsis synoviae (strain 53)
Q6HJC7 8.15e-22 97 23 8 387 3 thyA Thymidylate synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81R23 8.15e-22 97 23 8 387 3 thyA Thymidylate synthase Bacillus anthracis
A0RDL9 8.15e-22 97 23 8 387 3 thyA Thymidylate synthase Bacillus thuringiensis (strain Al Hakam)
Q63BV5 8.39e-22 97 24 8 387 3 thyA Thymidylate synthase Bacillus cereus (strain ZK / E33L)
Q81E05 8.48e-22 97 24 8 387 3 thyA Thymidylate synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q738X7 9.17e-22 97 24 8 387 3 thyA Thymidylate synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
P47469 1.63e-21 96 29 3 195 3 thyA Thymidylate synthase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47469 4.78e-10 63 34 1 107 3 thyA Thymidylate synthase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A4WQT6 4.55e-21 95 32 4 188 3 thyA Thymidylate synthase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A4WQT6 2.97e-08 58 30 1 107 3 thyA Thymidylate synthase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q07PP0 5.43e-21 95 32 3 188 3 thyA Thymidylate synthase Rhodopseudomonas palustris (strain BisA53)
Q07PP0 1.98e-05 49 29 1 131 3 thyA Thymidylate synthase Rhodopseudomonas palustris (strain BisA53)
Q98Q31 6.64e-21 94 23 8 366 3 thyA Thymidylate synthase Mycoplasmopsis pulmonis (strain UAB CTIP)
A5VJK9 7.06e-21 95 25 14 366 3 thyA Thymidylate synthase Limosilactobacillus reuteri (strain DSM 20016)
A8Z406 8.78e-21 95 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GGY0 8.78e-21 95 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain MRSA252)
A6QGX8 8.78e-21 95 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain Newman)
Q5HFZ6 8.78e-21 95 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain COL)
Q2YY40 8.78e-21 95 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FYK5 8.78e-21 95 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH11 8.78e-21 95 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain USA300)
B3QZX0 1.13e-20 94 22 7 366 3 thyA Thymidylate synthase Phytoplasma mali (strain AT)
P67048 1.13e-20 94 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain MW2)
Q6G9D4 1.13e-20 94 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain MSSA476)
P67047 1.13e-20 94 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain N315)
P67046 1.13e-20 94 23 12 414 1 thyA Thymidylate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ISV8 1.13e-20 94 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain JH9)
A6U1P7 1.13e-20 94 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain JH1)
A7X2B3 1.13e-20 94 23 12 414 3 thyA Thymidylate synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
P00469 1.17e-20 94 24 8 404 1 thyA Thymidylate synthase Lacticaseibacillus casei
Q67JQ1 1.19e-20 94 26 13 352 3 thyA Thymidylate synthase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q05762 1.63e-20 96 27 9 291 1 THY-1 Bifunctional dihydrofolate reductase-thymidylate synthase 1 Arabidopsis thaliana
Q05762 5e-11 67 32 1 107 1 THY-1 Bifunctional dihydrofolate reductase-thymidylate synthase 1 Arabidopsis thaliana
Q87UL4 1.95e-20 94 31 8 209 3 thyA Thymidylate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UL4 0.000124 47 28 5 148 3 thyA Thymidylate synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2G6V6 2.05e-20 94 34 6 190 3 thyA Thymidylate synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q2G6V6 8.92e-07 53 29 2 108 3 thyA Thymidylate synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q3J0W9 2.37e-20 93 31 3 188 3 thyA Thymidylate synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3J0W9 2.86e-08 58 31 1 107 3 thyA Thymidylate synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q8EV81 3.05e-20 92 27 4 206 3 thyA Thymidylate synthase Malacoplasma penetrans (strain HF-2)
Q8EV81 9.55e-16 80 39 1 107 3 thyA Thymidylate synthase Malacoplasma penetrans (strain HF-2)
Q03F96 8.39e-20 92 24 7 363 3 thyA Thymidylate synthase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
P04818 8.71e-20 92 34 5 173 1 TYMS Thymidylate synthase Homo sapiens
P04818 3.73e-12 70 35 1 107 1 TYMS Thymidylate synthase Homo sapiens
Q9XC19 1.08e-19 91 27 4 213 3 thyA Thymidylate synthase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
P12462 1.17e-19 91 30 6 192 3 TS Thymidylate synthase Herpesvirus ateles
P12462 3.11e-13 72 35 1 107 3 TS Thymidylate synthase Herpesvirus ateles
A3PLD1 1.18e-19 91 31 3 188 3 thyA Thymidylate synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A3PLD1 3.53e-08 57 31 1 107 3 thyA Thymidylate synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q6KIQ6 1.24e-19 91 29 3 173 3 thyA Thymidylate synthase Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q6KIQ6 2.12e-16 82 39 1 107 3 thyA Thymidylate synthase Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
P07607 1.34e-19 91 32 7 186 1 Tyms Thymidylate synthase Mus musculus
P07607 7.48e-12 68 35 1 107 1 Tyms Thymidylate synthase Mus musculus
A5VCW6 1.42e-19 91 30 2 188 3 thyA Thymidylate synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A9NG27 1.72e-19 90 27 3 187 3 thyA Thymidylate synthase Acholeplasma laidlawii (strain PG-8A)
A9NG27 2.52e-10 64 32 1 107 3 thyA Thymidylate synthase Acholeplasma laidlawii (strain PG-8A)
P06854 4.17e-19 89 30 6 182 3 70 Thymidylate synthase Saimiriine herpesvirus 2 (strain 11)
P06854 5.08e-11 66 33 1 107 3 70 Thymidylate synthase Saimiriine herpesvirus 2 (strain 11)
Q49XN8 4.85e-19 90 23 12 385 3 thyA Thymidylate synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P45352 5.39e-19 89 32 5 186 1 Tyms Thymidylate synthase Rattus norvegicus
P45352 8.29e-12 68 35 1 107 1 Tyms Thymidylate synthase Rattus norvegicus
Q07422 5.43e-19 92 33 6 181 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Toxoplasma gondii
Q07422 2.58e-14 77 34 3 131 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Toxoplasma gondii
Q7VUE3 5.59e-19 90 28 6 204 3 thyA Thymidylate synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2TA32 6.67e-19 90 32 6 182 2 TYMS Thymidylate synthase Bos taurus
Q2TA32 3.41e-08 58 45 0 59 2 TYMS Thymidylate synthase Bos taurus
P90463 1.49e-18 89 33 3 170 1 70 Thymidylate synthase Human herpesvirus 8 type P (isolate GK18)
P90463 1.35e-08 59 29 1 107 1 70 Thymidylate synthase Human herpesvirus 8 type P (isolate GK18)
P0C0M5 1.56e-18 88 22 9 372 3 thyA Thymidylate synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMP6 1.56e-18 88 22 9 372 3 thyA1 Thymidylate synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0A0M5 1.56e-18 88 22 9 372 3 thyA Thymidylate synthase Staphylococcus aureus
Q7W1A9 2.69e-18 88 28 6 204 3 thyA Thymidylate synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WP13 2.69e-18 88 28 6 204 3 thyA Thymidylate synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q89940 4.47e-18 87 32 4 174 3 70 Thymidylate synthase Equine herpesvirus 2 (strain 86/87)
Q89940 1.33e-09 62 31 1 107 3 70 Thymidylate synthase Equine herpesvirus 2 (strain 86/87)
Q04FR4 9.09e-18 86 23 15 389 3 thyA Thymidylate synthase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04B29 1.67e-17 85 27 7 251 3 thyA Thymidylate synthase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q04B29 1.26e-10 65 34 1 107 3 thyA Thymidylate synthase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAP2 1.67e-17 85 27 7 251 3 thyA Thymidylate synthase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1GAP2 1.26e-10 65 34 1 107 3 thyA Thymidylate synthase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P78029 3.8e-17 84 28 2 162 3 thyA Thymidylate synthase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P78029 8.49e-10 62 35 2 107 3 thyA Thymidylate synthase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P20712 6.47e-17 85 33 4 145 3 None Bifunctional dihydrofolate reductase-thymidylate synthase Plasmodium chabaudi
P20712 3.07e-09 62 28 2 132 3 None Bifunctional dihydrofolate reductase-thymidylate synthase Plasmodium chabaudi
Q03S95 9.19e-17 83 26 5 230 3 thyA Thymidylate synthase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03S95 2.5e-10 64 33 1 107 3 thyA Thymidylate synthase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q4L6D7 1.14e-16 83 27 4 200 3 thyA Thymidylate synthase Staphylococcus haemolyticus (strain JCSC1435)
Q4L6D7 5.56e-15 78 36 1 107 3 thyA Thymidylate synthase Staphylococcus haemolyticus (strain JCSC1435)
Q27713 1.55e-16 84 33 4 145 3 None Bifunctional dihydrofolate reductase-thymidylate synthase Plasmodium berghei (strain Anka)
Q27713 1.33e-09 63 31 1 107 3 None Bifunctional dihydrofolate reductase-thymidylate synthase Plasmodium berghei (strain Anka)
Q5FKL6 3.84e-16 81 27 6 227 3 thyA Thymidylate synthase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5FKL6 2.55e-13 73 39 2 107 3 thyA Thymidylate synthase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q1WU17 1.09e-15 80 27 5 203 3 thyA Thymidylate synthase Ligilactobacillus salivarius (strain UCC118)
Q1WU17 4.36e-14 75 38 1 107 3 thyA Thymidylate synthase Ligilactobacillus salivarius (strain UCC118)
P13922 2.22e-15 80 31 3 145 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Plasmodium falciparum (isolate K1 / Thailand)
P13922 8.93e-11 67 31 2 132 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Plasmodium falciparum (isolate K1 / Thailand)
Q5UQG3 5.64e-15 79 28 4 156 3 MIMI_R497 Bifunctional dihydrofolate reductase-thymidylate synthase Acanthamoeba polyphaga mimivirus
O02604 1.01e-14 79 31 4 145 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Plasmodium vivax
O02604 2.1e-11 68 34 1 107 1 None Bifunctional dihydrofolate reductase-thymidylate synthase Plasmodium vivax
A8YUW0 1.07e-14 77 28 7 202 3 thyA Thymidylate synthase Lactobacillus helveticus (strain DPC 4571)
A8YUW0 8.17e-12 68 36 2 107 3 thyA Thymidylate synthase Lactobacillus helveticus (strain DPC 4571)
O62584 1.93e-14 76 28 2 171 1 TS-1 Thymidylate synthase 1/2 Encephalitozoon cuniculi (strain GB-M1)
O62584 2.8e-11 67 34 3 106 1 TS-1 Thymidylate synthase 1/2 Encephalitozoon cuniculi (strain GB-M1)
Q8SRG2 1.97e-14 76 28 2 171 3 TS-3 Thymidylate synthase 3 Encephalitozoon cuniculi (strain GB-M1)
Q8SRG2 2.31e-11 67 34 3 106 3 TS-3 Thymidylate synthase 3 Encephalitozoon cuniculi (strain GB-M1)
Q6QGJ5 2.05e-14 76 28 6 195 1 thy Probable thymidylate synthase Escherichia phage T5
Q6QGJ5 1.57e-09 61 34 1 101 1 thy Probable thymidylate synthase Escherichia phage T5
Q38WX8 3.35e-14 76 28 6 204 3 thyA Thymidylate synthase Latilactobacillus sakei subsp. sakei (strain 23K)
Q38WX8 1.24e-12 71 38 1 107 3 thyA Thymidylate synthase Latilactobacillus sakei subsp. sakei (strain 23K)
P00471 4.96e-14 75 27 7 193 1 TD Thymidylate synthase Enterobacteria phage T4
P00471 2.84e-08 58 38 2 80 1 TD Thymidylate synthase Enterobacteria phage T4
Q9UWQ5 5.35e-14 75 33 7 169 3 thyA Thymidylate synthase Haloferax volcanii
P0C0M4 8.84e-14 70 37 2 100 3 thyA Thymidylate synthase (Fragment) Staphylococcus epidermidis
E0TVT6 1.04e-13 73 24 15 370 3 thyA1 Thymidylate synthase 1 Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
Q9ANR7 1.3e-13 73 24 13 335 3 thyA Thymidylate synthase Bacillus mojavensis
P0CI79 1.1e-12 71 24 13 340 1 thyA1 Thymidylate synthase 1 Bacillus subtilis (strain 168)
A6M378 1.63e-12 70 23 8 235 3 thyA Thymidylate synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6M378 4.32e-10 63 33 0 107 3 thyA Thymidylate synthase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P07606 3.8e-12 69 27 5 185 3 thyP3 Thymidylate synthase Bacillus phage phi3T
Q5D189 4.29e-12 69 29 4 154 3 thyA Thymidylate synthase Bacillus subtilis subsp. natto
Q59212 6.67e-12 68 25 4 185 3 thyA Thymidylate synthase Bacillus licheniformis
Q65J44 6.67e-12 68 25 4 185 3 thyA Thymidylate synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q3IDN1 1.43e-11 67 28 5 187 3 thyA Thymidylate synthase Pseudoalteromonas translucida (strain TAC 125)
Q3IDN1 0.000188 46 27 2 110 3 thyA Thymidylate synthase Pseudoalteromonas translucida (strain TAC 125)
P57808 2.1e-10 64 28 5 187 3 thyA Thymidylate synthase Pasteurella multocida (strain Pm70)
O30394 1.22e-09 61 30 4 134 3 thyA Thymidylate synthase (Fragment) Bacillus atrophaeus
O30397 1.36e-09 61 30 4 134 3 thyA1 Thymidylate synthase 1 (Fragment) Bacillus amyloliquefaciens
A5UI47 6.15e-09 60 27 5 188 3 thyA Thymidylate synthase Haemophilus influenzae (strain PittGG)
A3QBR4 1.02e-08 59 29 5 188 3 thyA Thymidylate synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8CQK7 1.38e-08 58 27 5 187 3 thyA Thymidylate synthase Shewanella piezotolerans (strain WP3 / JCM 13877)
A8H1B4 2.23e-08 58 27 5 187 3 thyA Thymidylate synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A8H1B4 0.001 44 26 2 116 3 thyA Thymidylate synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q65VJ8 2.58e-08 58 23 13 369 3 thyA Thymidylate synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5R064 2.58e-08 58 24 3 185 3 thyA Thymidylate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5R064 0.000535 45 32 3 105 3 thyA Thymidylate synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A5UDH0 2.66e-08 58 27 5 188 3 thyA Thymidylate synthase Haemophilus influenzae (strain PittEE)
P44420 6.84e-08 57 25 3 186 3 thyA Thymidylate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B0UWT7 9.17e-08 56 25 5 188 3 thyA Thymidylate synthase Histophilus somni (strain 2336)
Q0I563 9.17e-08 56 25 5 188 3 thyA Thymidylate synthase Histophilus somni (strain 129Pt)
A8FSC3 1.65e-07 55 26 4 187 3 thyA Thymidylate synthase Shewanella sediminis (strain HAW-EB3)
A6VMA0 2.75e-07 55 23 12 369 3 thyA Thymidylate synthase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q87SA0 4.98e-07 54 22 13 377 3 thyA Thymidylate synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5E7P1 6.14e-07 53 24 5 191 3 thyA Thymidylate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E7P1 9.05e-05 47 27 2 110 3 thyA Thymidylate synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A7MXJ9 6.97e-07 53 25 5 191 3 thyA Thymidylate synthase Vibrio campbellii (strain ATCC BAA-1116)
A1SS96 9.86e-07 53 27 5 184 3 thyA Thymidylate synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q4QM04 1.04e-06 53 25 3 186 3 thyA Thymidylate synthase Haemophilus influenzae (strain 86-028NP)
Q47Y31 1.7e-06 52 25 5 188 3 thyA Thymidylate synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7MNN6 2.22e-06 52 25 5 191 3 thyA Thymidylate synthase Vibrio vulnificus (strain YJ016)
Q8DER9 2.32e-06 52 25 5 191 3 thyA Thymidylate synthase Vibrio vulnificus (strain CMCP6)
B7VJ78 3.16e-06 52 25 5 191 3 thyA Thymidylate synthase Vibrio atlanticus (strain LGP32)
A5F8Y6 1.25e-05 50 25 5 191 3 thyA Thymidylate synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C3LST0 1.39e-05 49 25 5 191 3 thyA Thymidylate synthase Vibrio cholerae serotype O1 (strain M66-2)
O66108 1.39e-05 49 25 5 191 3 thyA Thymidylate synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q07YY3 1.87e-05 49 29 2 110 3 thyA Thymidylate synthase Shewanella frigidimarina (strain NCIMB 400)
C4LD19 3.6e-05 48 26 5 188 3 thyA Thymidylate synthase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B0TIU4 6.96e-05 47 28 2 109 3 thyA Thymidylate synthase Shewanella halifaxensis (strain HAW-EB4)
Q02Y43 0.000132 47 25 7 187 3 thyA Thymidylate synthase Lactococcus lactis subsp. cremoris (strain SK11)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS17895
Feature type CDS
Gene -
Product thymidylate synthase
Location 20229 - 21344 (strand: -1)
Length 1116 (nucleotides) / 371 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000008
Length 103951 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_256
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00303 Thymidylate synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0207 Nucleotide transport and metabolism (F) F Thymidylate synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MENDIKNHLALSNDDSFRQVIEAVYNEGELSNNNRTGVPTRGLSFIPSFYHLTGGLVPMLSGKAVNEKPLLVELEWYLRGEGNIRFMSENGVKIWNQWADENGDLGPVYGKQWRKWRDTRVVTVSEFEEIKHRGYVVDGELTDGRLAVTREIDQLQRIVDNLRNDPENRRNIMSAWNVGELEDMQLPPCHFAFGTWSREVSPDQRFYIAVETGANHFAHGIVSKYSAMISDLVDENGALPDLDTLAETVTHEWLDARGIPRRVLNTGMVQRSVDTFVGMPFNIAGYGILTHYLAHITDHMADNFTHFGFDVHLYSNHEDGFKEYTGRREIEESYPVVVFPESWKELSDFNWQEIQILGYQSHDWIKVPVAK

Flanking regions ( +/- flanking 50bp)

CTACCAATCTTATATAAAATGTAAGTACGTAAATACATACAGAGGGCATTATGGAAAATGATATCAAAAACCACCTTGCACTGAGCAACGACGATTCATTCCGACAGGTTATTGAAGCTGTCTACAACGAGGGTGAATTATCAAATAACAACCGTACAGGTGTTCCGACTCGCGGATTGAGCTTTATTCCAAGTTTTTATCATCTTACCGGTGGTCTTGTTCCGATGCTGTCAGGTAAAGCCGTTAACGAAAAACCGCTTCTGGTTGAACTTGAATGGTATCTGCGCGGTGAGGGTAATATCCGCTTTATGAGCGAAAACGGCGTGAAAATCTGGAATCAATGGGCGGATGAAAACGGCGATCTCGGGCCGGTGTATGGCAAGCAATGGCGTAAGTGGCGCGATACCCGGGTTGTGACTGTCTCAGAGTTTGAAGAAATCAAGCACAGGGGCTATGTGGTGGATGGGGAGCTGACGGATGGTCGTCTGGCTGTTACCCGCGAAATCGACCAGTTACAGCGCATCGTGGATAATCTGCGTAACGACCCTGAGAACCGCCGTAACATCATGTCAGCGTGGAACGTTGGTGAGCTGGAGGATATGCAGCTTCCGCCGTGTCACTTCGCGTTCGGGACGTGGAGTCGTGAAGTCAGTCCGGATCAGCGTTTTTATATTGCAGTGGAAACCGGTGCGAATCATTTTGCTCACGGTATTGTGTCGAAATACTCAGCCATGATCAGTGATCTTGTTGATGAAAACGGCGCATTGCCGGATCTCGATACTCTGGCGGAAACGGTCACTCATGAATGGCTTGATGCCCGAGGCATTCCGCGCCGTGTACTGAACACCGGCATGGTGCAGCGCAGCGTTGATACCTTTGTCGGTATGCCTTTCAACATCGCTGGCTACGGCATTCTGACGCACTATCTGGCGCATATCACCGATCACATGGCGGACAATTTTACCCACTTCGGGTTTGACGTTCACCTGTATAGCAATCACGAAGACGGATTCAAAGAATACACCGGTCGTCGTGAAATCGAGGAAAGCTACCCTGTGGTGGTATTCCCTGAGTCGTGGAAAGAGTTGTCAGATTTCAACTGGCAGGAAATTCAGATCCTCGGTTATCAGTCTCACGACTGGATCAAAGTGCCTGTTGCGAAGTAAGGAAGCCTCAATGCAACCTCTGGTTATTTGTACCATTGACGGTGTGCTGT