Homologs in group_363

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13015 FBDBKF_13015 90.8 Morganella morganii S1 copA copper-exporting P-type ATPase CopA
EHELCC_06330 EHELCC_06330 90.8 Morganella morganii S2 copA copper-exporting P-type ATPase CopA
NLDBIP_06650 NLDBIP_06650 90.8 Morganella morganii S4 copA copper-exporting P-type ATPase CopA
LHKJJB_03530 LHKJJB_03530 90.8 Morganella morganii S3 copA copper-exporting P-type ATPase CopA
HKOGLL_07005 HKOGLL_07005 90.8 Morganella morganii S5 copA copper-exporting P-type ATPase CopA
F4V73_RS04945 F4V73_RS04945 44.2 Morganella psychrotolerans - heavy metal translocating P-type ATPase
PMI_RS10710 PMI_RS10710 76.6 Proteus mirabilis HI4320 copA copper-exporting P-type ATPase CopA

Distribution of the homologs in the orthogroup group_363

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_363

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZCA7 0.0 1268 66 6 963 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q8ZR95 0.0 1184 71 3 841 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR95 5.88e-17 89 39 3 161 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR95 3.38e-05 51 41 1 65 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XD24 0.0 1183 71 3 842 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q8XD24 2.14e-18 94 38 3 162 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q8Z8S4 0.0 1182 71 3 841 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8Z8S4 5.78e-17 89 39 3 161 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8Z8S4 3.44e-05 51 41 1 65 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q59385 0.0 1179 71 3 842 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q59385 2.16e-18 94 38 3 162 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q9KPZ7 0.0 796 47 9 909 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KPZ7 0.000106 50 40 2 71 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9X5X3 0.0 597 41 11 863 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q9X5X3 6.11e-11 70 36 4 128 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q9X5X3 2.67e-08 61 43 1 72 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
P58342 0.0 573 40 11 866 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58342 5.69e-14 80 36 5 154 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58342 5.55e-08 60 43 1 72 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58341 0.0 561 39 12 864 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
P58341 2.42e-09 65 37 6 134 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
P73241 0.0 561 41 13 756 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9ZHC7 0.0 560 45 8 662 1 silP Silver exporting P-type ATPase Salmonella typhimurium
O32220 0.0 546 38 15 870 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
P37279 0.0 545 43 13 751 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5ZWR1 9.27e-177 533 43 9 663 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8CN02 2.64e-176 533 37 12 854 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 2.64e-176 533 37 12 854 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L970 1.12e-174 529 38 15 850 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
Q2YWA3 1.18e-173 527 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YWA3 8.6e-09 63 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GDP1 7.17e-173 525 37 13 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q6GDP1 1.02e-08 63 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q8NUQ9 1.11e-172 524 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q8NUQ9 8.38e-09 63 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 1.11e-172 524 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q6G6B7 8.38e-09 63 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
A8Z3F8 2.95e-172 523 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
A8Z3F8 8.53e-09 63 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 2.95e-172 523 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q2FDV0 8.53e-09 63 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
A6QK47 3.43e-172 523 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
A6QK47 8.9e-09 63 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 3.43e-172 523 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q5HCZ3 8.9e-09 63 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 3.43e-172 523 37 14 862 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FV64 8.9e-09 63 31 7 148 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q4A0G1 4.66e-172 522 37 21 863 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A0G1 0.000198 48 30 9 150 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A3E6 6.89e-171 520 37 14 862 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q7A3E6 2.63e-08 61 31 7 148 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 6.89e-171 520 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99R80 2.63e-08 61 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 6.89e-171 520 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A5IVY3 2.63e-08 61 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 6.89e-171 520 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A6U4T8 2.63e-08 61 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 6.89e-171 520 37 14 862 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X6S1 2.63e-08 61 31 7 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9X5V3 4.95e-164 503 46 5 617 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
P32113 3.07e-159 487 38 16 748 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
O29777 7.29e-155 478 37 12 732 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O29777 0.000724 47 47 2 59 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P9WPS3 3.14e-149 462 43 7 615 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 3.14e-149 462 43 7 615 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6H7M3 6.51e-149 468 33 16 945 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
Q9SH30 1.08e-147 465 31 17 972 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
P77868 2.12e-145 451 37 16 758 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A3AWA4 1.12e-144 457 31 19 970 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q9S7J8 1.16e-141 449 32 15 977 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
P35670 3.32e-134 440 30 20 1034 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P35670 1.23e-07 59 21 6 269 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P37385 1.44e-132 419 36 15 790 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q59467 1.09e-131 416 33 14 760 3 copA Copper-transporting ATPase Helicobacter pylori
O08462 3.33e-131 414 32 17 768 3 copA Copper-transporting ATPase Helicobacter pylori
P07893 7.89e-131 415 36 15 790 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A0A0P0X004 1.44e-129 417 37 10 661 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
A0A0P0X004 9.55e-05 50 26 4 152 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
A0A0P0X004 0.000231 48 26 4 180 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q9XT50 3.45e-129 427 30 22 1035 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 4.59e-07 57 26 5 153 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 1.75e-06 55 24 9 264 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q64446 6.7e-129 426 31 19 918 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64446 1.96e-06 55 22 8 286 1 Atp7b Copper-transporting ATPase 2 Mus musculus
P77871 1.42e-128 407 32 17 768 3 copA Copper-transporting ATPase Helicobacter pylori
O32619 1.98e-128 407 34 11 735 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
Q9ZM69 3.97e-128 406 32 15 765 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q64535 1.14e-127 422 31 19 918 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64535 1.15e-07 59 23 11 298 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64430 1.43e-127 422 28 21 1041 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 2.87e-07 58 27 7 177 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 3.72e-05 51 21 10 287 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 0.000416 48 22 9 279 1 Atp7a Copper-transporting ATPase 1 Mus musculus
P55989 6.65e-127 403 32 17 768 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
P70705 7.9e-127 420 28 21 1047 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 1.72e-08 62 28 7 182 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 0.000376 48 34 1 70 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 0.000674 47 19 10 411 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
Q04656 1.86e-126 419 28 19 1054 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 2.83e-07 58 27 7 182 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
O30085 7.73e-123 391 36 10 652 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P9WPU1 1.22e-119 385 36 14 750 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 1.22e-119 385 36 14 750 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P49015 9.96e-118 395 27 20 1045 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P49015 1.44e-07 59 27 7 182 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P38995 2.02e-116 382 30 31 993 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P46840 2.55e-113 367 34 16 761 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
P9WPT8 5.25e-113 367 36 18 771 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 5.25e-113 367 36 18 771 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPT9 5.59e-113 367 36 18 771 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O59666 5.85e-113 371 30 19 896 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B9DFX7 1.4e-109 361 30 16 833 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
P05425 2.06e-109 357 33 13 657 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q69HU0 1.05e-101 334 31 10 652 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
A8YZ02 1.62e-101 334 32 10 653 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 1.62e-101 334 32 10 653 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
Q8CQF7 1.83e-101 334 31 10 652 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6GIX4 2.19e-101 334 31 10 652 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
Q9SZC9 1.18e-100 339 33 16 771 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
Q5HKB0 8.07e-100 329 31 12 653 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4LAB1 1.89e-99 328 31 12 654 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
Q9CCL1 9.66e-99 328 36 7 551 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
P9WPT5 4.41e-98 326 35 9 617 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 4.41e-98 326 35 9 617 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 4.41e-98 326 35 9 617 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P58414 3.9e-96 320 30 14 690 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B2HEM2 6.29e-96 321 35 10 614 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
P46839 6.43e-96 322 34 12 755 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
P20021 9.58e-94 315 30 15 761 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
P37386 2.22e-93 316 29 22 870 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
Q6GIX1 3.4e-90 305 30 17 750 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
P30336 6.12e-90 304 31 15 709 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q60048 1.12e-85 292 29 20 760 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
O31688 3.1e-84 286 34 10 557 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
Q3YW59 5.92e-83 285 30 17 789 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
P37617 6.96e-83 285 30 17 789 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
O32219 3.83e-82 283 29 17 741 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
O33533 6.97e-82 283 29 13 743 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
Q59998 4.02e-81 280 34 12 559 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q59207 2.54e-79 275 30 17 745 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P18398 7.3e-74 261 29 17 742 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
P38360 1.21e-73 267 29 12 632 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9SZW4 3.74e-72 260 31 14 563 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
A0R3A7 1.3e-71 252 33 14 614 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WPT7 2.71e-69 246 33 10 550 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 2.71e-69 246 33 10 550 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O64474 1.9e-67 248 31 16 564 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
A3BF39 2.14e-66 244 30 8 507 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
Q59465 1.03e-65 237 29 9 508 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9RQB4 3.15e-65 235 26 15 703 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
Q9ZL53 7.45e-64 231 29 7 507 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
P0CW78 4.05e-61 225 27 21 742 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
P9WPS7 1.27e-52 201 33 13 632 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 1.27e-52 201 33 13 632 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 1.27e-52 201 33 13 632 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8YPE9 1.03e-50 194 29 12 559 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P9WPT3 1.09e-50 193 30 14 629 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 1.09e-50 193 30 14 629 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 1.09e-50 193 30 14 629 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8H384 2.73e-49 192 32 10 508 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
Q9R6X1 1.01e-48 188 30 11 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
Q9M3H5 2.86e-46 182 29 12 538 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
Q8R8I6 4.33e-46 180 29 11 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P57700 5.38e-46 179 27 12 553 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
O32328 8.1e-45 176 27 12 554 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B4U8E4 1.76e-43 172 28 4 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
Q9RZP0 1.06e-42 169 29 5 445 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8U9D9 1.27e-42 169 32 7 422 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8YSD5 1.81e-42 169 30 11 480 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q97BF6 7.34e-42 167 27 12 538 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q98GX6 1.95e-41 166 31 7 435 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q57RN0 2.57e-41 165 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
Q5HK64 4.8e-41 164 27 15 530 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 4.8e-41 164 27 15 530 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 4.8e-41 164 27 15 530 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 4.8e-41 164 27 15 530 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8PCM1 4.96e-41 164 32 8 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4LAI2 7.93e-41 164 27 15 535 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
C3LF99 7.98e-41 164 29 9 447 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q8PPC9 8.57e-41 164 33 8 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
A9VFM1 1.34e-40 163 28 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
Q926K7 1.34e-40 163 29 8 467 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B7HWG1 1.38e-40 163 28 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
C1EYK0 1.43e-40 163 28 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
Q81HQ0 2.14e-40 163 28 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7GLG4 2.81e-40 162 28 9 473 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q6HN78 2.95e-40 162 29 9 447 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7II09 4.43e-40 162 28 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
B7HDF9 4.63e-40 162 28 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
A0RA13 4.95e-40 162 29 9 447 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
B7JRB8 5.5e-40 161 29 9 447 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
P73867 5.78e-40 161 31 9 447 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q63FR0 5.81e-40 161 28 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
Q92XJ0 1.67e-39 160 30 9 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
P0CW77 2.62e-39 157 25 14 570 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
Q9A7X7 3.18e-39 159 30 7 428 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P59219 6.52e-39 158 29 9 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
A4W860 1.19e-38 157 30 11 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
B5XZE9 1.43e-38 157 31 10 432 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
Q9X8Z9 2.39e-38 157 30 9 420 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B4SZB1 3.4e-38 156 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
B5BCA4 3.79e-38 155 30 11 434 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 3.79e-38 155 30 11 434 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5EZE3 3.96e-38 155 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
B2V2P3 4.73e-38 155 29 8 456 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
A9MUE0 5.01e-38 155 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A6T6D8 5.1e-38 155 30 10 432 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TBA6 5.54e-38 155 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 5.54e-38 155 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
B5R670 5.62e-38 155 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
B4TQ22 6.01e-38 155 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
B5FNE0 6.11e-38 155 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
Q72TM6 7.38e-38 155 29 9 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B7N9U0 8.02e-38 155 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8XU11 9.29e-38 155 30 8 437 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8ZQW2 1.2e-37 154 29 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FJV4 1.49e-37 154 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 1.49e-37 154 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UKX6 1.49e-37 154 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7MPK0 1.52e-37 154 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
B1IY32 2.32e-37 153 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q927G0 2.54e-37 153 29 14 501 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B6HYQ5 2.78e-37 153 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 2.78e-37 153 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
P03960 3.15e-37 153 28 9 457 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 3.15e-37 153 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 3.15e-37 153 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
A7ZXV8 3.33e-37 153 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
B7NMQ0 3.85e-37 152 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LKR7 4.21e-37 152 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLE1 4.44e-37 152 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
B2TMJ2 4.53e-37 152 29 8 456 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
B5YQN9 4.77e-37 152 28 12 490 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 4.77e-37 152 28 12 490 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
Q324L0 5.04e-37 152 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
Q2YUH7 5.21e-37 152 27 8 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q3Z4A6 5.37e-37 152 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
Q8NVI2 8.48e-37 151 27 10 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 8.48e-37 151 27 10 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
Q1REM0 9.29e-37 151 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 9.29e-37 151 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 9.29e-37 151 29 11 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
B8DAW1 9.99e-37 151 29 14 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
B7M5L3 1.1e-36 151 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 1.1e-36 151 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
Q71W90 1.48e-36 151 29 13 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 1.48e-36 151 29 13 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8KU73 1.8e-36 150 27 7 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q6GEZ7 2.32e-36 150 27 8 472 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
P9WPU3 2.95e-36 150 29 7 440 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 2.95e-36 150 29 7 440 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 2.95e-36 150 29 7 440 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8Y3Z7 3.58e-36 150 29 14 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A8Z4X9 3.98e-36 149 27 8 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 3.98e-36 149 27 8 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 3.98e-36 149 27 8 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
P57698 4e-36 149 29 8 455 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P63684 4.02e-36 149 27 8 472 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 4.02e-36 149 27 8 472 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A4TL06 7.94e-36 149 29 16 558 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 7.94e-36 149 29 16 558 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 7.94e-36 149 29 16 558 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 7.94e-36 149 29 16 558 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 7.94e-36 149 29 16 558 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 7.94e-36 149 29 16 558 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
Q93MV5 8.48e-36 149 30 8 445 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
P57699 8.94e-36 149 25 15 580 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 8.94e-36 149 25 15 580 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B2TTJ7 1.31e-35 148 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q667S4 1.61e-35 147 31 12 446 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7N6W6 2.05e-35 147 28 11 490 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JR96 2.13e-35 147 31 12 446 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 2.13e-35 147 31 12 446 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JQS2 3.07e-35 147 32 12 430 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A0AM16 3.89e-35 146 29 14 492 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q0TRT3 4.16e-35 146 28 9 456 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q47H39 2.49e-34 144 28 7 432 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
A8GB61 6.22e-34 143 30 10 430 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
A4SZG8 5.34e-33 140 28 10 448 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q58623 7.13e-33 140 26 12 530 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
C4LDL7 1.11e-32 139 28 7 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B2VJK3 2.01e-32 138 27 8 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P07038 4.79e-29 128 25 10 537 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P19657 8.03e-29 128 25 10 504 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P28877 1.33e-28 127 24 10 505 1 PMA1 Plasma membrane ATPase 1 Candida albicans
P35597 3.09e-28 125 25 11 512 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P36640 4.26e-28 125 24 15 585 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 4.26e-28 125 24 15 585 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
P0ABB8 4.54e-28 125 24 16 586 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 4.54e-28 125 24 16 586 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
P05030 1.21e-27 124 24 9 503 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9LY32 3.68e-27 122 27 18 542 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
P78036 6.87e-27 121 24 15 564 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P24545 1.03e-26 121 24 9 547 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
P47317 1e-25 117 24 16 573 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q43128 4.1e-25 116 25 14 528 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
P09627 1.13e-24 114 24 11 546 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08436 1.28e-24 114 25 17 548 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
P12522 1.82e-24 114 25 12 512 2 H1B Probable proton ATPase 1B Leishmania donovani
P49380 2e-24 114 24 9 503 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P54679 2.5e-24 113 24 17 548 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
Q07421 2.7e-24 113 24 10 531 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
P11718 2.93e-24 113 25 13 513 2 H1A Probable proton ATPase 1A Leishmania donovani
Q8Z8E5 5.45e-24 111 31 5 279 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
P28876 9.09e-24 112 24 10 538 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08435 1.39e-23 111 25 16 546 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
P19456 2.83e-23 110 24 14 525 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
Q9SU58 2.94e-23 110 26 18 550 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
A0R3Y2 4.32e-23 109 25 12 564 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7XPY2 7.05e-23 108 24 17 531 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
P83970 9.05e-23 108 25 17 528 2 ha1 Plasma membrane ATPase Triticum aestivum
P22036 1.27e-22 108 23 18 631 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9LV11 1.3e-22 108 25 17 548 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9M2A0 2.95e-22 107 24 12 521 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
P54210 4.69e-22 106 24 17 605 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
Q9SJB3 5.67e-22 105 25 14 527 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
P20649 7.4e-22 105 23 11 523 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
Q9SH76 1.69e-21 104 24 14 528 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
Q8Y8Q5 7.51e-21 102 34 3 188 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8Q5 4.55e-12 73 25 6 262 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P9WPT0 4.25e-19 96 24 12 491 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPT1 4.29e-19 96 24 12 491 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 4.29e-19 96 24 12 491 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P54211 8.9e-19 95 22 14 600 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
Q9M2L4 1.54e-18 95 22 17 603 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9CFU9 1.19e-17 92 32 3 188 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q9CFU9 2.02e-07 58 23 5 251 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
O77696 1.47e-17 91 34 2 175 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
O77696 0.000164 49 24 7 262 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
P35316 2.28e-17 91 31 4 212 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
Q292Q0 5.05e-17 90 30 4 212 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q292Q0 0.00044 48 24 9 272 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
P22700 8.1e-17 89 29 4 212 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
P22700 0.000114 50 25 9 266 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
Q9YGL9 8.28e-17 89 35 2 159 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 3.19e-05 51 21 6 264 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q4WHC8 3.72e-16 87 30 5 221 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WHC8 0.000446 48 23 7 280 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q73E41 4.99e-16 86 34 2 159 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73E41 5.19e-07 57 24 7 261 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
O53114 5.96e-16 87 25 13 564 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
Q7PPA5 6.96e-16 86 29 4 212 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q7PPA5 0.000364 48 24 9 272 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q64518 7.5e-16 86 32 2 175 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64518 0.000264 48 24 7 262 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
P04191 8.76e-16 86 30 4 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P22189 1.01e-15 85 26 10 327 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P22189 5.83e-05 50 25 10 292 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q93084 1.09e-15 85 32 2 175 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q93084 0.001 47 24 7 262 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q7XEK4 1.1e-15 85 33 4 182 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q7XEK4 3.5e-05 51 24 5 218 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q0VCY0 1.36e-15 85 30 4 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
P18596 1.41e-15 85 34 2 159 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P18596 0.000298 48 24 7 262 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
Q8R429 1.59e-15 85 30 4 215 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q64578 1.6e-15 85 30 4 215 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q92105 1.68e-15 85 30 4 215 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
O14983 1.89e-15 85 30 4 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O43108 2e-15 84 32 2 166 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O43108 9.81e-11 69 25 5 243 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P16615 2.49e-15 84 32 3 184 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P37367 2.61e-15 84 33 5 203 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37367 4.83e-05 51 23 4 227 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37278 2.89e-15 84 33 3 172 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37278 2.84e-13 77 26 8 317 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P20647 2.93e-15 84 32 3 184 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P11507 5.15e-15 83 32 3 184 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P13585 5.24e-15 83 29 4 215 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
O55143 5.33e-15 83 32 3 184 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
P11607 5.51e-15 83 32 3 184 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
Q03669 6e-15 83 32 3 184 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q00779 7.14e-15 83 32 3 184 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
O46674 7.26e-15 83 32 3 184 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
P70083 9.22e-15 82 29 4 215 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P13586 1.11e-14 82 32 4 175 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13586 8.54e-09 63 23 6 268 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54209 1.16e-14 82 33 2 172 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
O13397 1.29e-14 82 33 3 174 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
Q9XES1 1.34e-14 82 32 4 167 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
Q9XES1 1.63e-05 52 26 7 255 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
O59868 1.62e-14 82 33 4 185 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59868 1.56e-13 78 26 6 268 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P92939 1.82e-14 82 32 4 167 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P92939 1.89e-05 52 26 7 255 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
Q42883 2.2e-14 81 28 3 201 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q42883 5.99e-07 57 23 8 322 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q7XB51 2.68e-14 81 30 1 178 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q7XB51 2.62e-10 68 25 6 270 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
O23087 4.15e-14 80 29 3 195 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O23087 5.46e-08 60 23 8 327 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
C1L360 4.83e-14 80 33 2 175 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
C1L360 3.36e-12 74 30 8 249 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
Q9SY55 5.49e-14 80 28 2 195 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q9SY55 0.000159 49 24 6 257 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q4WND5 6.53e-14 80 29 5 211 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WND5 0.00063 47 23 6 263 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O13398 7.82e-14 79 32 3 174 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O13398 2.56e-07 58 25 10 285 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O22218 1.07e-13 79 30 3 184 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O22218 4.55e-06 54 24 7 242 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
Q64392 1.11e-13 79 28 6 262 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 6.9e-06 53 22 6 280 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
O34431 1.86e-13 78 31 5 178 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
O34431 0.000273 48 24 11 317 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
Q9HDW7 2.47e-13 78 34 2 156 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HDW7 0.000394 48 24 6 240 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B9QMJ0 2.65e-13 78 30 6 250 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
Q03194 3.82e-13 77 31 4 192 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
Q03194 1.72e-09 65 27 5 192 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
P54707 4.3e-13 77 24 11 390 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 6.29e-07 57 23 6 260 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
Q08853 5.53e-13 77 32 3 177 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
P20431 8.72e-13 76 30 4 194 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
P20431 2.52e-08 61 25 5 218 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
P17326 1.01e-12 76 26 3 193 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 8.94e-08 60 23 4 237 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P28774 1.21e-12 75 27 4 213 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 6.67e-07 57 24 8 252 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
Q65X71 1.74e-12 75 32 6 192 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q65X71 1.06e-07 59 25 9 315 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
P35315 1.93e-12 75 31 2 159 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P35315 1.03e-08 63 23 7 300 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
Q12691 2.03e-12 75 31 3 174 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12691 4.42e-05 51 23 11 270 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 2.07e-12 75 31 3 174 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 4.85e-05 51 23 11 270 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9WV27 2.07e-12 75 28 3 192 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9WV27 1.96e-06 55 22 8 291 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9LIK7 2.38e-12 75 27 6 226 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q9LIK7 0.000328 48 21 5 257 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q9Z1W8 2.7e-12 74 28 6 259 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9Z1W8 3.88e-05 51 24 7 303 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9TV52 2.74e-12 74 27 6 262 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 1.58e-08 62 23 5 279 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
P54708 2.99e-12 74 27 6 262 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 4.04e-06 54 22 7 303 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P38929 3.17e-12 74 30 5 214 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q92030 4.44e-12 73 26 6 233 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q92030 3.31e-07 58 23 5 258 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q8R4C1 4.75e-12 73 25 5 255 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q8R4C1 5.92e-10 67 32 3 178 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q42556 5.66e-12 73 29 4 192 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
Q42556 2.59e-08 61 27 5 192 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
P58312 5.71e-12 73 26 5 236 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 1.14e-09 66 24 6 254 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P13587 5.89e-12 73 31 3 174 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13587 5.32e-05 50 23 11 270 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q64566 7.96e-12 73 30 6 235 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q64566 2.37e-09 65 26 8 259 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q8RUN1 8.34e-12 73 31 5 182 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q8RUN1 2.05e-05 52 26 5 222 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
P25489 8.43e-12 73 25 5 235 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 1.24e-05 53 23 3 251 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
Q9LY77 8.97e-12 73 28 5 197 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
Q64541 1.01e-11 72 26 6 236 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q64541 4.11e-06 54 23 6 237 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
P22180 1.19e-11 72 30 4 192 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
P22180 8.96e-10 66 27 7 213 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
A7L9Z8 1.38e-11 72 24 5 255 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
A7L9Z8 2.99e-10 68 32 3 178 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
P05025 1.38e-11 72 25 4 244 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 1.95e-07 58 25 8 256 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
J9VQQ3 1.44e-11 72 30 2 172 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q92123 1.5e-11 72 26 6 236 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92123 2.38e-06 55 22 5 283 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q9LF79 1.53e-11 72 29 4 186 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
Q9T0E0 1.57e-11 72 23 12 463 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
P13607 1.65e-11 72 27 4 212 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 6.5e-08 60 25 8 280 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
Q9SZR1 1.68e-11 72 28 4 187 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q80XR2 1.76e-11 72 29 6 235 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q80XR2 4.53e-09 64 26 8 258 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
O75185 2.06e-11 72 33 4 178 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
O75185 3.78e-11 70 25 4 253 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
Q92036 2.2e-11 71 28 5 239 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q9YH26 2.59e-11 71 25 6 236 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 1.21e-06 56 24 5 258 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q5RDR3 2.66e-11 71 27 3 192 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RDR3 1.25e-07 59 24 7 283 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RCD8 2.75e-11 71 25 6 236 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 8.13e-08 60 25 8 256 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
P05023 2.85e-11 71 27 3 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P05023 3.98e-08 61 24 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P18907 2.94e-11 71 27 3 192 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 1.8e-08 62 24 7 285 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
Q08DA1 2.97e-11 71 27 3 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 2.93e-08 61 24 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P98194 3.01e-11 71 30 7 249 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P98194 1.2e-09 66 26 8 259 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P04074 3.02e-11 71 27 3 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 2.91e-08 61 24 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
Q92126 3.11e-11 71 24 7 316 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 1.64e-05 52 24 6 258 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
P57709 3.19e-11 71 30 6 235 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P57709 2.42e-09 65 26 8 259 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P09572 3.21e-11 71 27 3 192 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 4.41e-08 61 24 7 284 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
Q9N0Z6 3.24e-11 71 28 3 189 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9N0Z6 3.7e-07 58 21 4 253 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
P24797 3.61e-11 71 25 6 240 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 3.39e-07 58 25 8 256 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
Q5R5K5 3.73e-11 70 32 4 190 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q5R5K5 1.43e-09 65 26 8 259 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q6RWA9 3.73e-11 70 27 3 192 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q6RWA9 5.07e-09 63 26 7 258 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
P23980 4.18e-11 70 29 4 192 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
P06687 4.53e-11 70 26 6 237 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 5.76e-09 63 26 8 259 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 4.53e-11 70 26 6 237 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 5.76e-09 63 26 8 259 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
P13637 4.69e-11 70 26 6 237 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 6.01e-09 63 26 8 259 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P50993 4.95e-11 70 25 6 236 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 5.69e-08 60 26 8 259 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
A2VDL6 4.99e-11 70 25 6 236 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 4.52e-08 60 26 8 259 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
P06686 5.12e-11 70 25 6 236 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
P06686 2.31e-08 62 25 8 256 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
D2WKD8 5.12e-11 70 25 6 236 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 4.41e-08 61 26 8 259 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
Q6PIE5 5.12e-11 70 25 6 236 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6PIE5 2.31e-08 62 25 8 256 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
P20648 5.37e-11 70 26 5 239 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 1.33e-06 56 22 5 257 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P50996 5.46e-11 70 26 5 239 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 8.46e-07 57 22 5 257 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P09626 5.65e-11 70 26 5 239 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 1.42e-06 56 22 5 257 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P19156 5.7e-11 70 26 5 239 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 1.31e-06 56 22 5 257 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
Q64436 5.9e-11 70 26 5 237 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 1.34e-06 56 22 5 257 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q8VDN2 5.97e-11 70 27 3 192 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q8VDN2 1.92e-07 58 23 6 255 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
P06685 6.08e-11 70 27 3 192 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06685 2.11e-07 58 23 6 255 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P27112 6.16e-11 70 26 5 239 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 3.94e-06 54 22 5 257 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P24798 6.87e-11 70 26 6 236 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 3.99e-09 64 27 8 259 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P30714 7.14e-11 70 27 3 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 1.24e-06 56 22 7 258 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
Q6Q477 8.09e-11 70 29 6 205 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
Q37145 9.95e-11 69 30 5 182 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q37145 4.82e-05 51 25 6 216 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q9LU41 1e-10 69 28 4 189 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
Q6ATV4 1.14e-10 69 29 5 186 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q6ATV4 0.000803 47 24 12 319 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
P9WPS9 1.18e-10 69 29 5 227 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS9 6.68e-07 57 26 7 272 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 1.18e-10 69 29 5 227 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS8 6.68e-07 57 26 7 272 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 1.18e-10 69 29 5 227 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63688 6.68e-07 57 26 7 272 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
D3K0R6 1.23e-10 69 29 5 205 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
P23634 1.53e-10 69 29 5 202 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
P05024 1.81e-10 68 27 3 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P05024 1.03e-07 59 24 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
Q2QMX9 2.83e-10 68 27 4 179 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q2QMX9 0.000145 49 26 6 222 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q64542 2.85e-10 68 29 4 193 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
O81108 3e-10 68 29 5 179 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O81108 8.12e-08 60 24 23 577 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
P54678 3.65e-10 67 30 2 150 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P54678 7.46e-06 53 23 6 268 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
Q2QY12 3.91e-10 67 25 11 327 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 8.34e-10 66 29 5 185 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
O64806 4.64e-10 67 29 5 182 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O64806 7.52e-08 60 24 23 568 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
Q7X8B5 5.78e-10 67 29 5 188 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q2RAS0 6.81e-10 67 27 7 236 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2RAS0 8.86e-10 66 29 5 185 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
G5E829 9.8e-10 66 28 5 202 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
P11505 1.1e-09 66 28 5 202 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
A0A143ZZK9 1.53e-09 65 26 7 223 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
Q64568 2.07e-09 65 28 5 205 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
P50997 2.3e-09 65 27 4 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P50997 6.14e-08 60 24 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P20020 2.31e-09 65 27 5 205 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
P20020 0.000643 47 24 17 395 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
Q16720 2.39e-09 65 28 5 205 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
P23220 2.39e-09 65 27 5 205 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
P23220 0.000643 47 24 17 395 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
P11506 3.43e-09 64 27 5 205 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
Q98SH2 3.49e-09 64 27 4 205 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
Q9R0K7 3.7e-09 64 27 5 205 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q9R0K7 1.23e-06 56 24 5 276 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q01814 3.87e-09 64 27 5 205 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
G5EFR6 5.87e-09 63 31 5 165 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
Q13733 1.09e-08 63 31 4 132 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 4.21e-07 57 25 6 238 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
P35317 2.61e-08 61 34 2 108 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P35317 0.000135 49 23 4 236 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P58165 4.88e-08 60 28 6 205 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
Q00804 1.05e-07 60 27 5 202 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
P9WPS4 7.86e-07 57 28 3 194 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS4 0.000788 47 27 6 206 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q21286 8.28e-07 57 25 13 302 2 catp-5 Cation-transporting ATPase catp-5 Caenorhabditis elegans
P9WPS5 9.64e-07 57 28 3 194 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS5 0.000755 47 27 6 206 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5XF90 2.93e-06 55 30 8 229 1 Atp13a4 Probable cation-transporting ATPase 13A4 Mus musculus
Q4VNC1 3.14e-06 55 31 9 227 1 ATP13A4 Probable cation-transporting ATPase 13A4 Homo sapiens
O14022 3.93e-06 54 23 4 212 3 cta5 Cation-transporting ATPase 5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12697 7.12e-06 53 22 10 283 1 YPK9 Vacuolar cation-transporting ATPase YPK9 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9NQ11 2.2e-05 52 26 13 290 1 ATP13A2 Polyamine-transporting ATPase 13A2 Homo sapiens
Q95JN5 7.46e-05 50 24 8 221 2 ATP13A3 Polyamine-transporting ATPase 13A3 Macaca fascicularis
Q9H7F0 7.46e-05 50 24 8 221 1 ATP13A3 Polyamine-transporting ATPase 13A3 Homo sapiens
Q94BT9 0.000107 44 39 0 51 1 ATX1 Copper transport protein ATX1 Arabidopsis thaliana
P04129 0.00011 45 38 1 70 1 merP Mercuric transport protein periplasmic component Shigella flexneri
Q58378 0.000132 48 24 2 135 1 patS Soluble P-type ATPase-like phosphatase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O82089 0.000133 45 36 0 52 1 CCH Copper transport protein CCH Arabidopsis thaliana
Q5XF89 0.000217 48 23 11 284 1 Atp13a3 Polyamine-transporting ATPase 13A3 Mus musculus
Q27533 0.000468 48 44 0 52 3 W08D2.5 Probable cation-transporting ATPase W08D2.5 Caenorhabditis elegans
Q52107 0.000839 42 36 1 68 3 merP Mercuric transport protein periplasmic component Acinetobacter calcoaceticus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16200
Feature type CDS
Gene copA
Product copper-exporting P-type ATPase CopA
Location 47787 - 50531 (strand: 1)
Length 2745 (nucleotides) / 914 (amino acids)

Contig

Accession term accessions NZ_VXKB01000006 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_363
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00403 Heavy-metal-associated domain
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2217 Inorganic ion transport and metabolism (P) P Cation-transporting P-type ATPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K17686 P-type Cu+ transporter [EC:7.2.2.8] Platinum drug resistance
MAPK signaling pathway - plant
Mineral absorption		 -

Protein Sequence

MANTTILALQGLTCMHCVGSVKKVLDARPDVESAVVTLEFAKVTGDADPQSLISAIEDAGYEAQVAEHPGTILQLSGLNCMKCAAKTQSALEAVDGVAAAVVDTKEAKVYGSADAQILISAVEAAGFQAAVAGENQHPKTEPLTPVTSSDETVSAAHCDIPATPDNTPVMADIADDDESLSFLLDGMTCASCVSKVNKALLSVDGVENVRVNLAERSALVTGHASPDALVAAVEKAGYGAELIQDDIKRRERQQEVATANMKRFRWQAVVALAVGVPVMIWGMIGDNMMLTPANNGIWLTIGVLTLAVMVTAGGHFYRSAWQSLKNRSATMDTLVALGTGAAWLYSITVNLWPDVFPPQARHLYYEASAMIVGLINLGHMLEQRARQRSSKALERLLDLTPPTARVVTPEGEKDLPLAEIQPGMILRLTTGDRVPVDGEITQGEVWMDEAMLTGEPIPQQKTIGDSVSAGTTVQDGTVLFRAAAVGSKTTLARIIKLVRQAQSSKPEIGQLADKISAVFVPVVVVIALIAGAIWYVFGPAPQITYALVIITTVLIIACPCALGLATPMSIISGVGRAAEFGVLVRDADALQQASNLDTIVFDKTGTLTEGMPQVTDIHIFNGYSEEDVLRWAAALESGSNHPLARAITARAKDLSVPSVTQFRTLAGMGISGESEGRTLLLGNHALMNAQNIATTAQADALVQSQAGKGVTPVMLAADGKIAAVLSIRDPLREDSISALARLRKQGYRLVMLTGDNEITARAIAKEAGIDDVIAGVLPDGKSAAIEKLQQAGQRVAMVGDGINDAPALARADVGIAMGGGSDIAIETAAITLMRHSLHGVADAVAISKGTLRNMKQNLLGAFVYNSLGIPIAAGILFPFTGTLLNPVVAGAAMALSSITVVSNANRLLRFKPKD

Flanking regions ( +/- flanking 50bp)

CCCCCGGGTTTACTGCGGGGTGATGATGCGAAACAGTTAAGGAAAAAAAGATGGCTAATACGACTATTCTTGCATTACAGGGACTCACCTGTATGCATTGCGTCGGCAGTGTAAAAAAAGTGCTGGACGCCCGTCCGGATGTTGAATCCGCCGTTGTCACCCTTGAATTTGCAAAAGTCACCGGTGATGCCGATCCGCAATCGCTTATCAGCGCAATCGAAGATGCCGGCTATGAAGCACAGGTGGCAGAGCATCCCGGTACAATTTTGCAGCTTTCAGGGCTCAATTGTATGAAATGTGCTGCGAAAACGCAAAGTGCATTAGAAGCCGTTGACGGTGTCGCCGCCGCTGTTGTGGATACCAAAGAAGCCAAAGTGTATGGCAGCGCAGATGCGCAGATTCTGATAAGTGCGGTGGAAGCCGCCGGTTTTCAGGCAGCGGTGGCAGGAGAAAACCAGCACCCAAAAACTGAACCGCTGACACCGGTCACATCTTCGGATGAGACGGTATCAGCGGCACATTGCGACATTCCTGCCACCCCGGACAACACCCCGGTAATGGCGGATATTGCAGATGACGATGAAAGCCTGTCGTTTCTGCTCGACGGCATGACCTGTGCCAGTTGTGTCAGTAAAGTGAATAAAGCCCTGCTCAGTGTGGACGGCGTGGAAAACGTCCGCGTTAATCTGGCAGAGCGCAGCGCGCTGGTCACCGGACACGCTTCACCTGATGCGCTTGTCGCGGCAGTGGAGAAAGCCGGTTACGGCGCAGAGCTGATTCAGGATGATATAAAGCGCCGTGAGCGTCAGCAGGAAGTGGCGACAGCAAACATGAAACGCTTCCGCTGGCAGGCCGTTGTCGCACTGGCAGTGGGTGTTCCGGTGATGATCTGGGGCATGATCGGCGACAACATGATGCTGACGCCCGCCAACAACGGGATCTGGCTCACCATCGGTGTGCTGACCCTGGCGGTGATGGTCACCGCAGGCGGGCATTTCTACCGCAGCGCATGGCAATCACTGAAAAACCGCAGTGCGACGATGGATACCTTAGTCGCGCTCGGCACCGGTGCCGCGTGGCTTTACTCTATTACTGTCAATCTGTGGCCGGATGTCTTTCCGCCACAGGCGCGTCATCTTTATTACGAAGCCAGTGCCATGATAGTCGGTCTGATAAACCTGGGTCACATGCTGGAACAGCGCGCCCGCCAGCGCTCATCAAAAGCACTGGAGCGGCTTTTGGATCTGACTCCGCCGACCGCACGGGTTGTAACGCCTGAAGGTGAGAAAGATCTGCCGCTGGCAGAGATTCAGCCGGGTATGATCCTGCGTCTGACCACCGGTGACCGGGTGCCGGTCGATGGTGAGATAACACAGGGCGAAGTGTGGATGGATGAAGCCATGCTGACCGGGGAGCCCATCCCGCAGCAAAAAACCATTGGTGATTCGGTTTCAGCCGGAACAACCGTGCAGGATGGTACCGTACTGTTCCGTGCTGCGGCTGTCGGCAGCAAAACCACACTGGCGCGCATCATAAAACTGGTGCGTCAGGCACAGAGCAGTAAACCGGAGATTGGTCAGTTAGCCGATAAAATCTCAGCGGTGTTTGTGCCGGTTGTGGTGGTGATCGCCCTGATCGCCGGTGCCATCTGGTATGTCTTTGGTCCTGCGCCGCAAATAACCTATGCACTGGTCATTATTACCACGGTGCTGATTATCGCCTGTCCGTGTGCGCTGGGTCTGGCAACACCGATGTCGATAATCTCCGGTGTCGGACGTGCGGCTGAGTTTGGTGTACTGGTACGGGATGCGGATGCACTGCAACAGGCCAGTAACCTGGATACTATCGTTTTCGATAAAACCGGGACTCTGACCGAGGGAATGCCGCAGGTTACTGATATTCATATTTTTAATGGTTACAGTGAAGAGGATGTACTGCGCTGGGCGGCAGCTCTGGAAAGCGGTTCTAATCACCCGCTGGCGCGCGCTATTACCGCACGGGCAAAAGATCTCTCAGTGCCGTCTGTCACACAGTTCCGTACGCTCGCCGGAATGGGGATCAGCGGGGAGTCAGAAGGCCGGACACTCCTGCTTGGTAACCATGCCCTGATGAATGCGCAGAATATCGCGACCACCGCACAAGCCGATGCCTTGGTTCAGTCACAGGCCGGTAAAGGCGTGACGCCGGTGATGCTGGCGGCAGACGGCAAAATTGCCGCTGTTCTGTCCATCCGTGATCCGCTGCGGGAAGACAGCATCAGCGCTCTCGCGCGGCTCCGTAAGCAGGGATATCGCCTGGTCATGCTGACCGGGGATAATGAAATCACCGCCCGGGCTATCGCAAAAGAAGCAGGTATTGATGATGTAATCGCCGGTGTGCTGCCGGACGGCAAATCAGCCGCAATTGAAAAATTGCAGCAAGCCGGGCAGAGAGTGGCAATGGTCGGGGATGGCATTAATGATGCACCCGCGCTGGCGCGTGCGGATGTGGGGATCGCCATGGGCGGCGGCAGTGATATCGCCATCGAAACTGCCGCAATAACCCTGATGCGCCACAGCTTGCATGGTGTGGCAGATGCCGTGGCTATCTCAAAAGGGACACTGCGCAATATGAAGCAGAACCTGCTGGGTGCTTTTGTGTATAACTCGCTGGGGATACCGATCGCGGCAGGAATACTCTTTCCGTTCACCGGCACACTGCTCAACCCGGTGGTTGCAGGTGCGGCAATGGCACTCTCTTCGATTACCGTGGTCAGTAATGCTAACCGGCTGCTGAGGTTTAAACCTAAAGATTAATAACGATACCCTTATTCATTCAAACCGCAGGTTCGTTGGCTGCACTCAGC