Homologs in group_331

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13015 FBDBKF_13015 78.4 Morganella morganii S1 copA copper-exporting P-type ATPase CopA
EHELCC_06330 EHELCC_06330 78.4 Morganella morganii S2 copA copper-exporting P-type ATPase CopA
NLDBIP_06650 NLDBIP_06650 78.4 Morganella morganii S4 copA copper-exporting P-type ATPase CopA
LHKJJB_03530 LHKJJB_03530 78.4 Morganella morganii S3 copA copper-exporting P-type ATPase CopA
HKOGLL_07005 HKOGLL_07005 78.4 Morganella morganii S5 copA copper-exporting P-type ATPase CopA
F4V73_RS04945 F4V73_RS04945 43.8 Morganella psychrotolerans - heavy metal translocating P-type ATPase
F4V73_RS16200 F4V73_RS16200 76.6 Morganella psychrotolerans copA copper-exporting P-type ATPase CopA

Distribution of the homologs in the orthogroup group_331

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_331

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZCA7 0.0 1264 66 4 960 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q8ZR95 0.0 1243 72 2 844 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR95 5.01e-17 90 34 2 160 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z8S4 0.0 1239 72 2 844 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8Z8S4 4.92e-17 90 34 2 160 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8XD24 0.0 1230 72 4 845 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q8XD24 1.98e-18 94 35 4 172 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q59385 0.0 1225 72 4 845 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q59385 1.95e-18 94 35 4 172 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q9KPZ7 0.0 816 49 8 912 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KPZ7 3.09e-18 94 29 4 227 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9X5X3 0.0 623 41 10 867 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q9X5X3 5.59e-09 63 26 3 164 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q9X5X3 8.82e-07 57 26 4 128 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
P58342 0.0 605 41 10 867 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58342 1.89e-09 65 32 5 137 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58342 2.42e-09 65 28 4 149 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58341 0.0 592 40 13 870 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
P58341 2.01e-10 68 30 5 163 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
P58341 1.3e-05 53 27 2 103 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
Q4L970 0.0 569 40 12 850 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
Q4L970 1.58e-06 55 28 5 146 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
Q4L970 0.000132 49 22 4 141 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
P37279 0.0 562 42 15 754 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZHC7 0.0 562 44 7 661 1 silP Silver exporting P-type ATPase Salmonella typhimurium
Q5ZWR1 0.0 556 45 7 659 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P73241 0.0 554 41 10 746 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O32220 0.0 548 39 15 856 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
O32220 0.000122 49 27 5 148 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
Q8CN02 0.0 547 39 13 853 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CN02 1.78e-06 55 28 4 138 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CN02 2.79e-06 55 28 5 139 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 0.0 547 39 13 853 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HL56 1.78e-06 55 28 4 138 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HL56 2.79e-06 55 28 5 139 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GDP1 1.65e-180 547 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q6GDP1 7.87e-07 57 25 4 145 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q6GDP1 1.27e-06 56 27 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
A8Z3F8 7.38e-180 545 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
A8Z3F8 4.26e-07 57 27 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
A8Z3F8 1.35e-06 56 27 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 7.38e-180 545 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q2FDV0 4.26e-07 57 27 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q2FDV0 1.35e-06 56 27 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q2YWA3 1.08e-179 545 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YWA3 4.19e-07 57 27 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YWA3 1.41e-06 56 27 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A6QK47 1.6e-179 544 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
A6QK47 4.19e-07 57 27 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
A6QK47 1.36e-06 56 27 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 1.6e-179 544 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q5HCZ3 4.19e-07 57 27 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q5HCZ3 1.36e-06 56 27 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 1.6e-179 544 39 16 861 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FV64 4.19e-07 57 27 5 148 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FV64 1.36e-06 56 27 5 155 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A3E6 1.83e-179 544 39 16 861 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q7A3E6 1.58e-06 55 26 5 148 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q7A3E6 4.75e-06 54 26 5 155 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 1.83e-179 544 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99R80 1.58e-06 55 26 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99R80 4.75e-06 54 26 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 1.83e-179 544 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A5IVY3 1.58e-06 55 26 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A5IVY3 4.75e-06 54 26 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 1.83e-179 544 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A6U4T8 1.58e-06 55 26 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A6U4T8 4.75e-06 54 26 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 1.83e-179 544 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X6S1 1.58e-06 55 26 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X6S1 4.75e-06 54 26 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NUQ9 2.13e-179 544 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q8NUQ9 4.3e-07 57 27 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q8NUQ9 1.38e-06 56 27 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 2.13e-179 544 39 16 861 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q6G6B7 4.3e-07 57 27 5 148 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q6G6B7 1.38e-06 56 27 5 155 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q4A0G1 3.54e-178 540 38 17 856 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A0G1 1.73e-07 59 31 6 156 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A0G1 3.23e-06 55 29 5 153 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9X5V3 1.05e-165 509 45 4 603 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
O29777 7.98e-160 493 37 14 739 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O29777 1.54e-05 52 45 2 64 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P32113 2.92e-158 486 38 12 735 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q9S7J8 6.64e-152 478 32 18 1021 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
Q9S7J8 0.000318 48 33 3 112 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
Q9S7J8 0.000344 48 27 7 159 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
Q6H7M3 9.46e-151 475 33 19 951 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
P9WPS3 1.74e-150 468 42 8 615 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 1.74e-150 468 42 8 615 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9SH30 8.81e-148 468 33 24 969 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
Q9SH30 3.87e-08 61 27 7 207 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
A3AWA4 9.36e-147 465 32 21 968 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
P77868 1.38e-141 443 37 17 756 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P35670 6.17e-141 460 30 26 1046 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P35670 9.11e-13 76 21 11 394 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P35670 4.03e-08 61 22 7 269 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P35670 4.91e-07 57 22 13 322 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
A0A0P0X004 1.22e-140 449 33 22 987 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
A0A0P0X004 2.45e-08 62 27 5 181 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
A0A0P0X004 1.41e-05 53 25 8 209 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q64446 3.36e-138 453 30 31 1051 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64446 3.56e-10 68 22 12 382 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64446 5.07e-07 57 21 4 196 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64446 7.3e-07 57 22 9 267 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64446 4.99e-06 54 21 11 309 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q9XT50 7.32e-136 447 30 27 1049 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 3.93e-11 71 20 10 383 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 2.28e-08 62 24 9 265 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 6.8e-08 60 21 7 289 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 8.2e-06 53 23 4 153 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 9.63e-06 53 21 5 232 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q59467 1.43e-134 425 33 14 756 3 copA Copper-transporting ATPase Helicobacter pylori
O08462 6.15e-133 421 33 15 759 3 copA Copper-transporting ATPase Helicobacter pylori
Q64535 1.07e-132 437 32 24 898 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64535 2.49e-07 58 22 9 266 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64535 5.02e-07 57 20 5 240 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64535 1.63e-06 56 24 5 154 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64535 1.7e-06 56 22 4 178 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64535 1.59e-05 52 25 3 147 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q9ZM69 5.33e-131 416 33 15 759 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
P77871 5.41e-130 413 33 16 759 3 copA Copper-transporting ATPase Helicobacter pylori
P37385 5.88e-130 414 35 14 796 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P07893 2.24e-128 410 35 15 796 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P55989 1.65e-127 407 33 15 759 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q64430 4.36e-127 423 27 30 1153 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 1.05e-06 57 22 10 321 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q04656 1.53e-126 422 29 34 1133 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 1.3e-09 66 21 15 395 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 0.000409 48 20 11 341 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
O30085 3.26e-124 396 36 11 655 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P70705 3.96e-124 415 27 30 1151 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 4.67e-09 64 20 13 390 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 1.31e-06 56 21 11 324 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
O32619 1.2e-123 396 33 11 734 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
P9WPU1 7.87e-123 395 35 13 743 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 7.87e-123 395 35 13 743 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P38995 2.71e-120 395 30 29 977 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P49015 1.57e-119 402 27 31 1147 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P49015 4.16e-10 67 23 14 342 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P49015 1.71e-05 52 23 14 339 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P46840 1.83e-117 380 34 13 758 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
Q9SZC9 1.92e-113 375 34 16 785 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
P9WPT8 8.17e-111 363 34 13 749 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 8.17e-111 363 34 13 749 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPT9 3.93e-110 361 34 13 749 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P05425 1.34e-106 351 33 12 652 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
B9DFX7 1.78e-105 352 31 21 806 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
P20021 3.75e-104 344 31 17 746 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
O59666 1.93e-103 347 34 13 647 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P30336 2.55e-100 334 32 16 693 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
B2HEM2 3.75e-100 333 35 9 614 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q6GIX1 4.89e-100 333 30 19 768 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
P9WPT5 1.04e-99 332 35 11 617 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 1.04e-99 332 35 11 617 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 1.04e-99 332 35 11 617 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4LAB1 1.49e-99 330 31 10 652 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
Q9CCL1 2.43e-99 331 34 10 614 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
A8YZ02 1.02e-98 328 31 11 658 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 1.02e-98 328 31 11 658 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
Q8CQF7 2.37e-98 327 31 11 657 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P37386 6.11e-98 330 29 25 870 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
P58414 8.81e-98 327 30 13 698 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q69HU0 1.06e-97 325 31 14 657 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
Q5HKB0 1.58e-97 325 31 10 651 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GIX4 1.63e-97 325 31 14 657 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
P46839 9.82e-95 320 33 11 743 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
Q60048 4.3e-91 308 30 16 707 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
Q3YW59 1.56e-86 296 31 20 746 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
P37617 6.84e-86 295 31 19 744 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
O33533 2.98e-83 288 27 15 744 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
Q59998 4.51e-80 278 30 24 754 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O32219 2.84e-79 276 29 21 755 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
P18398 8.58e-78 273 29 20 747 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
O31688 8.84e-78 270 32 5 502 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
Q59207 3.67e-76 268 29 16 736 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9SZW4 4.77e-71 258 27 21 741 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
P38360 2.41e-70 258 28 15 681 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0R3A7 9.08e-70 248 32 8 542 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A3BF39 5.6e-68 250 29 10 558 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
O64474 4.75e-66 245 29 16 561 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
P9WPT7 7.83e-66 237 32 11 551 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 7.83e-66 237 32 11 551 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0CW78 2.58e-61 226 29 13 554 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
Q59465 2.77e-59 219 29 7 505 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZL53 4.48e-58 216 25 13 687 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
Q9RQB4 2.77e-55 207 25 15 694 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
P9WPS7 3.42e-55 209 32 13 631 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 3.42e-55 209 32 13 631 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 3.42e-55 209 32 13 631 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPT3 1.41e-51 196 31 10 546 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 1.41e-51 196 31 10 546 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 1.41e-51 196 31 10 546 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9M3H5 4.88e-47 185 28 13 571 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
Q8H384 1.87e-46 184 31 13 541 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
Q5HK64 2.83e-46 181 29 13 506 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 2.83e-46 181 29 13 506 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 2.83e-46 181 29 13 506 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 2.83e-46 181 29 13 506 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9RZP0 4.27e-46 180 31 11 447 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8R8I6 7.14e-46 179 29 13 547 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P57700 1.51e-45 178 25 11 552 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
O32328 2.47e-45 178 27 13 557 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8YPE9 3.77e-45 177 30 9 468 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q97BF6 1.61e-44 175 27 10 532 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q4LAI2 4.39e-44 174 29 13 506 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
Q9R6X1 2.98e-43 172 29 8 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
Q926K7 5.34e-43 171 30 9 467 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8NVI2 6.94e-42 167 30 12 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 6.94e-42 167 30 12 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
Q2YUH7 3.2e-41 165 29 12 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
P63684 3.87e-41 165 29 12 467 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 3.87e-41 165 29 12 467 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A8Z4X9 4.24e-41 165 29 12 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 4.24e-41 165 29 12 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 4.24e-41 165 29 12 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
B4U8E4 7.22e-41 164 28 7 486 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
Q6GEZ7 7.78e-41 164 29 12 467 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
Q8YSD5 1.44e-40 164 28 6 474 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8U9D9 1.52e-40 163 30 15 514 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8PCM1 2.36e-40 163 32 12 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B2TMJ2 3.31e-40 162 30 11 454 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
B7HWG1 4.96e-40 162 28 10 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
Q81HQ0 5.01e-40 162 28 13 479 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q57RN0 8.93e-40 161 28 12 464 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
B7JRB8 1.19e-39 160 29 11 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
Q63FR0 1.22e-39 160 28 10 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
B2V2P3 2.69e-39 159 30 11 454 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
Q8KU73 3.11e-39 159 28 12 502 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
A9VFM1 3.21e-39 159 28 12 476 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
C1EYK0 4.29e-39 159 28 13 479 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
B7HDF9 4.64e-39 159 28 15 488 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
P0CW77 6.22e-39 156 27 7 382 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
B7II09 6.9e-39 158 28 15 488 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
Q8PPC9 8.62e-39 158 31 10 464 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
Q6HN78 9.12e-39 158 28 13 479 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
A0RA13 1.24e-38 157 28 10 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
Q9X8Z9 2.01e-38 157 29 10 442 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9A7X7 2.83e-38 156 30 12 461 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
C3LF99 2.88e-38 156 28 10 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
P59219 6.32e-38 155 30 12 481 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q98GX6 7.95e-38 155 30 11 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A4W860 1.02e-37 155 28 12 459 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
P73867 1.38e-37 154 29 9 464 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8XU11 4.5e-37 153 28 14 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B5BCA4 5.51e-37 152 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 5.51e-37 152 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q93MV5 6.8e-37 152 28 9 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
Q72TM6 9.42e-37 152 30 12 481 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A7GLG4 9.42e-37 152 28 12 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B4SZB1 1.16e-36 151 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
Q0TRT3 1.28e-36 151 29 14 455 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B5EZE3 1.5e-36 151 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
B5R670 1.6e-36 151 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MUE0 1.95e-36 150 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TBA6 2.01e-36 150 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 2.01e-36 150 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
B5FNE0 2.01e-36 150 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
Q8FJV4 2.02e-36 150 28 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 2.02e-36 150 28 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UKX6 2.02e-36 150 28 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P57698 2.06e-36 150 29 11 461 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B4TQ22 2.12e-36 150 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
B5YQN9 2.21e-36 150 27 15 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 2.21e-36 150 27 15 496 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
B7MPK0 2.53e-36 150 28 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
Q927G0 2.56e-36 150 29 12 460 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P9WPU3 2.83e-36 150 29 16 502 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 2.83e-36 150 29 16 502 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 2.83e-36 150 29 16 502 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B8DAW1 4.38e-36 149 29 13 461 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
Q8ZQW2 4.78e-36 149 28 12 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q71W90 4.79e-36 149 29 12 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 4.79e-36 149 29 12 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
B7LKR7 5.23e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7M5L3 5.77e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 5.77e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
B1IY32 6.2e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P03960 6.43e-36 149 27 12 463 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 6.43e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 6.43e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
B7N9U0 7.35e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B6HYQ5 7.49e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 7.49e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NMQ0 8.72e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3Z4A6 8.88e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
B1LLE1 8.96e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
A7ZXV8 9.28e-36 149 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
Q324L0 1.26e-35 148 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
Q1REM0 1.27e-35 148 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 1.27e-35 148 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 1.27e-35 148 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
B5XZE9 1.45e-35 148 28 11 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
Q7N6W6 1.5e-35 148 28 15 498 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q92XJ0 1.61e-35 148 27 8 456 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
Q8Y3Z7 2.25e-35 147 29 12 471 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0AM16 3.89e-35 147 28 13 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A6T6D8 3.92e-35 147 28 11 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2TTJ7 2.18e-34 144 27 12 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P78036 1.65e-33 143 25 19 604 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P57699 2e-33 142 24 16 581 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 2e-33 142 24 16 581 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q58623 2.65e-33 142 27 18 574 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B2VJK3 3.88e-33 140 28 13 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q667S4 4.4e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
B1JR96 4.44e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 4.44e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TL06 5.36e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 5.36e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 5.36e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 5.36e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 5.36e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 5.36e-33 140 28 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
A8GB61 9.6e-33 139 27 13 534 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
A1JQS2 1.31e-32 139 28 10 455 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q47H39 1.18e-31 136 27 11 461 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
P19657 1.62e-31 137 25 9 513 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A4SZG8 1.91e-31 135 27 10 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
P05030 2.89e-31 135 25 9 513 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C4LDL7 5.39e-31 134 26 8 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P35597 7.62e-31 134 26 13 501 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P28877 8.82e-31 134 25 10 514 1 PMA1 Plasma membrane ATPase 1 Candida albicans
Q9LY32 2.23e-30 133 28 17 524 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
P12522 1.31e-28 127 25 10 512 2 H1B Probable proton ATPase 1B Leishmania donovani
P11718 2.43e-28 126 25 10 512 2 H1A Probable proton ATPase 1A Leishmania donovani
P36640 7.63e-28 125 24 18 630 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 7.63e-28 125 24 18 630 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
P0ABB8 1.03e-27 124 25 22 629 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 1.03e-27 124 25 22 629 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
P49380 1.58e-27 124 25 10 516 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P24545 4.36e-27 122 25 9 513 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
Q08436 4.43e-27 122 26 16 529 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
P07038 1.42e-26 120 25 12 508 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q08435 3.29e-26 119 26 15 527 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
P47317 7.3e-26 118 23 16 566 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9SU58 1.21e-25 118 26 15 526 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
P22180 2.05e-25 117 26 16 528 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
Q03194 2.22e-25 117 24 14 546 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
Q7XPY2 4.3e-25 116 24 14 545 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
A0R3Y2 1.1e-24 114 24 13 567 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P54679 1.14e-24 115 24 15 520 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
Q07421 1.2e-24 114 25 14 547 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
Q43128 1.57e-24 114 24 14 545 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
P19456 2.16e-24 114 24 15 548 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
P09627 7.89e-24 112 25 15 577 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LV11 8.88e-24 112 26 14 526 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9M2A0 1.11e-23 111 24 12 523 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
Q9SH76 1.5e-23 111 24 13 525 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
P83970 2.35e-23 110 24 16 527 2 ha1 Plasma membrane ATPase Triticum aestivum
P20649 4.5e-23 109 25 16 547 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
Q8Z8E5 1.65e-22 106 31 6 283 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
P22036 3.84e-22 106 23 17 606 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9LIK7 2.57e-21 104 23 17 617 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
P28876 5.61e-21 103 25 15 549 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q42556 6.92e-21 102 23 12 522 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
P20431 1.31e-20 101 23 14 547 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
Q8Y8Q5 4.62e-20 100 33 4 200 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8Q5 1.77e-09 65 23 6 255 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P54211 5.63e-20 100 23 12 526 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
P9WPT0 1.28e-19 98 25 11 459 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPT1 1.39e-19 98 25 11 459 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 1.39e-19 98 25 11 459 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O53114 2.48e-19 98 24 12 523 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
P54210 8.28e-19 96 24 12 567 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
O43108 3.68e-18 94 34 4 183 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O43108 8.78e-10 66 23 5 276 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q4WHC8 4.98e-18 93 34 3 185 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6ATV4 8.61e-18 92 23 22 692 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q73E41 1.15e-17 92 34 2 173 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73E41 2.88e-06 55 25 8 290 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
O13397 1.2e-17 92 33 4 198 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
P35316 1.21e-17 92 29 2 198 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P35316 0.00014 49 21 9 323 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
O13398 1.69e-17 92 34 3 171 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O13398 3.31e-06 55 24 9 287 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
P37278 4.24e-17 90 34 3 172 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37278 2.03e-14 81 27 8 318 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P22189 1.91e-16 88 31 3 183 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59868 2.74e-16 87 34 4 185 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59868 2.89e-11 71 24 5 269 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9CFU9 2.82e-16 87 32 4 188 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q9CFU9 4.47e-08 61 21 6 255 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q2QMX9 4.87e-16 87 22 15 574 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q292Q0 5.3e-16 87 28 2 197 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q292Q0 0.000377 48 22 9 310 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
P37367 5.55e-16 86 35 2 157 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37367 3.88e-08 61 25 3 228 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O77696 5.61e-16 87 33 1 159 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
O77696 1.93e-05 52 24 11 348 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
Q93084 7.9e-16 86 33 1 159 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q93084 9.94e-05 50 24 8 269 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q9LY77 9.87e-16 86 23 19 577 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
Q9YGL9 9.94e-16 85 32 1 159 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 4.22e-07 58 23 10 346 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
P22700 1.28e-15 85 27 2 197 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
P22700 9.66e-05 50 22 8 292 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
Q7XB51 1.87e-15 85 33 2 175 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q7XB51 3.96e-11 71 26 6 270 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q4WND5 1.9e-15 85 26 5 242 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WND5 0.000452 48 24 8 263 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q64518 2.29e-15 84 33 1 159 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64518 1.24e-05 53 25 8 269 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
P18596 2.58e-15 84 33 1 159 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P18596 1.16e-05 53 23 11 364 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P23980 3.03e-15 84 27 11 381 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
P54209 5.87e-15 83 33 2 172 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
P04191 8.04e-15 83 32 2 159 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P04191 2.98e-05 52 22 10 346 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
Q8R429 8.72e-15 83 32 2 159 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q8R429 0.000323 48 21 10 346 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q64578 8.95e-15 82 32 2 159 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q64578 0.000435 48 21 10 346 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q92105 9.1e-15 82 33 2 159 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
O14983 9.37e-15 82 30 3 186 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O14983 0.000332 48 21 10 346 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
Q0VCY0 1.27e-14 82 32 2 159 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q0VCY0 9.76e-05 50 22 10 346 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
P70083 1.38e-14 82 32 2 159 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
C1L360 1.64e-14 82 31 2 196 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
C1L360 1.42e-12 75 30 7 247 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
O34431 1.97e-14 81 23 19 634 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
Q7PPA5 2e-14 82 27 2 197 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
O22218 2.1e-14 81 30 3 184 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O22218 1.01e-07 60 22 24 616 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
P13586 2.31e-14 81 31 3 174 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13586 2.5e-07 58 22 7 267 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9T0E0 2.32e-14 81 22 12 490 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
Q03669 2.4e-14 81 32 1 159 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q03669 5.14e-05 51 23 15 361 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
P13585 2.4e-14 81 30 3 186 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P13585 0.000611 47 22 10 346 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P20647 2.68e-14 81 30 1 170 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P20647 0.000142 49 23 11 281 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P16615 2.68e-14 81 30 1 170 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P16615 0.000116 50 23 11 281 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
Q12691 3.14e-14 81 32 2 171 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 3.19e-14 81 32 2 171 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P11607 4.87e-14 80 30 1 170 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11607 0.000111 50 23 11 281 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
O55143 4.96e-14 80 30 1 170 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
O55143 0.000131 49 23 11 281 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
P11507 5.26e-14 80 30 1 170 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P11507 0.000135 49 23 11 281 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
Q9M2L4 5.35e-14 80 30 3 184 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9M2L4 1.73e-09 65 23 25 609 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q00779 5.79e-14 80 31 1 159 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q00779 0.000114 50 23 11 281 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q08853 6.03e-14 80 32 3 177 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
P17326 6.69e-14 80 27 3 193 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 2.92e-09 65 23 3 234 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
O46674 6.7e-14 80 31 1 159 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
O46674 9.45e-05 50 23 12 299 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
P13587 1.11e-13 79 31 2 171 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7XEK4 1.22e-13 79 31 4 183 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q7XEK4 6.57e-06 53 23 5 216 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
P54707 2.1e-13 78 28 5 239 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 8.15e-07 57 23 5 252 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
Q64392 2.47e-13 78 27 6 279 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 5.44e-05 51 25 7 260 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q9XES1 3.01e-13 78 29 3 167 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
Q9XES1 0.000129 50 23 6 263 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
P13607 3.66e-13 77 27 4 221 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 2.02e-08 62 23 6 279 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P92939 4.34e-13 77 29 3 167 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P92939 0.000162 49 23 6 263 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
Q13733 4.58e-13 77 26 9 342 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 2.76e-08 62 25 8 240 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q65X71 4.81e-13 77 30 4 185 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q65X71 3.55e-09 64 25 7 311 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
P35315 4.91e-13 77 32 2 159 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P35315 7.75e-08 60 23 6 262 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P38929 5.01e-13 77 31 4 195 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38929 0.000118 50 23 7 263 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B9QMJ0 5.95e-13 77 31 5 198 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
O23087 6.97e-13 77 28 3 195 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O23087 8.62e-09 63 23 9 338 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O75185 9.72e-13 76 34 4 178 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
O75185 5.05e-10 67 25 6 247 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
Q92126 1.32e-12 75 28 2 192 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 4.29e-05 51 24 6 250 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
P09626 1.44e-12 75 27 3 221 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 3.5e-06 55 23 5 249 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P50996 1.47e-12 75 27 3 221 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 1.79e-06 55 24 11 300 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
Q9SY55 1.53e-12 75 30 2 164 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
P9WPS9 1.53e-12 75 31 7 245 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS9 1.04e-06 56 26 5 266 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 1.53e-12 75 31 7 245 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS8 1.04e-06 56 26 5 266 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 1.53e-12 75 31 7 245 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63688 1.04e-06 56 26 5 266 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P20648 1.57e-12 75 27 3 221 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 2.27e-06 55 23 5 249 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P19156 1.59e-12 75 27 3 221 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 2.5e-06 55 23 5 249 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
Q64436 1.59e-12 75 27 3 221 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 3.17e-06 55 23 5 249 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
P27112 1.68e-12 75 27 3 221 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 1.16e-05 53 23 5 249 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
Q5R5K5 1.71e-12 75 33 5 190 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q5R5K5 1.71e-08 62 25 7 252 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
P98194 1.73e-12 75 33 5 190 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P98194 1.64e-08 62 25 7 252 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
Q64566 1.89e-12 75 33 5 190 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q64566 3.83e-08 61 25 7 252 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
P57709 1.96e-12 75 33 5 190 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P57709 2.18e-08 62 24 10 319 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
Q42883 2.31e-12 75 28 2 169 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q42883 5.81e-07 57 23 6 325 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
P58312 2.37e-12 75 28 7 235 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 3.38e-10 68 23 5 252 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
Q9SJB3 2.59e-12 75 30 4 192 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
Q9SJB3 1.23e-08 62 24 5 212 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
Q6RWA9 2.72e-12 74 27 4 227 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q6RWA9 5.03e-08 60 24 5 253 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q92123 2.88e-12 74 28 3 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92123 1.4e-05 53 21 4 251 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q80XR2 2.93e-12 74 33 5 190 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q80XR2 2.68e-08 62 25 7 251 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
P06687 3.12e-12 74 28 3 192 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 4.61e-09 64 24 6 257 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 3.12e-12 74 28 3 192 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 4.61e-09 64 24 6 257 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
P13637 3.12e-12 74 28 3 192 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 4.34e-09 64 24 6 257 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
Q8R4C1 4.17e-12 74 25 5 248 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q8R4C1 2.25e-11 72 33 4 178 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
P30714 4.33e-12 74 28 3 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 3.47e-08 61 23 5 255 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P24798 4.38e-12 74 28 3 192 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 2.61e-09 65 25 7 257 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
Q8RUN1 6.29e-12 73 27 9 274 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q8RUN1 1.97e-07 58 22 11 372 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
A7L9Z8 6.78e-12 73 33 3 178 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
A7L9Z8 1.42e-11 72 25 5 248 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
Q9HDW7 1.16e-11 72 34 3 149 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HDW7 0.001 47 23 6 245 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P54708 1.28e-11 72 27 5 242 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 3.19e-05 52 22 6 271 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
Q9Z1W8 1.35e-11 72 27 5 239 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9Z1W8 0.000507 47 22 6 271 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
J9VQQ3 1.48e-11 72 31 2 170 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q9TV52 4.23e-11 71 27 5 239 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 1.65e-07 59 22 4 251 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9LF79 5.15e-11 70 29 4 184 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
P25489 5.42e-11 70 27 3 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 8.25e-06 53 22 3 249 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
Q7X8B5 7.66e-11 70 31 5 185 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q9LU41 7.92e-11 70 29 4 187 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
Q9SZR1 9.65e-11 69 28 4 184 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q92036 2e-10 68 28 5 239 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q2RAS0 2.58e-10 68 28 4 183 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2RAS0 6.42e-10 67 25 11 343 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 2.84e-10 68 26 11 316 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 3.33e-10 68 28 4 183 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
O81108 3.51e-10 68 29 3 162 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O81108 9.19e-07 57 23 9 313 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
Q37145 3.76e-10 67 30 4 162 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q37145 3.86e-05 51 22 10 362 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
P54678 3.88e-10 67 30 2 150 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P54678 1.2e-06 56 24 7 268 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
A0A143ZZK9 4.24e-10 67 26 7 223 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
O64806 6e-10 67 29 3 162 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O64806 2.85e-07 58 24 11 319 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
Q64541 6.39e-10 67 24 8 306 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q64541 2.6e-09 65 25 5 235 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q9WV27 8.62e-10 66 24 7 306 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9WV27 1.38e-09 66 24 8 289 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
P9WPS4 3.11e-09 65 32 4 186 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS5 3.14e-09 65 36 4 152 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P39986 4.01e-09 64 22 16 441 1 SPF1 Endoplasmic reticulum transmembrane helix translocase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q16720 4.84e-09 64 28 6 205 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
Q64568 5.18e-09 64 28 6 205 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
G5E829 7.34e-09 63 28 6 202 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
P11505 7.52e-09 63 28 6 202 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
P28774 8.34e-09 63 25 4 193 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 1.58e-06 56 22 4 254 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P11506 1.07e-08 63 27 6 205 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
P20020 1.16e-08 63 27 5 205 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
Q9R0K7 1.19e-08 63 27 6 205 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
Q9R0K7 2.71e-05 52 24 5 260 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
P23220 1.25e-08 63 27 5 205 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
Q01814 1.26e-08 63 27 6 205 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
P35317 1.55e-08 62 32 4 131 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P35317 1.63e-05 52 23 5 238 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P06685 1.56e-08 62 24 6 253 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06685 7.52e-08 60 36 1 88 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
Q8VDN2 1.66e-08 62 24 6 253 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q8VDN2 8.18e-08 60 36 1 88 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q5RCD8 1.7e-08 62 37 1 88 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 1.09e-07 60 25 7 255 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
G5EFR6 2.04e-08 62 31 5 173 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
Q64542 2.08e-08 62 30 3 165 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
Q9N0Z6 2.31e-08 62 24 6 253 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9N0Z6 3.5e-08 61 36 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
D2WKD8 2.38e-08 62 37 1 88 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 8.75e-08 60 25 5 256 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
P06686 2.4e-08 62 37 1 88 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
P06686 4.47e-08 61 25 7 255 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 2.4e-08 62 37 1 88 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6PIE5 4.47e-08 61 25 7 255 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
P24797 2.44e-08 62 37 1 88 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 1.06e-07 60 23 6 253 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P50993 2.47e-08 62 37 1 88 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 1.29e-07 59 24 5 256 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
A2VDL6 2.47e-08 62 37 1 88 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 9.86e-08 60 25 5 256 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
Q92030 2.58e-08 62 25 3 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q92030 1.8e-06 55 21 5 256 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
P05025 2.62e-08 62 36 1 88 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 7.58e-08 60 24 6 253 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
Q98SH2 2.66e-08 62 27 5 205 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
Q5RDR3 3.13e-08 61 36 1 88 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RDR3 8.68e-08 60 24 6 253 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q9YH26 3.19e-08 61 36 1 88 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 1.29e-05 53 22 5 256 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
P05023 3.38e-08 61 36 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P05023 9.53e-08 60 24 6 253 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P18907 3.44e-08 61 36 1 88 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 3.47e-08 61 24 6 253 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P09572 3.84e-08 61 36 1 88 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 4.44e-08 61 22 4 251 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
Q08DA1 3.84e-08 61 36 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 6.96e-08 60 24 6 253 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P04074 3.9e-08 61 36 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 6.39e-08 60 24 6 253 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
Q6Q477 3.99e-08 61 27 6 205 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
P05024 4.01e-08 61 24 6 253 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P05024 2.37e-07 58 35 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
D3K0R6 4.13e-08 61 27 5 205 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
P23634 4.72e-08 61 27 6 202 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
P58165 4.87e-08 61 27 6 205 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
P50997 1.59e-07 59 24 6 253 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P50997 3.41e-07 58 36 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
Q00804 6.75e-07 57 26 6 205 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
Q21286 2.34e-06 55 24 13 302 2 catp-5 Cation-transporting ATPase catp-5 Caenorhabditis elegans
O32622 2.79e-06 49 41 2 65 4 HI_0292 Uncharacterized protein HI_0292 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P43979 8.11e-06 47 40 2 65 1 HI_0291 Uncharacterized protein HI_0291 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6GDP0 1.34e-05 47 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MRSA252)
P0C885 1.34e-05 47 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain bovine RF122 / ET3-1)
P17239 1.52e-05 52 37 1 86 1 merA Mercuric reductase Acidithiobacillus ferrooxidans
P17239 0.000165 49 34 3 86 1 merA Mercuric reductase Acidithiobacillus ferrooxidans
O14022 1.99e-05 52 23 7 226 3 cta5 Cation-transporting ATPase 5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12697 2.5e-05 52 22 18 398 1 YPK9 Vacuolar cation-transporting ATPase YPK9 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q79ZY4 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MW2)
A8Z3F9 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6B6 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MSSA476)
Q7A3E5 2.73e-05 46 39 1 61 1 copZ Copper chaperone CopZ Staphylococcus aureus (strain N315)
Q99R79 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QK48 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Newman)
Q5HCZ2 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain COL)
A5IVY4 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain JH9)
Q2FV63 2.73e-05 46 39 1 61 1 copZ Copper chaperone CopZ Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDU9 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain USA300)
A6U4T9 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain JH1)
A7X6S3 2.73e-05 46 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4VNC1 5.96e-05 50 29 7 213 1 ATP13A4 Probable cation-transporting ATPase 13A4 Homo sapiens
Q58378 7.25e-05 49 24 3 151 1 patS Soluble P-type ATPase-like phosphatase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4L971 0.000251 43 36 1 63 3 copZ Copper chaperone CopZ Staphylococcus haemolyticus (strain JCSC1435)
B3H6D0 0.000278 46 28 1 74 3 HIPP45 Heavy metal-associated isoprenylated plant protein 45 Arabidopsis thaliana
F4IC29 0.00032 45 32 0 58 3 HIPP28 Heavy metal-associated isoprenylated plant protein 28 Arabidopsis thaliana
Q5XF89 0.00037 48 25 13 297 1 Atp13a3 Polyamine-transporting ATPase 13A3 Mus musculus
Q51772 0.00038 48 36 1 71 3 merA Mercuric reductase Pseudomonas fluorescens
Q4WYP6 0.000503 48 40 0 49 2 spfA Endoplasmic reticulum transmembrane helix translocase spfA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P0A216 0.000524 43 38 1 67 3 merP Mercuric transport protein periplasmic component Salmonella typhi
P0A218 0.000524 43 38 1 67 3 merP Mercuric transport protein periplasmic component Enterobacter cloacae
P0A217 0.000524 43 38 1 67 3 merP Mercuric transport protein periplasmic component Enterobacter agglomerans
Q52107 0.000567 43 38 1 67 3 merP Mercuric transport protein periplasmic component Acinetobacter calcoaceticus
Q6BZU2 0.000593 46 35 1 64 3 CCS1 Superoxide dismutase 1 copper chaperone Yarrowia lipolytica (strain CLIB 122 / E 150)
Q5XF90 0.000661 47 28 7 214 1 Atp13a4 Probable cation-transporting ATPase 13A4 Mus musculus
O14072 0.00074 47 40 0 49 1 cta4 Endoplasmic reticulum transmembrane helix translocase Schizosaccharomyces pombe (strain 972 / ATCC 24843)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10710
Feature type CDS
Gene copA
Product copper-exporting P-type ATPase CopA
Location 2353322 - 2356276 (strand: 1)
Length 2955 (nucleotides) / 984 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_331
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00403 Heavy-metal-associated domain
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2217 Inorganic ion transport and metabolism (P) P Cation-transporting P-type ATPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K17686 P-type Cu+ transporter [EC:7.2.2.8] Platinum drug resistance
MAPK signaling pathway - plant
Mineral absorption
-

Protein Sequence

MAKTTLLALQGLSCSHCINSVKKSLDARNDIEQSTVTIQYAKIDSDATVESLIKTIEEAGYEAHLATQADVKLNLSGLNCMKCVGKTENALLAVDGVVAVNVDKTSAEIFGTANAKDLIAAVVAEGFEASLANEEENKPKTIELTLSGLNCGHCINSVKKALEGTDGVESAQVELTHATVTGTANTERVITAIQDAGYDAKLAGANHPKTEPLTQTDAPLEASSAAICDIPVEEAILDNNNADISIDDDSTQLLIDGMTCASCVSKVQKALQSVSGVENARVNLAERSALVTGHVNHDDLINAVEKAGYGAEIIQDDVKRRERQQEVAVANMKRFRWQAALALVVGIPVMVWGMIGDNMMLTEANHNIWLTIGIITLIVMIAAGGHFYRNAWQSLKNGSATMDTLVALGTGAAWLYSISVNLWPEVFPAQARHLYYEASAMIIGLINLGHMLEQRARQRSSKALERLLDLTPPTARVVTDNGEVEMPLADVKQGMILRLATGDKVPVDGEITQGEVWMDEAMLTGEPIPQQKSLGDTIHAGTTVQDGSVLFKAAAVGSQTTLARIIKLVRQAQSSKPEIGQLADKISSVFVPIVVVIALIAGAIWYFFGPSPQITYALVIITTVLIIACPCALGLATPMSIISGVGRAAEYGVLVRDADALQQASQLDTLVFDKTGTLTEGMPQVTEIHTFNQISETQALALAGALESGSNHPLAKAILTKAEGIKLPQISQFRTLAGMGLSGEIDGNIVLLGKPKLMKESGIDISEINALIENQSAKGVTPVLLAQNGKIAALLSIRDPLREDTVSALQRLHHQGYRLVMLTGDNPITANAIAKEAGIDQVIAGVMPEGKAQAISQLQAEGRRVAMIGDGINDAPALAKADVGIAMGGGSDIAIETAAITLMRHSLHGVADAVEISKGTLRNMKQNLFGAFIYNSLGIPIAAGILYPFTGTLLNPVVAGAAMALSSITVVSNANRLLRFKPKK

Flanking regions ( +/- flanking 50bp)

CATATTACGCCATAATAGAGGTAATCGCTTTTTATTTGGAGATATTGACCATGGCAAAAACTACGCTACTCGCACTACAAGGGCTTTCATGCTCCCACTGTATTAACAGTGTAAAAAAATCACTTGATGCCCGCAATGATATAGAACAGTCCACGGTGACTATTCAATACGCTAAAATTGACAGCGACGCAACTGTTGAAAGCTTAATCAAAACAATTGAAGAAGCCGGATATGAAGCTCATCTAGCCACTCAAGCTGATGTAAAACTAAATTTGAGTGGACTTAACTGTATGAAATGCGTTGGTAAAACAGAAAATGCGTTATTAGCCGTTGACGGTGTTGTTGCGGTCAATGTAGACAAAACATCAGCTGAAATTTTTGGTACAGCAAACGCAAAAGATTTAATTGCCGCCGTTGTTGCTGAAGGTTTTGAAGCCTCATTAGCAAACGAAGAAGAAAATAAACCAAAAACGATTGAACTGACTTTATCAGGCTTAAATTGTGGTCATTGTATTAATTCAGTGAAGAAAGCTCTTGAAGGGACTGATGGGGTAGAAAGTGCACAAGTGGAATTAACTCATGCCACAGTAACAGGTACGGCAAACACAGAGCGTGTGATCACAGCCATTCAAGATGCTGGTTATGATGCAAAATTAGCAGGAGCCAACCACCCAAAAACTGAGCCGCTGACGCAAACGGATGCACCACTGGAAGCATCGTCAGCGGCGATTTGTGATATTCCAGTAGAAGAAGCCATCCTTGATAATAATAATGCTGATATCAGTATCGATGATGATAGCACTCAGCTATTAATCGACGGTATGACTTGTGCAAGCTGTGTTAGCAAAGTACAAAAAGCCTTACAAAGTGTTTCCGGTGTTGAAAATGCACGTGTTAATTTGGCTGAACGTAGCGCACTTGTAACCGGTCATGTTAATCATGATGACCTGATTAATGCGGTCGAAAAAGCAGGCTATGGGGCAGAAATTATTCAAGATGATGTAAAACGTAGAGAGCGTCAACAAGAAGTCGCTGTTGCTAATATGAAGCGTTTTCGCTGGCAAGCAGCCTTAGCCTTAGTCGTTGGTATTCCTGTAATGGTATGGGGAATGATCGGCGATAATATGATGTTAACGGAAGCTAATCATAATATCTGGTTAACTATCGGTATTATTACGCTTATTGTGATGATAGCTGCAGGTGGGCACTTTTATCGTAATGCGTGGCAAAGCCTAAAAAACGGCAGTGCCACCATGGACACGCTCGTTGCGTTAGGTACAGGGGCGGCTTGGCTCTATTCAATTAGTGTTAACTTATGGCCTGAGGTGTTTCCTGCCCAAGCAAGACATCTCTATTACGAGGCCAGTGCGATGATCATTGGTTTGATAAACCTTGGTCATATGCTTGAACAAAGAGCCCGTCAGCGCTCTTCTAAAGCATTAGAGCGTCTATTAGACTTAACACCACCAACAGCAAGAGTAGTAACAGATAATGGCGAAGTTGAAATGCCATTAGCGGATGTGAAACAAGGTATGATCTTGCGTTTAGCAACCGGTGATAAAGTTCCCGTTGATGGTGAAATCACCCAAGGTGAAGTGTGGATGGATGAGGCAATGTTAACTGGTGAGCCTATTCCACAACAAAAAAGCCTTGGTGATACCATTCATGCAGGTACTACCGTGCAAGATGGCTCAGTGCTGTTTAAAGCTGCAGCAGTAGGCAGTCAAACTACCCTTGCCCGAATTATCAAACTGGTACGTCAAGCACAAAGCAGTAAACCCGAAATAGGTCAATTAGCAGATAAAATTTCCAGTGTATTTGTTCCTATCGTCGTCGTTATTGCGTTAATTGCAGGGGCTATTTGGTACTTTTTTGGTCCTTCACCACAAATTACTTATGCACTCGTCATTATCACAACGGTATTAATTATCGCTTGTCCTTGTGCTCTAGGATTAGCGACCCCCATGTCGATTATTTCAGGTGTGGGACGTGCCGCAGAATATGGCGTATTAGTGCGTGATGCGGATGCATTACAACAAGCAAGCCAATTAGATACCTTAGTTTTTGATAAAACAGGTACCTTAACTGAAGGCATGCCACAAGTAACTGAGATCCACACATTCAATCAGATAAGTGAAACTCAAGCGCTAGCATTAGCAGGCGCACTAGAAAGTGGCTCTAATCATCCATTAGCAAAAGCGATTTTAACCAAAGCTGAAGGTATTAAATTACCGCAAATAAGCCAATTTAGAACTCTTGCAGGTATGGGGTTAAGTGGTGAAATTGACGGCAATATTGTGCTGTTAGGTAAACCTAAACTAATGAAAGAATCTGGCATTGATATAAGTGAGATAAACGCCTTAATAGAAAACCAATCAGCGAAAGGGGTAACCCCTGTCTTATTGGCGCAAAATGGGAAAATAGCGGCCCTACTTTCTATTCGTGACCCACTGCGAGAAGATACCGTTAGTGCATTACAGCGTCTACATCATCAAGGTTATCGTTTGGTCATGTTAACTGGAGATAACCCTATTACGGCTAATGCGATAGCTAAAGAAGCGGGTATTGATCAAGTGATTGCAGGCGTTATGCCAGAAGGTAAAGCGCAAGCGATTAGTCAACTACAGGCAGAAGGTCGTCGCGTAGCAATGATTGGAGATGGTATTAACGATGCCCCAGCACTGGCTAAAGCAGACGTTGGTATTGCGATGGGTGGTGGCAGTGATATCGCCATTGAAACCGCGGCCATTACCTTAATGCGCCATAGCTTACATGGTGTTGCTGATGCGGTTGAGATCTCAAAAGGCACACTGCGCAATATGAAACAAAACTTGTTTGGTGCATTTATATATAACAGTTTAGGCATTCCTATTGCTGCCGGTATCTTATATCCTTTTACCGGTACATTATTAAACCCTGTGGTTGCGGGGGCTGCCATGGCCTTATCATCAATCACTGTCGTCAGTAATGCCAACCGATTATTACGTTTTAAACCGAAAAAATAGTCGCAATTAATCAGTCAAATACAGCCTCTTCTATCTTTAGATACCAGAGG