Homologs in group_331

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13015 FBDBKF_13015 100.0 Morganella morganii S1 copA copper-exporting P-type ATPase CopA
NLDBIP_06650 NLDBIP_06650 100.0 Morganella morganii S4 copA copper-exporting P-type ATPase CopA
LHKJJB_03530 LHKJJB_03530 100.0 Morganella morganii S3 copA copper-exporting P-type ATPase CopA
HKOGLL_07005 HKOGLL_07005 100.0 Morganella morganii S5 copA copper-exporting P-type ATPase CopA
F4V73_RS04945 F4V73_RS04945 45.2 Morganella psychrotolerans - heavy metal translocating P-type ATPase
F4V73_RS16200 F4V73_RS16200 90.8 Morganella psychrotolerans copA copper-exporting P-type ATPase CopA
PMI_RS10710 PMI_RS10710 78.4 Proteus mirabilis HI4320 copA copper-exporting P-type ATPase CopA

Distribution of the homologs in the orthogroup group_331

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_331

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZCA7 0.0 1285 67 6 963 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q8ZR95 0.0 1203 72 2 839 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR95 7.64e-21 102 41 2 160 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR95 3.53e-06 54 44 1 70 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z8S4 0.0 1201 72 2 839 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8Z8S4 8.26e-21 102 41 2 160 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8Z8S4 3.5e-06 54 44 1 70 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8XD24 0.0 1199 73 4 842 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q8XD24 1.52e-21 104 38 2 171 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q8XD24 1.45e-05 52 41 1 70 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q59385 0.0 1191 72 3 841 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q59385 1.64e-21 104 38 2 171 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q59385 1.57e-05 52 41 1 70 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q9KPZ7 0.0 800 48 11 911 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9X5X3 0.0 610 42 11 861 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q9X5X3 4.22e-11 70 34 3 128 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
Q9X5X3 1.07e-07 59 44 1 70 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
P58342 0.0 591 41 12 866 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58342 5.48e-13 77 35 3 134 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58342 3.43e-07 58 44 1 70 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58341 0.0 578 40 14 864 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
P58341 5.08e-09 63 31 5 149 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
Q9ZHC7 0.0 561 45 8 662 1 silP Silver exporting P-type ATPase Salmonella typhimurium
P73241 0.0 552 41 11 752 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O32220 0.0 551 39 16 858 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
Q2YWA3 0.0 549 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YWA3 1.3e-09 65 31 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GDP1 0.0 548 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q6GDP1 1.28e-09 65 31 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q8NUQ9 0.0 545 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q8NUQ9 1.33e-09 65 31 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 0.0 545 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q6G6B7 1.33e-09 65 31 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q5ZWR1 0.0 545 45 9 663 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8CN02 1.72e-180 544 38 13 853 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 1.72e-180 544 38 13 853 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8Z3F8 3.17e-180 544 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
A8Z3F8 1.25e-09 65 31 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDV0 3.17e-180 544 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q2FDV0 1.25e-09 65 31 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
P37279 3.21e-180 542 43 14 754 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A6QK47 3.89e-180 543 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
A6QK47 1.28e-09 65 31 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 3.89e-180 543 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q5HCZ3 1.28e-09 65 31 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 3.89e-180 543 39 14 860 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FV64 1.28e-09 65 31 8 157 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q4L970 4.67e-180 543 39 14 856 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
Q7A3E6 2.47e-179 541 39 14 860 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q7A3E6 3.65e-09 64 30 8 157 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 2.47e-179 541 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99R80 3.65e-09 64 30 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 2.47e-179 541 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A5IVY3 3.65e-09 64 30 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 2.47e-179 541 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A6U4T8 3.65e-09 64 30 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 2.47e-179 541 39 14 860 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X6S1 3.65e-09 64 30 8 157 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4A0G1 7.72e-179 540 38 19 859 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A0G1 1.49e-05 52 28 6 148 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9X5V3 2.32e-165 506 47 5 612 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
P32113 3.76e-161 492 40 17 741 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
O29777 1.6e-156 482 37 13 734 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O29777 0.000365 48 47 2 59 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O29777 0.0008 47 46 3 62 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q6H7M3 5.06e-153 479 34 19 946 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
P9WPS3 9.5e-153 471 44 7 615 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 9.5e-153 471 44 7 615 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9SH30 1.55e-150 473 32 19 970 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
Q9SH30 0.000386 48 31 2 85 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
A3AWA4 9.28e-149 468 32 21 973 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
P77868 2.93e-146 453 38 17 748 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0P0X004 1.99e-141 449 32 23 986 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
A0A0P0X004 0.000179 49 24 5 186 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q9S7J8 5.15e-141 447 32 17 975 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
P35670 5.09e-133 437 32 17 904 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
Q64446 5.74e-133 436 31 18 922 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64535 1.01e-132 436 32 19 928 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q64535 1.86e-06 55 21 6 247 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
P37385 3.19e-131 416 37 17 800 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9XT50 1.77e-130 430 32 17 901 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 0.000139 49 22 7 250 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 0.000204 49 22 5 153 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q64430 4.36e-130 429 29 22 1041 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 1.32e-05 53 21 7 285 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 0.000243 48 20 7 283 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q59467 2.65e-129 409 33 16 765 3 copA Copper-transporting ATPase Helicobacter pylori
O08462 3.93e-129 409 33 16 765 3 copA Copper-transporting ATPase Helicobacter pylori
Q04656 9.44e-129 426 29 21 1055 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 1.16e-05 53 20 8 285 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 0.000433 48 23 11 291 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
P07893 9.94e-129 409 36 17 800 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P70705 2.34e-128 424 29 24 1047 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 9.88e-07 56 26 5 178 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 0.000168 49 19 6 281 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P77871 8.69e-128 405 32 16 765 3 copA Copper-transporting ATPase Helicobacter pylori
Q9ZM69 4.81e-127 404 33 15 765 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
P55989 9.5e-125 397 32 16 765 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
P38995 1.8e-123 401 31 30 992 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P9WPU1 3.82e-122 391 37 14 745 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 3.82e-122 391 37 14 745 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O32619 4.91e-122 390 33 11 735 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
O30085 1.73e-121 387 36 10 652 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P49015 2.05e-120 402 28 24 1046 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P49015 3.33e-07 58 27 5 173 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P46840 2.98e-113 367 34 14 743 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
O59666 1.73e-111 367 31 24 896 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B9DFX7 5.36e-109 360 31 18 799 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
P05425 1.24e-107 352 33 13 655 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q9SZC9 1.72e-107 357 34 16 782 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
P9WPT8 2.01e-107 352 34 17 769 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 2.01e-107 352 34 17 769 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPT9 7.48e-107 350 35 16 748 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8CQF7 1.2e-102 337 32 10 652 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q69HU0 1.59e-102 337 32 12 653 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
A8YZ02 1.98e-102 336 32 10 653 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 1.98e-102 336 32 10 653 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
Q6GIX4 2.49e-102 336 32 12 653 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
Q4LAB1 3.02e-101 333 31 12 654 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
Q5HKB0 9.6e-101 332 31 12 653 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P9WPT5 7.37e-99 328 36 9 621 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 7.37e-99 328 36 9 621 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 7.37e-99 328 36 9 621 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P58414 8.36e-99 328 31 14 688 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9CCL1 1.35e-98 328 35 10 619 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
B2HEM2 2.99e-98 327 35 9 619 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
P46839 7.38e-98 327 34 12 749 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
P37386 8.16e-98 328 30 26 870 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
P20021 1.85e-95 319 30 17 747 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
Q6GIX1 7.66e-93 312 30 17 751 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
P30336 1.72e-90 306 31 17 732 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q60048 1.66e-87 297 31 19 748 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
O33533 3.54e-86 295 29 15 745 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
Q3YW59 4.32e-86 294 31 18 758 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
O32219 2.53e-85 291 29 15 742 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
P37617 3.38e-85 291 30 18 759 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
Q59998 1.47e-84 290 35 12 559 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O31688 4.84e-84 286 34 10 557 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
Q59207 1.66e-78 273 31 16 740 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P18398 2.64e-76 268 29 17 743 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
P9WPT7 5.35e-73 256 35 10 550 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 5.35e-73 256 35 10 550 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P38360 5.16e-72 262 28 15 683 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0R3A7 3.24e-70 248 34 9 543 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9SZW4 8.83e-70 253 27 24 750 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
O64474 3.08e-65 242 30 15 564 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
A3BF39 6.33e-65 240 30 8 507 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
Q59465 1.45e-63 231 29 9 508 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9RQB4 6.05e-63 229 26 13 697 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
Q9ZL53 1.02e-61 225 26 14 691 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
P0CW78 3.21e-58 217 28 13 556 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
P9WPS7 1.79e-51 197 36 10 541 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 1.79e-51 197 36 10 541 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 1.79e-51 197 36 10 541 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPT3 2.68e-51 195 32 9 547 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 2.68e-51 195 32 9 547 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 2.68e-51 195 32 9 547 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8YPE9 8.88e-50 191 28 10 535 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9M3H5 3.38e-49 191 29 14 572 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
Q8H384 2.57e-48 189 32 10 508 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
Q9R6X1 6.09e-47 182 29 9 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
P57700 1.86e-46 181 27 13 556 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q97BF6 2.77e-44 174 27 12 539 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q8R8I6 1.27e-43 172 29 11 541 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
O32328 4.94e-43 171 28 13 555 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5HK64 3.86e-42 168 28 13 530 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 3.86e-42 168 28 13 530 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 3.86e-42 168 28 13 530 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 3.86e-42 168 28 13 530 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q4LAI2 2.54e-41 165 27 12 530 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
Q9A7X7 2.86e-41 165 32 7 421 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8PPC9 3.52e-41 165 33 9 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
Q8PCM1 7.56e-41 164 33 12 465 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B4U8E4 9.94e-41 164 28 5 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
C3LF99 1.22e-40 164 29 9 473 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q9RZP0 4.41e-40 161 28 5 445 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q63FR0 6.21e-40 161 28 9 475 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
Q8YSD5 8.45e-40 161 27 8 474 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A0RA13 1.34e-39 160 29 10 475 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
Q6HN78 1.62e-39 160 29 10 475 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7HWG1 1.62e-39 160 28 9 473 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
A4W860 1.63e-39 160 30 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
Q57RN0 1.8e-39 160 29 11 438 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
A9VFM1 2.16e-39 160 29 9 474 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
B7JRB8 3.02e-39 159 28 10 475 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
C1EYK0 3.09e-39 159 28 9 473 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
Q81HQ0 3.19e-39 159 28 9 473 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HDF9 3.28e-39 159 28 9 474 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
B7II09 3.43e-39 159 28 9 474 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
Q926K7 2.01e-38 157 28 7 467 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8U9D9 3.06e-38 156 31 6 422 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
P73867 3.45e-38 156 30 9 447 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q98GX6 9.39e-38 155 31 7 435 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A7GLG4 1.82e-37 154 28 11 482 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B5YQN9 3.16e-37 153 29 14 493 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 3.16e-37 153 29 14 493 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
Q9X8Z9 5.04e-37 152 29 7 435 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B1IY32 5.29e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q3Z4A6 5.68e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
P57699 6.15e-37 152 25 11 575 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 6.15e-37 152 25 11 575 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B7NMQ0 6.39e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P03960 7.18e-37 152 29 11 460 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 7.18e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 7.18e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
B1LLE1 7.24e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
A7ZXV8 7.65e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
B6HYQ5 7.71e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 7.71e-37 152 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
Q92XJ0 9.09e-37 151 29 11 470 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
P59219 9.7e-37 151 29 10 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q324L0 1.18e-36 151 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
B2V2P3 1.18e-36 151 29 10 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
B5XZE9 1.47e-36 151 29 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
Q8XU11 1.57e-36 151 29 11 492 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B7N9U0 1.72e-36 150 28 9 459 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8ZQW2 2.55e-36 150 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0CW77 2.57e-36 148 27 5 351 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
B4SZB1 2.64e-36 150 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
B7MPK0 2.79e-36 150 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
A6T6D8 2.87e-36 150 29 8 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8FJV4 2.87e-36 150 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 2.87e-36 150 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UKX6 2.87e-36 150 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5EZE3 3e-36 150 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
B5R670 3.04e-36 150 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7M5L3 3.49e-36 150 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 3.49e-36 150 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
B2TMJ2 3.85e-36 149 29 10 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
B5BCA4 4e-36 149 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 4e-36 149 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5FNE0 4e-36 149 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
B4TBA6 4.11e-36 149 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 4.11e-36 149 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
B4TQ22 4.61e-36 149 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
A9MUE0 5.09e-36 149 29 11 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B7LKR7 6.73e-36 149 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8NVI2 9.06e-36 148 28 9 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 9.06e-36 148 28 9 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
Q6GEZ7 9.91e-36 148 28 9 469 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
Q72TM6 1.1e-35 148 29 10 467 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P57698 1.16e-35 148 30 10 463 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1REM0 1.72e-35 147 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 1.72e-35 147 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 1.72e-35 147 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
Q927G0 1.74e-35 147 29 14 501 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B2TTJ7 1.9e-35 147 29 11 460 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A8Z4X9 2.03e-35 147 28 9 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 2.03e-35 147 28 9 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 2.03e-35 147 28 9 469 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
P63684 2.05e-35 147 28 9 469 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 2.05e-35 147 28 9 469 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q71W90 4.39e-35 146 29 14 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 4.39e-35 146 29 14 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
B8DAW1 4.89e-35 146 29 14 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
Q2YUH7 4.98e-35 146 27 6 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
P9WPU3 5.15e-35 146 30 8 441 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 5.15e-35 146 30 8 441 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 5.15e-35 146 30 8 441 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8Y3Z7 6.17e-35 146 29 14 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q58623 7.05e-35 146 26 10 525 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8KU73 1.19e-34 145 27 7 458 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q93MV5 1.65e-34 144 30 8 445 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
Q667S4 5.67e-34 143 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TL06 5.72e-34 143 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 5.72e-34 143 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 5.72e-34 143 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 5.72e-34 143 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 5.72e-34 143 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 5.72e-34 143 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
B1JR96 6.66e-34 142 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 6.66e-34 142 31 12 451 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7N6W6 1.05e-33 142 28 14 499 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A0AM16 1.13e-33 142 28 15 494 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A1JQS2 6.01e-33 140 30 12 466 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q0TRT3 2.47e-32 138 27 10 472 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q47H39 2.54e-32 138 30 9 433 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
B2VJK3 6.69e-32 136 28 8 441 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C4LDL7 1.31e-31 135 27 6 462 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A8GB61 1.91e-31 135 28 9 457 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
A4SZG8 6.99e-31 133 27 9 448 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
P28877 8.88e-30 130 25 9 504 1 PMA1 Plasma membrane ATPase 1 Candida albicans
P19657 2.88e-29 129 25 10 515 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P07038 1.39e-28 127 25 11 512 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P05030 4.66e-28 125 25 9 503 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0ABB8 8.87e-28 124 25 20 594 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 8.87e-28 124 25 20 594 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
Q9LY32 2.16e-27 123 27 16 528 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
Q43128 6.04e-27 122 25 15 532 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
P12522 6.08e-27 122 24 8 509 2 H1B Probable proton ATPase 1B Leishmania donovani
P11718 1.05e-26 121 25 9 510 2 H1A Probable proton ATPase 1A Leishmania donovani
P47317 1.11e-26 120 24 16 586 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P24545 1.24e-26 120 24 10 547 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
P54679 4.21e-26 119 24 17 548 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
P36640 1.03e-25 117 24 18 590 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 1.03e-25 117 24 18 590 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
Q08436 1.14e-25 117 26 14 530 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
P35597 2.45e-25 116 26 11 476 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P09627 3.13e-25 116 24 11 543 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9SU58 3.26e-25 116 26 17 538 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
Q08435 5.53e-25 115 26 14 532 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
Q7XPY2 8.75e-25 115 25 15 531 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
P49380 1.89e-24 114 24 9 503 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A0R3Y2 2.54e-24 113 25 15 570 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9SH76 2.65e-24 113 25 13 510 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
P22180 3.25e-24 113 26 17 531 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
Q9M2A0 5.45e-24 112 25 11 505 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
Q07421 6.92e-24 112 24 10 510 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
P19456 7.89e-24 112 24 17 533 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
P28876 1.02e-23 111 24 12 538 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P83970 1.64e-23 110 24 14 514 2 ha1 Plasma membrane ATPase Triticum aestivum
P20649 2.56e-23 110 24 15 533 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
Q9LV11 2.7e-23 110 25 15 536 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
P22036 5.79e-23 109 22 16 628 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P54210 9.5e-23 108 23 11 563 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
P20431 1.32e-22 108 24 14 529 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
Q9SJB3 1.73e-22 107 24 13 528 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
P54211 3.23e-21 103 24 20 629 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
Q8Z8E5 3.61e-21 102 32 6 282 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
P9WPT1 1e-20 101 26 12 494 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 1e-20 101 26 12 494 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPT0 1.05e-20 101 26 12 494 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8Y8Q5 4.1e-20 100 33 3 188 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8Q5 6.9e-11 70 25 6 263 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9M2L4 6.64e-20 99 22 18 598 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9CFU9 3.13e-17 90 32 4 188 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q9CFU9 9.51e-07 56 21 6 255 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
P22189 2.07e-16 88 27 7 304 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O77696 2.11e-16 88 30 3 220 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
O77696 1.44e-06 56 25 6 251 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
Q73E41 2.85e-16 87 35 2 159 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73E41 1.09e-07 59 25 9 274 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7XB51 3.67e-16 87 31 1 178 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q7XB51 1.81e-12 75 28 6 270 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
O13397 5.07e-16 87 33 3 174 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
Q4WHC8 5.44e-16 86 32 3 185 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WHC8 0.000274 48 24 6 275 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O43108 5.68e-16 86 33 4 183 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O43108 1.36e-12 75 26 5 276 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P37367 6.29e-16 86 32 4 203 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37367 6.04e-06 53 24 3 217 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9YGL9 9.41e-16 85 31 4 204 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 2.61e-06 55 25 8 251 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
P35316 1.1e-15 85 29 4 212 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P35316 1.01e-06 56 23 7 285 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
Q93084 1.51e-15 85 30 4 220 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q93084 5.33e-06 54 25 7 269 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
P22700 1.88e-15 85 28 4 216 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
P22700 2.74e-07 58 24 9 328 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
Q292Q0 1.95e-15 85 27 3 216 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q292Q0 1.6e-06 55 24 9 328 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
P54209 2.27e-15 84 31 4 217 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
Q7XEK4 2.58e-15 84 33 4 186 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q7XEK4 8.8e-07 57 24 6 237 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
O13398 3.3e-15 84 32 3 174 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O13398 2.64e-07 58 26 10 307 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
P37278 3.88e-15 84 33 3 172 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37278 9.69e-15 82 27 8 317 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q64518 4.38e-15 84 29 4 220 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64518 1.75e-06 55 25 7 269 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
P18596 8.37e-15 82 30 4 204 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P18596 2.15e-06 55 25 7 269 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
O59868 9.6e-15 82 26 5 269 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59868 1.73e-14 81 34 4 185 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
C1L360 1.03e-14 82 32 2 175 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
C1L360 5.16e-14 80 31 7 245 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
Q7PPA5 1.31e-14 82 28 4 216 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q7PPA5 7.47e-06 53 23 8 311 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
P78036 3.14e-14 80 33 3 165 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P78036 9.28e-13 76 25 9 311 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q03669 3.41e-14 80 30 3 184 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q03669 0.000168 49 22 9 274 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q9XES1 3.59e-14 80 31 5 174 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
Q9XES1 3.2e-06 55 25 7 264 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
P20647 3.71e-14 80 30 3 184 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P20647 8.9e-05 50 23 9 286 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P16615 3.74e-14 80 30 3 184 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P16615 0.000189 49 22 9 274 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P92939 4.59e-14 80 32 4 167 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P92939 3.42e-06 55 25 7 264 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
Q64578 5.1e-14 80 28 4 216 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q64578 0.000156 49 22 8 284 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
P04191 5.39e-14 80 28 4 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P04191 0.000138 49 23 8 284 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P13586 5.47e-14 80 31 4 175 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13586 3.49e-11 71 24 7 296 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8R429 5.7e-14 80 28 4 216 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q8R429 0.000139 49 23 8 284 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
P13585 6.53e-14 80 28 4 215 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P11507 6.57e-14 80 30 3 184 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P11507 0.000155 49 23 8 271 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
O14983 6.96e-14 79 28 4 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O14983 0.000151 49 23 8 284 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O55143 7.1e-14 79 30 3 184 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
O55143 0.000176 49 23 8 271 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
P11607 7.22e-14 79 30 3 184 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11607 0.000185 49 22 9 274 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
Q8R4C1 7.74e-14 79 26 5 252 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q8R4C1 1.3e-09 65 31 4 178 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
O46674 8.31e-14 79 30 3 184 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
O46674 0.000148 49 23 8 271 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
Q00779 8.52e-14 79 30 3 184 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q00779 0.000124 49 23 8 271 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
B9QMJ0 1.21e-13 79 31 6 214 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
Q64392 1.28e-13 79 27 6 262 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 6.43e-06 53 21 4 238 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q08853 1.29e-13 79 32 3 177 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
Q0VCY0 1.63e-13 78 28 4 215 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q0VCY0 0.000427 48 22 8 284 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q9SY55 1.66e-13 78 28 3 195 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q9SY55 0.000144 49 25 8 256 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q42883 1.74e-13 78 27 3 195 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q42883 5.43e-08 60 23 7 324 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q4WND5 1.89e-13 78 29 5 211 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WND5 1.84e-07 58 26 8 268 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q92105 1.95e-13 78 32 2 159 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q01896 2.29e-13 78 31 3 174 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12691 2.39e-13 78 31 3 174 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7L9Z8 2.41e-13 78 26 5 252 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
A7L9Z8 4.81e-10 67 32 5 178 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
P70083 2.43e-13 78 28 4 215 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P70083 0.000174 49 24 8 302 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
O53114 2.81e-13 78 23 13 557 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
O22218 3.36e-13 77 29 2 179 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O22218 1.68e-07 59 22 20 488 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O23087 4.34e-13 77 28 3 195 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O23087 3.19e-08 61 22 9 327 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
Q9HDW7 4.42e-13 77 35 3 156 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HDW7 8.46e-05 50 25 5 223 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q03194 4.67e-13 77 30 4 193 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
Q03194 1.59e-09 65 27 7 220 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
P13587 6.15e-13 77 30 3 174 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O34431 6.56e-13 76 31 6 190 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
O34431 0.000145 49 26 9 283 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
P54707 1.07e-12 76 27 6 262 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 2.16e-08 62 22 7 294 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P23980 1.09e-12 75 26 11 386 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
Q9TV52 1.56e-12 75 27 6 262 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 3.57e-08 61 22 5 279 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9Z1W8 1.69e-12 75 28 6 259 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9Z1W8 4.86e-05 51 22 6 299 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q8RUN1 1.78e-12 75 32 4 165 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q8RUN1 1.74e-07 58 24 10 324 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
P54708 2.1e-12 75 28 6 259 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 4.94e-06 54 21 6 299 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
Q9LIK7 2.29e-12 75 27 5 226 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q9LIK7 2.29e-06 55 22 6 257 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
P38929 2.83e-12 74 30 6 211 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P28774 3.12e-12 74 27 4 212 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 3.92e-07 57 25 8 252 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
Q42556 3.59e-12 74 31 3 172 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
Q42556 1.35e-08 62 29 5 193 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
O75185 4.17e-12 73 27 7 251 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
O75185 2.46e-11 71 32 4 178 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
Q9LF79 5.09e-12 73 29 4 187 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
P35315 5.41e-12 73 30 2 159 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P35315 1.15e-09 66 24 9 353 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
Q5R5K5 5.54e-12 73 28 8 256 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q5R5K5 4.08e-11 70 31 5 190 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
P98194 6.14e-12 73 28 8 256 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P98194 3.88e-11 70 31 5 190 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
Q9T0E0 6.71e-12 73 24 15 466 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
Q9LY77 6.75e-12 73 29 5 197 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
Q65X71 7.77e-12 73 31 4 165 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q65X71 9.03e-09 63 25 12 387 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q9SZR1 7.98e-12 73 29 4 187 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q9SZR1 0.001 47 24 12 303 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q64566 1.13e-11 72 28 8 256 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q64566 3.47e-11 71 31 5 190 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
P57709 1.24e-11 72 27 8 256 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P57709 3.71e-11 70 31 5 190 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
Q80XR2 1.45e-11 72 27 8 255 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q80XR2 6.58e-11 70 31 5 190 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
J9VQQ3 2.03e-11 72 30 2 172 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P19156 2.23e-11 71 25 3 222 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 4.35e-06 54 22 4 253 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P50996 2.3e-11 71 25 3 221 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 4.54e-06 54 22 7 291 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P09626 2.38e-11 71 25 3 221 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 2.82e-06 55 22 4 243 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
Q64436 2.78e-11 71 25 3 221 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 2.84e-06 55 22 4 243 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
P20648 2.78e-11 71 25 3 221 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 1.8e-06 55 22 4 243 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P27112 2.9e-11 71 25 3 221 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 8.81e-06 53 22 4 243 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P17326 3.91e-11 70 24 5 239 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 9.03e-09 63 23 7 294 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
Q5RCD8 4.34e-11 70 25 6 236 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 4.55e-08 60 26 8 259 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
P13607 4.49e-11 70 27 3 192 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 3.19e-09 64 25 9 295 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P06686 6.26e-11 70 25 6 236 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
P06686 1.64e-08 62 26 9 264 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 6.26e-11 70 25 6 236 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6PIE5 1.64e-08 62 26 9 264 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6RWA9 6.8e-11 70 27 3 192 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q6RWA9 2.41e-09 65 26 7 258 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
D2WKD8 7.36e-11 70 25 6 236 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 8.88e-09 63 26 8 259 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
P50993 7.74e-11 70 25 6 236 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 1.41e-08 62 26 8 259 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P24797 7.8e-11 70 25 6 239 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 5.2e-08 60 25 8 256 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
Q9LU41 7.86e-11 70 28 4 189 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
A2VDL6 8.51e-11 69 25 6 236 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 1.13e-08 63 26 8 259 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
Q92126 1.05e-10 69 25 3 221 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 4.58e-05 51 24 5 245 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q2QY12 1.18e-10 69 25 9 321 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 1.35e-09 65 28 4 185 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
P13637 1.2e-10 69 25 6 237 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 9.94e-10 66 27 8 259 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
Q2RAS0 1.21e-10 69 25 9 319 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2RAS0 9.7e-10 66 28 4 185 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
P06687 1.23e-10 69 25 6 237 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 9.36e-10 66 27 8 259 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 1.23e-10 69 25 6 237 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 9.36e-10 66 27 8 259 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
P9WPS9 1.87e-10 68 29 5 244 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS9 1.19e-06 56 26 5 269 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 1.87e-10 68 29 5 244 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS8 1.19e-06 56 26 5 269 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 1.87e-10 68 29 5 244 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63688 1.19e-06 56 26 5 269 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P24798 1.87e-10 68 25 6 236 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 3.53e-09 64 26 8 259 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
Q92030 1.91e-10 68 25 6 233 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q92030 9.62e-08 60 22 5 258 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q7X8B5 2.42e-10 68 30 6 188 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q37145 2.55e-10 68 30 4 162 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q37145 3.98e-05 51 25 6 216 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q92123 2.76e-10 68 26 3 192 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92123 2.13e-06 55 22 5 283 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92036 3.35e-10 67 26 5 239 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q92036 7.32e-05 50 24 7 260 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
P58312 3.37e-10 67 26 8 259 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 3.48e-08 61 30 3 132 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P54678 5.24e-10 67 30 2 149 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P54678 1.83e-06 55 23 6 268 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
A0A143ZZK9 6.34e-10 67 25 9 271 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
Q6ATV4 7.95e-10 66 28 5 186 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q6ATV4 7.37e-05 50 23 12 317 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
P30714 1.22e-09 66 26 3 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 1.64e-07 59 23 7 258 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
Q6Q477 1.75e-09 65 28 6 202 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
Q2QMX9 2.07e-09 65 29 4 162 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q2QMX9 4.49e-05 51 26 6 222 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q9WV27 2.53e-09 65 24 8 291 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9WV27 6.63e-08 60 36 1 88 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
P11505 3.49e-09 64 26 5 202 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
G5E829 3.65e-09 64 26 5 202 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
Q64541 4.21e-09 64 24 6 237 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q64541 6.4e-08 60 36 1 88 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
D3K0R6 4.61e-09 64 28 6 202 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
P11506 4.65e-09 64 26 5 205 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
Q01814 4.69e-09 64 26 5 205 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
Q9R0K7 4.8e-09 64 26 5 205 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
O81108 5.1e-09 63 27 3 162 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O81108 6.32e-08 60 23 22 573 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
P23634 5.84e-09 63 27 5 202 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
P23220 6.02e-09 63 27 5 205 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
Q13733 6.02e-09 63 32 2 117 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 8.39e-09 63 25 7 240 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
P20020 7.01e-09 63 27 5 205 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
Q64568 8.81e-09 63 26 4 210 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
Q16720 8.82e-09 63 27 5 210 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
O64806 1.02e-08 63 27 3 162 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O64806 3.49e-08 61 24 22 566 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
Q64542 1.1e-08 63 26 4 193 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
P50997 1.16e-08 62 26 3 192 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P50997 5.39e-08 60 23 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P06685 1.26e-08 62 24 6 255 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06685 2.31e-07 58 35 1 88 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
Q8VDN2 1.33e-08 62 24 6 255 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q8VDN2 2.31e-07 58 35 1 88 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
G5EFR6 1.4e-08 62 28 4 190 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
P18907 1.52e-08 62 24 7 285 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 1.02e-07 59 35 1 88 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P05024 1.53e-08 62 23 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P05024 7.4e-07 57 34 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
Q98SH2 1.82e-08 62 26 5 205 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
P35317 2.1e-08 62 33 2 108 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P35317 1.3e-05 53 24 6 241 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
Q9N0Z6 2.15e-08 62 22 4 253 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9N0Z6 1.07e-07 59 35 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
P04074 2.36e-08 62 23 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 1.11e-07 59 35 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
Q08DA1 2.36e-08 62 23 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 1.13e-07 59 35 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P09572 2.64e-08 61 22 5 283 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 1.23e-07 59 35 1 88 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P05023 3.32e-08 61 23 7 285 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P05023 1.01e-07 59 35 1 88 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
Q5RDR3 4.59e-08 60 24 7 268 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RDR3 9.3e-08 60 35 1 88 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
P25489 5.18e-08 60 29 3 131 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 5.6e-06 54 22 3 251 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
Q9YH26 5.77e-08 60 30 4 132 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 6.52e-07 57 23 5 258 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
P05025 8.25e-08 60 35 1 88 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 1.17e-07 59 24 8 256 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P58165 1.35e-07 59 26 5 205 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
P9WPS5 1.43e-07 59 31 4 160 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS4 1.46e-07 59 31 4 160 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q00804 2.89e-07 58 25 5 202 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
Q21286 6.4e-07 57 21 23 560 2 catp-5 Cation-transporting ATPase catp-5 Caenorhabditis elegans
Q5XF90 6.06e-06 54 29 8 229 1 Atp13a4 Probable cation-transporting ATPase 13A4 Mus musculus
O14022 6.69e-06 53 22 5 248 3 cta5 Cation-transporting ATPase 5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4VNC1 9.03e-06 53 29 7 216 1 ATP13A4 Probable cation-transporting ATPase 13A4 Homo sapiens
Q12697 1.73e-05 52 22 10 283 1 YPK9 Vacuolar cation-transporting ATPase YPK9 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9NQ11 5.26e-05 51 25 11 326 1 ATP13A2 Polyamine-transporting ATPase 13A2 Homo sapiens
Q58378 0.000127 48 25 2 135 1 patS Soluble P-type ATPase-like phosphatase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9H7F0 0.000215 48 24 6 220 1 ATP13A3 Polyamine-transporting ATPase 13A3 Homo sapiens
Q5XF89 0.000216 48 23 10 279 1 Atp13a3 Polyamine-transporting ATPase 13A3 Mus musculus
Q95JN5 0.000222 48 24 6 220 2 ATP13A3 Polyamine-transporting ATPase 13A3 Macaca fascicularis
Q95JN5 0.000675 47 29 8 152 2 ATP13A3 Polyamine-transporting ATPase 13A3 Macaca fascicularis
P04129 0.000233 44 37 1 69 1 merP Mercuric transport protein periplasmic component Shigella flexneri
Q52107 0.000318 43 41 1 60 3 merP Mercuric transport protein periplasmic component Acinetobacter calcoaceticus

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_06330
Feature type CDS
Gene copA
Product copper-exporting P-type ATPase CopA
Location 277423 - 280161 (strand: 1)
Length 2739 (nucleotides) / 912 (amino acids)
In genomic island -

Contig

Accession ZDB_215
Length 284267 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_331
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00403 Heavy-metal-associated domain
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2217 Inorganic ion transport and metabolism (P) P Cation-transporting P-type ATPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K17686 P-type Cu+ transporter [EC:7.2.2.8] Platinum drug resistance
MAPK signaling pathway - plant
Mineral absorption
-

Protein Sequence

MANTTILALQGLSCGHCTGSVKKALDARPDVESAVVTLDFAKVTGDADAQSLIKTIEEAGYEAQIADKPGTILQLSGLNCMKCAAKTQSALEAVDGVAAAVVDTKEAKVYGSADAQTLISAVEAAGFQAAVAGENASPKSEPLTPSQTEAAAAEHCDIPATPDNIPAMPVIEEDDDSLSFLLDGMTCASCVSKVHKALLSVDGVENARVNLAERSALVTGHASAEALIAAVEKAGYGAELIQDDAKRRERQQEVAVANMKRFRWQAALALAVGIPVMIWGMIGDNMMLTPANNGIWLTIGIVTLAVMILAGGHFYRSAWQSLKNGSATMDTLVALGTGAAWLYSITVNLWPDMFPPQARHLYYEASAMIIGLINLGHMLEQRARQRSSKALERLLDLTPPTARVVTPEGEKDVPLADVQPGMILRLTTGDRVPVDGEITEGEVWIDEAMLTGEPIPQQKTTGDTVSAGTTVQDGTVLFRAAAVGSKTTLARIIKLVRQAQSSKPEIGQLADKISAVFVPVVVVIALIAGAVWYFFGPAPQITYALVIITTVLIIACPCALGLATPMSIISGVGRAAEFGVLVRDADALQQASTLDTIVFDKTGTLTEGMPQVTEIHTFNGFSDDDVLRLAAALESGSNHPLARAITERAKALTLPSVTQFRTLAGMGISGESEGRTLLLGNHALMQAQNISTAGEADALVQSQAGKGVTPVMLAVDGNIAAILSVRDPLREDSVSALARLHKQGYRLVMLTGDNEVTARAIAKEAGIDEVIAGVLPDGKAAAIEKLQQAGRRVAMVGDGINDAPALARADVGIAMGGGSDIAIETAAITLMRHSLHGVADAVAISKGTLRNMKQNLLGAFIYNTLGIPIAAGVLFPFTGTLLNPVVAGAAMALSSITVVSNANRLLRFKPKD

Flanking regions ( +/- flanking 50bp)

CGTGTGCTGATATGCGGCGTGATGATGCGAAACATGTAAGGAAAAAAAGTATGGCTAATACCACTATTCTCGCGTTACAGGGGCTGTCCTGCGGACATTGCACCGGCAGTGTGAAAAAAGCTCTCGACGCCCGCCCGGATGTTGAATCTGCGGTGGTCACCCTTGATTTCGCCAAAGTAACCGGCGATGCGGATGCACAATCTCTCATCAAAACTATCGAAGAAGCAGGTTATGAAGCTCAGATTGCAGACAAACCCGGTACGATTTTACAGCTTTCCGGGCTGAATTGTATGAAATGTGCAGCGAAAACGCAAAGTGCATTAGAAGCGGTTGACGGTGTTGCGGCTGCGGTCGTTGATACCAAAGAGGCAAAAGTATACGGCAGCGCTGATGCGCAGACCTTAATCAGCGCGGTGGAAGCCGCCGGTTTTCAGGCAGCAGTGGCGGGAGAAAACGCCTCCCCAAAATCTGAACCGCTGACGCCGTCTCAGACTGAGGCTGCGGCAGCGGAGCACTGCGACATTCCGGCCACTCCGGACAATATCCCTGCCATGCCGGTGATTGAGGAGGATGACGACAGTCTCTCCTTCCTGCTCGACGGCATGACCTGTGCAAGCTGTGTCAGCAAAGTACACAAAGCGTTGCTCAGTGTGGACGGTGTGGAAAATGCCCGCGTTAACCTCGCGGAACGCAGTGCACTGGTCACCGGGCACGCCTCTGCAGAGGCGCTGATCGCCGCTGTGGAGAAAGCCGGTTACGGCGCGGAGCTGATTCAGGATGATGCCAAACGCCGTGAGCGCCAGCAGGAAGTGGCTGTCGCCAATATGAAGCGGTTCCGCTGGCAGGCTGCTCTGGCACTGGCGGTCGGTATCCCGGTGATGATCTGGGGAATGATCGGCGACAATATGATGCTGACCCCGGCGAACAACGGGATCTGGCTGACCATCGGGATCGTCACCCTGGCGGTGATGATTCTGGCGGGCGGACATTTCTACCGCAGCGCCTGGCAATCCCTGAAAAACGGCAGTGCAACGATGGATACCCTGGTGGCTCTCGGCACCGGTGCCGCGTGGCTCTATTCCATCACGGTAAACCTCTGGCCGGACATGTTCCCTCCGCAGGCGCGTCACCTCTATTATGAGGCCAGCGCCATGATTATCGGTCTGATAAACCTGGGTCATATGCTGGAGCAGCGTGCCCGCCAGCGTTCGTCAAAAGCACTGGAGCGCCTGCTGGATCTGACTCCGCCGACCGCCCGTGTGGTGACACCGGAAGGTGAGAAAGATGTACCGCTGGCAGATGTGCAGCCGGGGATGATCCTGCGCCTGACCACCGGTGACCGCGTACCGGTCGATGGTGAGATCACCGAAGGCGAAGTGTGGATAGATGAGGCGATGCTGACCGGGGAGCCAATCCCGCAGCAGAAAACCACCGGTGATACCGTTTCTGCCGGGACCACCGTGCAGGACGGCACCGTACTGTTCCGTGCCGCCGCTGTCGGCAGCAAAACCACGCTGGCACGCATCATTAAACTGGTGCGCCAGGCTCAGAGCAGTAAACCGGAAATCGGCCAGCTGGCGGACAAAATCTCAGCCGTCTTTGTGCCGGTTGTGGTGGTTATCGCCCTGATCGCCGGTGCTGTCTGGTACTTCTTCGGCCCGGCACCGCAGATAACCTATGCACTGGTGATTATTACCACGGTACTCATAATCGCTTGTCCGTGTGCACTGGGACTGGCAACGCCGATGTCGATTATTTCCGGGGTCGGACGCGCCGCTGAGTTTGGTGTGCTGGTACGGGATGCGGATGCTTTACAGCAGGCAAGCACTCTCGACACCATTGTTTTCGACAAAACCGGGACCCTGACAGAAGGCATGCCGCAGGTAACGGAAATCCATACCTTTAATGGTTTCAGTGACGATGATGTCCTGCGTCTCGCAGCGGCACTGGAAAGCGGTTCTAATCACCCGCTGGCCCGCGCTATCACTGAACGTGCGAAAGCGCTGACACTGCCGTCTGTTACTCAGTTCCGTACCCTGGCGGGGATGGGGATCAGCGGGGAGTCTGAAGGCCGGACACTCCTGCTGGGTAACCATGCGCTGATGCAGGCACAGAATATCAGCACTGCCGGGGAAGCGGATGCGCTGGTACAATCCCAGGCCGGTAAAGGCGTGACTCCGGTGATGCTGGCAGTTGACGGCAACATCGCGGCGATTCTTTCTGTCCGTGATCCGCTGCGTGAGGACAGTGTCAGTGCGCTGGCGCGTCTGCACAAACAGGGTTACCGTCTGGTGATGCTGACCGGGGACAACGAAGTAACCGCCCGGGCTATCGCCAAAGAAGCCGGGATTGATGAAGTAATCGCCGGTGTGCTGCCGGACGGCAAAGCTGCTGCCATTGAAAAATTACAGCAGGCCGGACGCCGTGTCGCGATGGTCGGTGACGGTATCAATGACGCACCTGCACTGGCACGGGCAGATGTGGGGATCGCCATGGGCGGCGGCAGTGATATCGCTATCGAAACCGCAGCAATCACCCTGATGCGCCACAGCCTGCACGGTGTGGCCGATGCGGTGGCTATTTCGAAAGGGACACTGCGTAATATGAAACAGAACCTGCTGGGTGCCTTTATTTATAACACCCTCGGGATCCCGATCGCCGCCGGGGTGCTGTTCCCGTTCACCGGCACTCTGCTGAATCCGGTAGTGGCAGGGGCGGCCATGGCGCTGTCATCCATTACCGTGGTCAGTAACGCCAACCGGTTGTTACGTTTTAAACCGAAAGATTAATCTCTGACCTGATAAGGGAGCGAATAATTCGCTCCCTTATTTTTTTCCTG