Homologs in group_1781

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12985 FBDBKF_12985 86.0 Morganella morganii S1 ybbJ Membrane protein implicated in regulation of membrane protease activity
EHELCC_06300 EHELCC_06300 86.0 Morganella morganii S2 ybbJ Membrane protein implicated in regulation of membrane protease activity
NLDBIP_06620 NLDBIP_06620 86.0 Morganella morganii S4 ybbJ Membrane protein implicated in regulation of membrane protease activity
LHKJJB_03500 LHKJJB_03500 86.0 Morganella morganii S3 ybbJ Membrane protein implicated in regulation of membrane protease activity
HKOGLL_06975 HKOGLL_06975 86.0 Morganella morganii S5 ybbJ Membrane protein implicated in regulation of membrane protease activity
PMI_RS10700 PMI_RS10700 59.1 Proteus mirabilis HI4320 - NfeD family protein

Distribution of the homologs in the orthogroup group_1781

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1781

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AAS4 1.01e-34 121 49 2 152 3 ybbJ Inner membrane protein YbbJ Shigella flexneri
P0AAS3 1.01e-34 121 49 2 152 1 ybbJ Inner membrane protein YbbJ Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16170
Feature type CDS
Gene -
Product NfeD family protein
Location 37316 - 37768 (strand: 1)
Length 453 (nucleotides) / 150 (amino acids)

Contig

Accession term accessions NZ_VXKB01000006 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1781
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01957 NfeD-like C-terminal, partner-binding

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1585 Posttranslational modification, protein turnover, chaperones (O) O Membrane protein implicated in regulation of membrane protease activity

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07340 inner membrane protein - -

Protein Sequence

MIELIASQAMWFWLCFGGILLILEMLGTGGYLLWSGVAALVVALLVWLVPGLSWEWQGIIFAAMTVVCAVLWRNWQRRRQRPDSTTPNQVNHKLIGLRSHLLTDTEDGFSRIRLADGSWRIHSVTPLPAGTEVEVIAVDGITLTVRAVSR

Flanking regions ( +/- flanking 50bp)

GCTGAAATGTTTAATGTATCAAAAGATAAAAACAGTCAGGGTAAATCTGCATGATTGAACTGATCGCATCGCAGGCAATGTGGTTCTGGCTCTGTTTCGGCGGTATTCTCCTGATCCTGGAGATGCTGGGAACCGGCGGTTACTTGTTGTGGAGCGGTGTGGCTGCGTTAGTTGTCGCGCTGCTGGTCTGGCTGGTGCCGGGTCTGAGCTGGGAGTGGCAGGGTATTATTTTTGCCGCAATGACAGTGGTCTGTGCGGTGCTCTGGCGTAACTGGCAGCGCCGCCGCCAGCGGCCCGACAGCACAACACCAAACCAGGTGAACCATAAGCTTATCGGTCTGCGCTCACATCTGCTGACCGATACTGAAGATGGTTTCAGCCGCATCCGCCTCGCGGACGGCAGCTGGCGTATTCACAGTGTCACCCCGCTTCCTGCCGGTACAGAAGTGGAAGTGATCGCTGTTGATGGCATTACGCTGACCGTCAGAGCCGTCAGCCGGTAACGCAGCAGTATCTTTGTCATATCTGAACGGCCTCTGTGAAAACAGAGGCC