Homologs in group_1159

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06235 FBDBKF_06235 85.2 Morganella morganii S1 rluA bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA
EHELCC_09280 EHELCC_09280 85.2 Morganella morganii S2 rluA bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA
NLDBIP_09660 NLDBIP_09660 85.2 Morganella morganii S4 rluA bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA
LHKJJB_08095 LHKJJB_08095 85.2 Morganella morganii S3 rluA bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA
HKOGLL_07645 HKOGLL_07645 85.2 Morganella morganii S5 rluA bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA
PMI_RS11520 PMI_RS11520 80.1 Proteus mirabilis HI4320 rluA bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA

Distribution of the homologs in the orthogroup group_1159

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1159

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AA38 5.23e-119 340 76 1 217 3 rluA Dual-specificity RNA pseudouridine synthase RluA Shigella flexneri
P0AA37 5.23e-119 340 76 1 217 1 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli (strain K12)
Q8FL93 1.04e-118 339 76 1 217 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XA10 3.15e-117 335 75 1 217 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O157:H7
Q8ZRV9 4.1e-117 335 75 1 217 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZIK1 6.11e-117 334 77 1 204 3 rluA Dual-specificity RNA pseudouridine synthase RluA Yersinia pestis
Q8Z9J5 1.41e-116 333 74 1 217 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhi
P44782 5.41e-95 279 62 1 214 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P59831 7.51e-92 271 59 2 217 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9CK02 1.31e-91 270 62 1 208 3 rluA Dual-specificity RNA pseudouridine synthase RluA Pasteurella multocida (strain Pm70)
Q87LD3 8.02e-84 252 55 1 221 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DCG0 1.06e-83 251 55 1 221 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio vulnificus (strain CMCP6)
Q9KP71 7.31e-80 241 55 0 216 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q82WZ5 1.55e-37 136 41 5 210 3 rluD Ribosomal large subunit pseudouridine synthase D Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8D8G1 6.84e-34 126 38 4 203 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q8XYX8 7.05e-32 121 36 7 221 3 rluD Ribosomal large subunit pseudouridine synthase D Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9KQH0 9.01e-32 120 39 6 199 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87N15 1.71e-31 119 37 4 199 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8ZQ16 1.93e-31 119 40 5 203 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z7J7 2.19e-31 119 40 5 203 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhi
Q9CM51 5.01e-31 119 38 3 204 3 rluC Ribosomal large subunit pseudouridine synthase C Pasteurella multocida (strain Pm70)
Q8X8J3 6.41e-31 118 40 5 203 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O157:H7
Q8FIP7 6.97e-31 118 40 5 203 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA40 7.35e-31 118 40 5 203 3 rluC Ribosomal large subunit pseudouridine synthase C Shigella flexneri
P0AA39 7.35e-31 118 40 5 203 1 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli (strain K12)
Q8ZFU1 2.41e-30 117 38 4 204 3 rluC Ribosomal large subunit pseudouridine synthase C Yersinia pestis
P59838 3.09e-30 116 35 5 217 3 rluD Ribosomal large subunit pseudouridine synthase D Blochmanniella floridana
P33640 2.6e-29 114 37 8 223 3 rluD Ribosomal large subunit pseudouridine synthase D Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P44433 2.79e-29 114 36 4 211 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P74346 6.14e-29 113 34 5 214 3 slr1629 Uncharacterized RNA pseudouridine synthase slr1629 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P59835 6.21e-29 113 37 4 198 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P70870 6.53e-28 110 33 2 205 3 rluD Ribosomal large subunit pseudouridine synthase D Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P59840 6.62e-28 108 37 8 219 3 truC tRNA pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P50513 1.26e-27 109 34 5 228 3 rluD Ribosomal large subunit pseudouridine synthase D Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q87AR7 1.4e-27 109 34 5 227 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9CKA6 1.68e-27 109 35 7 223 3 rluD Ribosomal large subunit pseudouridine synthase D Pasteurella multocida (strain Pm70)
P75485 1.83e-27 109 34 4 219 3 MPN_292 Uncharacterized RNA pseudouridine synthase MG209 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O67638 3.04e-27 108 34 6 226 3 aq_1758 Uncharacterized RNA pseudouridine synthase aq_1758 Aquifex aeolicus (strain VF5)
P57430 4.66e-27 108 30 3 214 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P44445 6.59e-27 107 36 5 212 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9PET9 7.86e-27 107 34 5 227 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain 9a5c)
Q9K0B0 9.79e-27 108 37 5 215 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P47451 1.55e-26 106 32 4 213 3 MG209 Uncharacterized RNA pseudouridine synthase MG209 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9JVB6 1.74e-26 107 37 5 215 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q08C69 1.97e-26 106 33 7 224 2 rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Danio rerio
P65835 2.55e-26 106 35 5 222 3 rluD Ribosomal large subunit pseudouridine synthase D Shigella flexneri
P65834 2.55e-26 106 35 5 222 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X9F0 2.86e-26 106 35 5 222 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O157:H7
Q89AH2 3.54e-26 105 31 3 197 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P33643 3.67e-26 105 35 5 222 1 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli (strain K12)
Q8K9E9 4.05e-26 105 31 6 212 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9KU20 4.15e-26 105 36 6 217 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q47417 4.32e-26 106 35 8 224 3 truC tRNA pseudouridine synthase C Pectobacterium carotovorum subsp. carotovorum
O31613 1.28e-25 103 35 4 198 3 yjbO Uncharacterized RNA pseudouridine synthase YjbO Bacillus subtilis (strain 168)
Q8K9J8 1.46e-25 104 30 3 211 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8ZBV7 3.92e-25 103 34 6 225 3 rluD Ribosomal large subunit pseudouridine synthase D Yersinia pestis
Q8PHN2 5.45e-25 102 34 5 224 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas axonopodis pv. citri (strain 306)
Q45826 5.48e-25 102 34 5 203 3 Caur_0901 Uncharacterized RNA pseudouridine synthase Caur_0901 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q9KTL4 5.95e-25 101 36 9 226 3 truC tRNA pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P54604 6.95e-25 102 31 5 205 3 yhcT Uncharacterized RNA pseudouridine synthase YhcT Bacillus subtilis (strain 168)
Q8P682 7.75e-25 102 34 6 225 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8ZH72 1.17e-24 100 34 8 226 3 truC tRNA pseudouridine synthase C Yersinia pestis
Q9L7A7 1.67e-24 101 34 6 223 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q87S65 1.81e-24 101 35 6 220 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O50310 3.47e-24 100 30 5 237 3 Cpar_0723 Uncharacterized RNA pseudouridine synthase Cpar_0723 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
P57481 4.58e-24 100 31 5 214 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P65836 5.39e-24 100 34 6 217 1 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65837 5.39e-24 100 34 6 217 3 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhi
Q89AD9 5.73e-24 100 30 4 213 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8X6T6 1.09e-23 98 34 7 226 3 truC tRNA pseudouridine synthase C Escherichia coli O157:H7
Q12069 1.15e-23 100 34 5 187 1 PUS9 tRNA pseudouridine(32) synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0AA42 1.2e-23 98 34 7 226 3 truC tRNA pseudouridine synthase C Shigella flexneri
P0AA41 1.2e-23 98 34 7 226 1 truC tRNA pseudouridine synthase C Escherichia coli (strain K12)
Q45480 1.39e-23 98 33 4 209 3 ylyB Uncharacterized RNA pseudouridine synthase YlyB Bacillus subtilis (strain 168)
O66114 1.44e-23 97 34 5 193 3 ZMO0505 Uncharacterized RNA pseudouridine synthase ZMO0505 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1RJX7 2.24e-23 98 30 5 210 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia bellii (strain RML369-C)
Q4UKQ3 2.65e-23 98 30 3 200 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8DBG5 4.3e-23 96 32 6 234 3 truC tRNA pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q92IS6 5.75e-23 97 31 3 195 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8FEF9 6.8e-23 95 32 7 235 3 truC tRNA pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9CNF3 9.28e-23 95 35 9 215 3 truC tRNA pseudouridine synthase C Pasteurella multocida (strain Pm70)
P0A5T3 9.88e-23 96 32 5 220 3 BQ2027_MB1567 Uncharacterized RNA pseudouridine synthase Mb1567 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ3 9.88e-23 96 32 5 220 1 Rv1540 Uncharacterized RNA pseudouridine synthase Rv1540 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ2 9.88e-23 96 32 5 220 3 MT1592 Uncharacterized RNA pseudouridine synthase MT1592 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q87MD4 1.08e-22 95 31 6 222 3 truC tRNA pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DEV0 1.57e-22 96 34 6 220 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio vulnificus (strain CMCP6)
Q8ZMD5 7.81e-22 93 31 5 225 3 truC tRNA pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z439 7.98e-22 93 31 5 225 3 truC tRNA pseudouridine synthase C Salmonella typhi
Q8VCZ8 8.98e-22 94 32 5 214 2 Rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Mus musculus
P43930 8.99e-22 92 32 4 192 3 HI_0042 Uncharacterized RNA pseudouridine synthase HI_0042 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44197 2.78e-21 91 34 8 211 3 truC tRNA pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q17QT4 4.02e-21 92 37 3 153 2 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Bos taurus
Q12362 1.05e-20 93 35 5 182 1 RIB2 Bifunctional protein RIB2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UJJ7 1.44e-20 90 31 5 214 1 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Homo sapiens
P72970 2.67e-20 89 31 6 214 3 slr1592 Uncharacterized RNA pseudouridine synthase slr1592 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q68XB2 4.17e-20 89 29 4 202 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P53294 1.2e-19 89 31 5 189 1 PUS6 tRNA pseudouridine(31) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9ZDR7 3.78e-19 86 29 4 197 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia prowazekii (strain Madrid E)
Q149F1 7.54e-19 87 32 4 177 1 Rpusd2 Pseudouridylate synthase RPUSD2 Mus musculus
Q9ZMA1 7.98e-19 85 29 8 214 3 jhp_0321 Uncharacterized RNA pseudouridine synthase jhp_0321 Helicobacter pylori (strain J99 / ATCC 700824)
Q8IZ73 6.45e-18 84 32 4 177 1 RPUSD2 Pseudouridylate synthase RPUSD2 Homo sapiens
O25114 8.66e-18 83 29 8 211 1 HP_0347 Uncharacterized RNA pseudouridine synthase HP_0347 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZKP5 8.75e-18 82 32 6 189 3 jhp_0890 Uncharacterized RNA pseudouridine synthase jhp_0890 Helicobacter pylori (strain J99 / ATCC 700824)
Q09709 8.95e-18 84 30 5 182 3 SPAC18B11.02c Pseudouridylate synthase C18B11.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HZM9 1.13e-17 82 35 6 198 3 rluC Ribosomal large subunit pseudouridine synthase C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5M721 2.93e-17 82 30 7 210 2 At3g52260 RNA pseudouridine synthase 5 Arabidopsis thaliana
Q9LT72 2.67e-16 80 33 8 210 2 At3g19440 RNA pseudouridine synthase 4, mitochondrial Arabidopsis thaliana
O25610 4.31e-16 77 30 7 189 3 HP_0956 Uncharacterized RNA pseudouridine synthase HP_0956 Helicobacter pylori (strain ATCC 700392 / 26695)
Q28C59 6.59e-15 75 30 6 195 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Xenopus tropicalis
Q9ZL98 1.59e-14 74 26 5 226 3 jhp_0682 Uncharacterized RNA pseudouridine synthase jhp_0682 Helicobacter pylori (strain J99 / ATCC 700824)
Q0DST9 2.3e-14 74 28 6 213 2 Os03g0288500 RNA pseudouridine synthase 5 Oryza sativa subsp. japonica
Q5Z8P2 5.17e-14 73 26 7 278 2 Os06g0717400 RNA pseudouridine synthase 2, chloroplastic Oryza sativa subsp. japonica
Q4QQT0 8.05e-14 72 31 7 195 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Rattus norvegicus
O25441 1.59e-13 71 26 6 226 3 HP_0745 Uncharacterized RNA pseudouridine synthase HP_0745 Helicobacter pylori (strain ATCC 700392 / 26695)
Q96CM3 2.13e-13 71 29 10 248 1 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Homo sapiens
P47610 2.38e-13 70 26 9 220 3 MG370 Uncharacterized RNA pseudouridine synthase MG370 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5XET6 9.83e-13 69 33 8 195 2 At1g78910 RNA pseudouridine synthase 3, mitochondrial Arabidopsis thaliana
Q3ECD0 9.97e-13 69 25 8 270 2 At1g76050 RNA pseudouridine synthase 2, chloroplastic Arabidopsis thaliana
Q5E9Z1 3.92e-12 67 31 7 193 2 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Bos taurus
Q9LU60 4.44e-12 67 29 4 179 2 At5g51140 RNA pseudouridine synthase 7 Arabidopsis thaliana
O16686 1.14e-11 66 27 3 183 3 K07E8.7 Uncharacterized protein K07E8.7 Caenorhabditis elegans
Q6DBR0 1.26e-11 66 28 5 195 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Danio rerio
Q0J4D4 2.13e-11 65 30 9 203 2 Os08g0520100 RNA pseudouridine synthase 3, mitochondrial Oryza sativa subsp. japonica
Q9CWX4 5.07e-11 64 31 6 193 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Mus musculus
Q2QNM3 3.56e-10 62 26 9 260 2 Os12g0560500 RNA pseudouridine synthase 1 Oryza sativa subsp. japonica
Q0E0Y3 2.02e-09 60 27 5 180 2 Os02g0512300 RNA pseudouridine synthase 7 Oryza sativa subsp. japonica
P45614 3.11e-09 58 23 11 231 3 MCAP_0714 Uncharacterized RNA pseudouridine synthase MCAP_0714 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P75230 3.56e-08 56 26 8 219 3 MPN_548 Uncharacterized RNA pseudouridine synthase MG370 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q06244 4.45e-08 55 26 5 182 1 PUS5 21S rRNA pseudouridine(2819) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FS81 5.14e-08 55 24 6 194 3 PUS5 21S rRNA pseudouridine(2819) synthase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q69K07 3e-07 53 28 5 176 2 Os09g0103500 RNA pseudouridine synthase 4, mitochondrial Oryza sativa subsp. japonica
O67444 3.31e-07 52 27 6 160 3 aq_1464 Uncharacterized RNA pseudouridine synthase aq_1464 Aquifex aeolicus (strain VF5)
Q14AI6 1.7e-05 48 27 5 190 2 Rpusd3 Mitochondrial mRNA pseudouridine synthase Rpusd3 Mus musculus
Q7XA65 2.64e-05 47 31 2 92 2 At1g56345 RNA pseudouridine synthase 1 Arabidopsis thaliana
Q8I3Z1 3.67e-05 47 32 1 74 1 PFE0570w MATH and LRR domain-containing protein PFE0570w Plasmodium falciparum (isolate 3D7)
Q5A0Y2 0.000164 45 25 11 213 3 PUS5 21S rRNA pseudouridine(2819) synthase Candida albicans (strain SC5314 / ATCC MYA-2876)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15680
Feature type CDS
Gene rluA
Product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA
Location 133657 - 134307 (strand: -1)
Length 651 (nucleotides) / 216 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000005
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1159
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0564 Translation, ribosomal structure and biogenesis (J) J Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06177 tRNA pseudouridine32 synthase / 23S rRNA pseudouridine746 synthase [EC:5.4.99.28 5.4.99.29] - -

Protein Sequence

MEPYNPPTDPRLDILFQDEHIIVVNKPSGLLSVPGRAPEHKDSVMTRVLRDYPQAESVHRLDMATSGIIVVALTKAAERELKRQFREREPKKTYLARVWGKIEEKTGIVDLPLICDWPNRPKQKVCFETGKSAQTGYEVLEYEPHATRVKLSPVTGRSHQLRVHMLAIGHPILGDRFYAHDEARESAPRLQLHAQALSITHPAHGTPLNFICEADF

Flanking regions ( +/- flanking 50bp)

CCCGGCAGAAACAGACTGCCGGGCGCCTCTCATCTGGTGACCCCATGTTAATGGAACCCTATAATCCGCCAACTGATCCCCGGCTGGATATTCTCTTTCAGGATGAGCACATCATCGTGGTGAATAAACCGAGCGGGCTGCTTTCCGTGCCCGGTCGTGCGCCGGAACATAAAGACAGTGTGATGACCCGTGTTCTGCGGGATTATCCACAGGCAGAATCTGTTCACCGGCTGGATATGGCGACCAGCGGTATTATTGTGGTTGCCTTAACCAAGGCCGCCGAACGGGAGCTTAAACGGCAATTCCGTGAGCGTGAGCCGAAGAAAACCTATCTCGCCCGCGTGTGGGGGAAAATAGAGGAAAAAACGGGAATAGTGGATTTACCCCTGATTTGTGACTGGCCGAACCGCCCGAAACAAAAGGTGTGTTTTGAAACCGGAAAATCAGCGCAGACCGGCTATGAAGTGCTGGAATATGAACCGCACGCAACCAGGGTGAAACTGTCCCCGGTAACCGGACGCTCACATCAGTTACGGGTTCATATGCTGGCAATCGGACACCCTATACTGGGTGATCGCTTCTATGCGCATGATGAAGCAAGAGAGTCAGCGCCCCGCCTGCAATTACATGCGCAGGCGCTGTCAATCACGCATCCGGCGCACGGAACGCCGCTGAATTTTATCTGTGAAGCTGATTTTTAATGAAATAACACGGTCACCGAATTCAGTGAGGCAAGAATCAGGCAAACTGC