Homologs in group_1691

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11790 FBDBKF_11790 92.6 Morganella morganii S1 kefB glutathione-regulated potassium-efflux system protein KefB
EHELCC_14515 EHELCC_14515 92.6 Morganella morganii S2 kefB glutathione-regulated potassium-efflux system protein KefB
NLDBIP_15610 NLDBIP_15610 92.6 Morganella morganii S4 kefB glutathione-regulated potassium-efflux system protein KefB
LHKJJB_15000 LHKJJB_15000 92.6 Morganella morganii S3 kefB glutathione-regulated potassium-efflux system protein KefB
HKOGLL_19285 HKOGLL_19285 92.6 Morganella morganii S5 kefB glutathione-regulated potassium-efflux system protein KefB
PMI_RS13855 PMI_RS13855 72.9 Proteus mirabilis HI4320 kefB glutathione-regulated potassium-efflux system protein KefB

Distribution of the homologs in the orthogroup group_1691

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1691

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JIU4 0.0 851 71 2 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664Q5 0.0 851 71 2 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGX5 0.0 851 71 2 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis (strain Pestoides F)
Q1CCS7 0.0 851 71 2 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R473 0.0 851 71 2 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJC4 0.0 851 71 2 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis
Q1C2S9 0.0 851 71 2 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Antiqua)
B2VK47 0.0 845 69 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8AQP0 0.0 835 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5XN76 0.0 832 70 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae (strain 342)
A6TEY9 0.0 825 69 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q6CZU5 0.0 821 69 2 603 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4WFE4 0.0 816 69 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Enterobacter sp. (strain 638)
B4TXF9 0.0 812 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella schwarzengrund (strain CVM19633)
B5R2A8 0.0 812 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella enteritidis PT4 (strain P125109)
B5FJN1 0.0 812 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella dublin (strain CT_02021853)
Q8ZLL3 0.0 811 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MT17 0.0 811 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F8G9 0.0 811 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella agona (strain SL483)
Q8Z1Y7 0.0 811 67 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhi
B4SUV7 0.0 810 67 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella newport (strain SL254)
C0Q0D3 0.0 809 67 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi C (strain RKS4594)
Q57J15 0.0 809 67 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella choleraesuis (strain SC-B67)
B5BH03 0.0 808 67 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain AKU_12601)
Q5PL21 0.0 808 67 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TKN2 0.0 808 67 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella heidelberg (strain SL476)
B7N1D2 0.0 806 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O81 (strain ED1a)
A7ME23 0.0 802 69 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Cronobacter sakazakii (strain ATCC BAA-894)
B1IPB4 0.0 800 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q3YWS1 0.0 800 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella sonnei (strain Ss046)
B7LS57 0.0 800 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I2Q9 0.0 800 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SE11)
A8A5F8 0.0 800 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O9:H4 (strain HS)
B7L4M7 0.0 800 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain 55989 / EAEC)
Q1R5T2 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain UTI89 / UPEC)
P45522 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12)
Q8FCY0 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AGN6 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O1:K1 / APEC
B1X6K0 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / DH10B)
C4ZUK6 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / MC4100 / BW2952)
B7MCW6 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O45:K1 (strain S88 / ExPEC)
B2U3F5 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7M1Q2 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O8 (strain IAI1)
A7ZSM6 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UK61 0.0 798 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A9MN27 0.0 797 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B1LHF1 0.0 794 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SMS-3-5 / SECEC)
B7NDV9 0.0 790 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8X878 0.0 789 69 3 592 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O157:H7
C6DG97 0.0 788 69 2 603 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q31VU0 0.0 781 68 4 604 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 4 (strain Sb227)
Q83PY0 0.0 736 67 4 571 5 kefB Putative glutathione-regulated potassium-efflux system protein KefB Shigella flexneri
B5Y1Z8 3.54e-156 465 41 8 620 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae (strain 342)
A6T4I3 2.18e-155 463 41 9 627 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4W6F3 3.01e-155 462 41 8 622 3 kefC Glutathione-regulated potassium-efflux system protein KefC Enterobacter sp. (strain 638)
P03819 8.25e-155 461 40 6 618 1 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12)
B1IRC9 8.25e-155 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XC48 8.25e-155 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / DH10B)
C4ZPX3 8.25e-155 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / MC4100 / BW2952)
B7N7S2 1.08e-154 461 40 7 619 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q326I6 1.53e-154 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 4 (strain Sb227)
B2U255 1.53e-154 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6HZ28 1.53e-154 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SE11)
A7ZVZ9 1.53e-154 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O9:H4 (strain HS)
B7M0E4 1.53e-154 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O8 (strain IAI1)
B1LFY1 1.61e-154 461 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SMS-3-5 / SECEC)
Q83SQ3 2.51e-154 460 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri
Q0TLU2 3.02e-154 460 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7L4H0 3.08e-154 460 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain 55989 / EAEC)
A7ZHE0 3.08e-154 460 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MNQ4 3.59e-154 460 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O81 (strain ED1a)
B7NHF1 3.59e-154 460 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UI93 3.59e-154 460 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LVT8 4e-154 460 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5YZ83 5.41e-154 459 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA20 5.41e-154 459 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7
Q3Z5W2 7.25e-154 459 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella sonnei (strain Ss046)
A9MQG6 1.29e-153 458 41 7 619 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8FLA1 1.3e-153 458 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RGF1 1.88e-153 458 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain UTI89 / UPEC)
B7MAH0 1.88e-153 458 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O45:K1 (strain S88 / ExPEC)
A8ALQ4 2.02e-153 458 41 7 610 3 kefC Glutathione-regulated potassium-efflux system protein KefC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MYL9 8.71e-153 456 40 7 619 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F767 4.13e-152 454 40 7 619 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella agona (strain SL483)
B4TJ42 4.51e-152 454 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella heidelberg (strain SL476)
B5BL23 5.9e-152 454 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain AKU_12601)
C0Q4N0 5.9e-152 454 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi C (strain RKS4594)
Q5PIL3 5.9e-152 454 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6L2 5.9e-152 454 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella newport (strain SL254)
B5R1S4 5.9e-152 454 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella enteritidis PT4 (strain P125109)
B5FI29 5.9e-152 454 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella dublin (strain CT_02021853)
B4TWT1 8.71e-152 454 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella schwarzengrund (strain CVM19633)
Q8ZRW2 2.18e-151 452 40 7 619 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57TH4 2.89e-151 452 41 7 606 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella choleraesuis (strain SC-B67)
Q0T8E8 7.57e-151 451 40 6 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri serotype 5b (strain 8401)
Q8Z9K0 1.23e-150 451 40 7 619 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhi
A7MIA0 2.08e-144 435 40 8 615 3 kefC Glutathione-regulated potassium-efflux system protein KefC Cronobacter sakazakii (strain ATCC BAA-894)
Q9X756 3.72e-138 419 41 8 580 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella aerogenes
P44933 8.72e-125 384 37 8 559 3 kefBC Glutathione-regulated potassium-efflux system protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZTZ7 1.97e-78 273 36 9 533 1 KEA1 K(+) efflux antiporter 1, chloroplastic Arabidopsis thaliana
O65272 1.01e-77 271 36 8 527 1 KEA2 K(+) efflux antiporter 2, chloroplastic Arabidopsis thaliana
Q9M0Z3 3.47e-75 258 33 16 601 1 KEA3 K(+) efflux antiporter 3, chloroplastic Arabidopsis thaliana
Q0ZAH7 2.65e-66 232 32 13 579 3 kefB Putative K(+) efflux antiporter KefB Alkalimonas amylolytica
P39830 2.54e-46 175 28 8 533 1 ybaL Putative cation/proton antiporter YbaL Escherichia coli (strain K12)
Q8VYR9 2.46e-39 155 34 10 355 1 KEA5 K(+) efflux antiporter 5 Arabidopsis thaliana
B5X0N6 6.61e-35 143 32 6 356 1 KEA6 K(+) efflux antiporter 6 Arabidopsis thaliana
Q9ZUN3 1.05e-30 130 29 6 372 1 KEA4 K(+) efflux antiporter 4 Arabidopsis thaliana
Q2W031 7.16e-27 117 29 9 351 1 magA Iron transporter MagA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B3VQ24 3.37e-24 108 26 9 361 3 gerT Probable Na(+)/H(+) antiporter GerT Bacillus cereus
Q9KI10 5.27e-24 107 27 7 358 1 gerN Na(+)/H(+)-K(+) antiporter GerN Bacillus cereus
P52071 7.29e-24 105 33 6 253 3 None Uncharacterized protein in phaC 3'region (Fragment) Methylorubrum extorquens
P26235 3.19e-17 87 27 12 375 1 napA Na(+)/H(+) antiporter Enterococcus hirae
Q6UWJ1 3.78e-16 85 27 13 379 1 TMCO3 Transmembrane and coiled-coil domain-containing protein 3 Homo sapiens
Q8BH01 4.75e-16 85 26 11 377 2 Tmco3 Transmembrane and coiled-coil domain-containing protein 3 Mus musculus
Q9SUQ7 1.2e-13 77 23 15 384 1 CHX17 Cation/H(+) antiporter 17 Arabidopsis thaliana
O31615 1.4e-13 77 27 7 283 3 cpaA Putative Na(+)/H(+) antiporter YjbQ Bacillus subtilis (strain 168)
D3FSJ3 2.46e-12 72 29 12 339 1 amhT Ammonium/H(+) antiporter subunit AmhT Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q55736 3.12e-09 63 26 11 267 3 nhaS5 Na(+)/H(+) antiporter NhaS5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P72973 3.74e-08 59 28 8 245 3 nhaS4 Na(+)/H(+) antiporter NhaS4 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O07536 7.98e-07 55 23 8 260 1 khtU K(+)/H(+) antiporter subunit KhtU Bacillus subtilis (strain 168)
Q59027 3.81e-06 53 31 1 99 4 MJ1633 Uncharacterized protein MJ1633 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P56509 7.36e-06 52 29 1 135 4 Mfer_0534 Uncharacterized protein Mfer_0534 Methanothermus fervidus (strain ATCC 43054 / DSM 2088 / JCM 10308 / V24 S)
P40309 1.87e-05 51 23 17 405 1 KHA1 K(+)/H(+) antiporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q55190 2.07e-05 51 26 11 354 1 nhaS3 High-affinity Na(+)/H(+) antiporter NhaS3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q58671 9.9e-05 48 26 11 297 3 MJ1275 Probable Na(+)/H(+) antiporter 3 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9FFR9 0.000153 48 22 15 389 2 CHX18 Cation/H(+) antiporter 18 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14865
Feature type CDS
Gene kefB
Product glutathione-regulated potassium-efflux system protein KefB
Location 208494 - 210332 (strand: 1)
Length 1839 (nucleotides) / 612 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1691
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00999 Sodium/hydrogen exchanger family
PF02254 TrkA-N domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0475 Inorganic ion transport and metabolism (P) P Kef-type K+ transport system, membrane component KefB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11747 glutathione-regulated potassium-efflux system protein KefB - -

Protein Sequence

MDDGNLLHAGIIFLAAAVIMVPVAQRLRIGAVLGYLLAGIAIGPWGLGFIKNVNELLHFSELGVVFLMFLIGLELNPRELWKLRRSIFGTGTAQVVFSALILGILLYLTDFSWQAAVVGGLGMAMSSTAMALQLMDEKGMTNNESGQLGFSVLLFQDMAVIPILAVIPLLGGEAAGSDWYRIGIKILAFAGLLVGGRYLLRPLFRLVVKSGVSEVFTAASLLVVIGSAVFMEQLGFSMALGTFIAGVMLADTEYRHELEITIEPFKGLLLGMFFISVGMSLNIGVLWQYLPQILLGVIVLVSVKMLVLYVLARLSCRRSGRLQFAGVLSQGGEFAFVLFSAALASRVITDNQMALLLVVVTLSMMTTPLLMQGIDMILARRYNAGAGTDETPFVEDNHPHVILVGFGRMGQVVGRLLMANKIHPTVLEKDVSAVSSMRRYGYKVYYGDATELALLRSAGAENAKIIVLTCDKPEDTMTIVQLCQEHFPHLQIIARARGRVEAHELLQHGVTQFSRETFSSALELARKALTGLGVHPAEAYRAQQLFRRLDMQLLRELIPQAEEEIAHVSRVKEARRELENLFSNEMKREQGQPDGWNSIDDSPGKTRIDDRS

Flanking regions ( +/- flanking 50bp)

GTGTGACTGGCTTCGCACCCCGCAACTGACAGGAGGGCGCACGGATGACAATGGATGACGGTAACTTACTGCATGCGGGGATTATTTTTCTGGCGGCGGCGGTCATTATGGTACCGGTGGCACAACGGCTGCGTATCGGTGCTGTCCTGGGGTATTTGCTGGCGGGGATCGCTATCGGTCCGTGGGGGCTGGGCTTTATTAAAAACGTCAATGAACTGCTGCACTTCTCAGAACTGGGTGTGGTTTTCCTGATGTTTCTTATCGGGCTGGAATTGAACCCGCGTGAATTGTGGAAACTGCGGCGCTCTATTTTTGGCACCGGGACGGCGCAGGTTGTTTTCTCCGCGCTGATCCTGGGTATTTTGCTGTATCTGACCGATTTTTCCTGGCAGGCGGCAGTCGTCGGCGGTCTGGGAATGGCGATGTCTTCCACTGCGATGGCATTACAGCTGATGGATGAAAAAGGCATGACCAACAATGAAAGTGGTCAGCTGGGTTTCTCTGTCTTGTTGTTTCAGGATATGGCGGTGATCCCTATTCTTGCCGTTATTCCGCTGCTGGGCGGGGAAGCGGCTGGCAGTGACTGGTATCGCATCGGTATAAAAATTCTGGCTTTCGCCGGGTTGTTGGTCGGCGGGCGGTATCTGCTGCGTCCGTTGTTCCGGCTGGTGGTGAAATCCGGTGTCAGTGAAGTGTTTACCGCCGCGTCATTGCTGGTGGTTATCGGGTCGGCGGTGTTTATGGAGCAGCTCGGGTTTTCCATGGCGCTGGGTACATTTATCGCAGGGGTGATGCTGGCGGATACAGAATACCGGCATGAGCTGGAAATCACCATTGAGCCGTTTAAAGGTCTGTTGCTGGGGATGTTTTTTATCTCTGTCGGCATGTCGCTGAATATCGGCGTGTTGTGGCAGTATCTCCCGCAAATTTTACTGGGTGTGATTGTGCTGGTGAGTGTCAAAATGCTGGTTTTGTATGTGCTGGCGCGCCTCAGTTGCCGCCGGAGCGGGCGTCTGCAATTTGCCGGGGTGCTGAGCCAGGGCGGGGAATTCGCCTTTGTGCTCTTTTCTGCGGCACTGGCGAGCCGCGTGATTACCGATAACCAGATGGCACTGCTACTGGTGGTGGTCACGCTTTCCATGATGACCACGCCGTTACTGATGCAGGGAATCGATATGATCCTGGCGCGTCGTTACAATGCGGGCGCGGGCACAGACGAAACGCCGTTTGTGGAGGATAATCATCCGCATGTGATTCTGGTCGGTTTCGGACGGATGGGGCAGGTTGTCGGTCGCCTGCTGATGGCAAATAAAATCCACCCGACCGTGCTGGAAAAGGATGTCAGCGCGGTCAGTTCTATGCGCCGCTATGGCTATAAAGTGTATTACGGTGATGCCACTGAACTGGCGCTGTTGCGCTCTGCCGGCGCAGAAAACGCAAAAATTATTGTACTTACCTGTGATAAACCGGAAGACACGATGACGATTGTGCAACTGTGTCAGGAACATTTCCCGCATCTGCAAATTATTGCGCGAGCCAGGGGACGGGTCGAGGCGCATGAGCTGTTGCAGCATGGTGTGACGCAGTTCAGCCGTGAGACATTTTCTTCGGCACTGGAGCTGGCACGCAAAGCCCTGACTGGGTTGGGAGTCCATCCGGCAGAAGCTTACCGGGCGCAGCAGTTATTCCGCCGCCTGGATATGCAGTTGCTGCGTGAGCTTATCCCGCAGGCAGAAGAAGAAATCGCGCATGTTTCCCGTGTGAAAGAAGCCCGCCGGGAGCTGGAAAATTTGTTCAGCAATGAAATGAAGCGGGAACAAGGTCAGCCGGATGGCTGGAACAGTATTGACGATTCTCCGGGTAAAACGCGGATTGATGACAGGAGCTGAGTGTGAAAAATCGTAAACGGTTTATTGCGGGGGCAGTATGCCCTGAGTGT