Homologs in group_1691

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11790 FBDBKF_11790 72.9 Morganella morganii S1 kefB glutathione-regulated potassium-efflux system protein KefB
EHELCC_14515 EHELCC_14515 72.9 Morganella morganii S2 kefB glutathione-regulated potassium-efflux system protein KefB
NLDBIP_15610 NLDBIP_15610 72.9 Morganella morganii S4 kefB glutathione-regulated potassium-efflux system protein KefB
LHKJJB_15000 LHKJJB_15000 72.9 Morganella morganii S3 kefB glutathione-regulated potassium-efflux system protein KefB
HKOGLL_19285 HKOGLL_19285 72.9 Morganella morganii S5 kefB glutathione-regulated potassium-efflux system protein KefB
F4V73_RS14865 F4V73_RS14865 72.9 Morganella psychrotolerans kefB glutathione-regulated potassium-efflux system protein KefB

Distribution of the homologs in the orthogroup group_1691

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1691

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JIU4 0.0 863 73 3 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664Q5 0.0 863 73 3 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGX5 0.0 863 73 3 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis (strain Pestoides F)
Q1CCS7 0.0 863 73 3 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R473 0.0 863 73 3 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJC4 0.0 863 73 3 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis
Q1C2S9 0.0 863 73 3 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Antiqua)
B2VK47 0.0 825 67 4 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8AQP0 0.0 810 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6CZU5 0.0 807 68 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5R2A8 0.0 797 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella enteritidis PT4 (strain P125109)
Q8ZLL3 0.0 797 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MT17 0.0 797 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TKN2 0.0 797 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella heidelberg (strain SL476)
B5F8G9 0.0 797 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella agona (strain SL483)
Q8Z1Y7 0.0 796 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhi
B4TXF9 0.0 796 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella schwarzengrund (strain CVM19633)
B4SUV7 0.0 796 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella newport (strain SL254)
B5FJN1 0.0 796 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella dublin (strain CT_02021853)
B5BH03 0.0 796 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain AKU_12601)
Q5PL21 0.0 796 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0Q0D3 0.0 794 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi C (strain RKS4594)
Q57J15 0.0 794 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella choleraesuis (strain SC-B67)
A7ME23 0.0 793 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Cronobacter sakazakii (strain ATCC BAA-894)
B5XN76 0.0 791 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae (strain 342)
A4WFE4 0.0 791 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Enterobacter sp. (strain 638)
A9MN27 0.0 787 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7N1D2 0.0 785 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O81 (strain ED1a)
A6TEY9 0.0 785 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q1R5T2 0.0 777 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain UTI89 / UPEC)
Q8FCY0 0.0 777 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AGN6 0.0 777 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O1:K1 / APEC
B7MCW6 0.0 777 67 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O45:K1 (strain S88 / ExPEC)
C6DG97 0.0 776 67 3 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q3YWS1 0.0 776 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella sonnei (strain Ss046)
B7LS57 0.0 776 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I2Q9 0.0 776 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SE11)
B1IPB4 0.0 776 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A5F8 0.0 776 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O9:H4 (strain HS)
B7L4M7 0.0 776 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain 55989 / EAEC)
P45522 0.0 775 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12)
B1X6K0 0.0 775 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / DH10B)
C4ZUK6 0.0 775 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / MC4100 / BW2952)
B2U3F5 0.0 775 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7M1Q2 0.0 775 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O8 (strain IAI1)
A7ZSM6 0.0 775 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UK61 0.0 774 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LHF1 0.0 773 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SMS-3-5 / SECEC)
B7NDV9 0.0 768 66 4 601 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8X878 0.0 765 66 4 594 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O157:H7
Q31VU0 0.0 758 66 5 603 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 4 (strain Sb227)
Q83PY0 0.0 716 65 5 570 5 kefB Putative glutathione-regulated potassium-efflux system protein KefB Shigella flexneri
A8ALQ4 6.82e-161 477 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3Z5W2 2.58e-160 476 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella sonnei (strain Ss046)
P03819 3.85e-160 475 43 5 595 1 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12)
B1IRC9 3.85e-160 475 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XC48 3.85e-160 475 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / DH10B)
C4ZPX3 3.85e-160 475 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / MC4100 / BW2952)
B7N7S2 5.88e-160 475 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TLU2 9.36e-160 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q326I6 9.67e-160 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 4 (strain Sb227)
B2U255 9.67e-160 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6HZ28 9.67e-160 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SE11)
A7ZVZ9 9.67e-160 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O9:H4 (strain HS)
B7M0E4 9.67e-160 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O8 (strain IAI1)
B1LFY1 1.05e-159 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SMS-3-5 / SECEC)
Q8FLA1 1.47e-159 474 43 6 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83SQ3 1.85e-159 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri
B7L4H0 1.85e-159 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain 55989 / EAEC)
A7ZHE0 1.85e-159 474 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MNQ4 2.32e-159 473 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O81 (strain ED1a)
B7NHF1 2.32e-159 473 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UI93 2.32e-159 473 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1RGF1 2.73e-159 473 43 6 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain UTI89 / UPEC)
B7MAH0 2.73e-159 473 43 6 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O45:K1 (strain S88 / ExPEC)
B5YZ83 5.18e-159 473 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA20 5.18e-159 473 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7
B7LVT8 6.5e-159 472 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A9MQG6 2.77e-157 468 43 8 631 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TJ42 1.16e-156 466 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella heidelberg (strain SL476)
B5Y1Z8 1.39e-156 466 43 7 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae (strain 342)
B4TWT1 2.87e-156 466 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella schwarzengrund (strain CVM19633)
Q0T8E8 4.24e-156 465 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri serotype 5b (strain 8401)
A6T4I3 5.92e-156 465 43 7 618 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9MYL9 1.84e-155 463 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BL23 3e-155 463 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain AKU_12601)
C0Q4N0 3e-155 463 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi C (strain RKS4594)
Q5PIL3 3e-155 463 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6L2 3e-155 463 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella newport (strain SL254)
B5R1S4 3e-155 463 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella enteritidis PT4 (strain P125109)
B5FI29 3e-155 463 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella dublin (strain CT_02021853)
A7MIA0 3.06e-155 463 43 6 590 3 kefC Glutathione-regulated potassium-efflux system protein KefC Cronobacter sakazakii (strain ATCC BAA-894)
A4W6F3 3.52e-155 462 42 7 624 3 kefC Glutathione-regulated potassium-efflux system protein KefC Enterobacter sp. (strain 638)
B5F767 4.67e-155 462 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella agona (strain SL483)
Q57TH4 1.39e-154 461 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella choleraesuis (strain SC-B67)
Q8Z9K0 3.38e-154 460 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhi
Q8ZRW2 4.57e-154 460 43 5 595 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9X756 1.38e-140 425 43 9 602 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella aerogenes
P44933 3.57e-132 404 37 9 616 3 kefBC Glutathione-regulated potassium-efflux system protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZTZ7 3.75e-79 275 35 8 530 1 KEA1 K(+) efflux antiporter 1, chloroplastic Arabidopsis thaliana
Q9M0Z3 1.78e-78 267 32 7 577 1 KEA3 K(+) efflux antiporter 3, chloroplastic Arabidopsis thaliana
O65272 6.03e-76 266 35 8 525 1 KEA2 K(+) efflux antiporter 2, chloroplastic Arabidopsis thaliana
Q0ZAH7 1.06e-69 241 31 8 575 3 kefB Putative K(+) efflux antiporter KefB Alkalimonas amylolytica
P39830 1.91e-45 172 28 9 543 1 ybaL Putative cation/proton antiporter YbaL Escherichia coli (strain K12)
Q8VYR9 2.49e-35 144 30 9 361 1 KEA5 K(+) efflux antiporter 5 Arabidopsis thaliana
B5X0N6 1.39e-32 136 30 6 357 1 KEA6 K(+) efflux antiporter 6 Arabidopsis thaliana
Q9ZUN3 1.46e-29 127 29 5 357 1 KEA4 K(+) efflux antiporter 4 Arabidopsis thaliana
Q2W031 4.08e-28 120 28 6 353 1 magA Iron transporter MagA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B3VQ24 9.8e-27 115 29 9 357 3 gerT Probable Na(+)/H(+) antiporter GerT Bacillus cereus
Q9KI10 2.65e-25 111 28 9 372 1 gerN Na(+)/H(+)-K(+) antiporter GerN Bacillus cereus
P52071 2.76e-21 97 30 5 275 3 None Uncharacterized protein in phaC 3'region (Fragment) Methylorubrum extorquens
Q6UWJ1 4.98e-18 91 28 12 371 1 TMCO3 Transmembrane and coiled-coil domain-containing protein 3 Homo sapiens
Q8BH01 2.23e-17 89 27 12 369 2 Tmco3 Transmembrane and coiled-coil domain-containing protein 3 Mus musculus
Q9SUQ7 1.15e-15 84 23 17 413 1 CHX17 Cation/H(+) antiporter 17 Arabidopsis thaliana
O31615 4.34e-14 79 30 7 283 3 cpaA Putative Na(+)/H(+) antiporter YjbQ Bacillus subtilis (strain 168)
Q55736 5.74e-13 75 27 10 302 3 nhaS5 Na(+)/H(+) antiporter NhaS5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
D3FSJ3 9.44e-13 73 26 14 384 1 amhT Ammonium/H(+) antiporter subunit AmhT Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P26235 3.15e-12 72 24 6 369 1 napA Na(+)/H(+) antiporter Enterococcus hirae
P72973 4.52e-09 62 28 10 246 3 nhaS4 Na(+)/H(+) antiporter NhaS4 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55190 7.54e-08 58 26 10 359 1 nhaS3 High-affinity Na(+)/H(+) antiporter NhaS3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9FFR9 6.44e-07 56 23 8 267 2 CHX18 Cation/H(+) antiporter 18 Arabidopsis thaliana
P56509 1.1e-06 55 29 3 171 4 Mfer_0534 Uncharacterized protein Mfer_0534 Methanothermus fervidus (strain ATCC 43054 / DSM 2088 / JCM 10308 / V24 S)
Q9P7I1 1.13e-06 55 22 15 405 3 kha1 K(+)/H(+) antiporter 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LUN4 3.19e-06 54 24 12 379 2 CHX19 Cation/H(+) antiporter 19 Arabidopsis thaliana
O07536 4.01e-06 53 23 5 274 1 khtU K(+)/H(+) antiporter subunit KhtU Bacillus subtilis (strain 168)
Q59027 4.95e-06 53 31 1 99 4 MJ1633 Uncharacterized protein MJ1633 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1HDT3 1.43e-05 52 22 9 291 2 CHX16 Cation/H(+) antiporter 16 Arabidopsis thaliana
Q9SIT5 8.17e-05 49 23 14 383 2 CHX15 Cation/H(+) antiporter 15 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13855
Feature type CDS
Gene kefB
Product glutathione-regulated potassium-efflux system protein KefB
Location 3076116 - 3077978 (strand: -1)
Length 1863 (nucleotides) / 620 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1691
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00999 Sodium/hydrogen exchanger family
PF02254 TrkA-N domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0475 Inorganic ion transport and metabolism (P) P Kef-type K+ transport system, membrane component KefB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11747 glutathione-regulated potassium-efflux system protein KefB - -

Protein Sequence

MEGNWMIKAVLFFLCAAVIMVPIAQRLKIGAVLGYLIAGIAIGPWGLGLFKDVDYILHFSELGVVFLMFLIGLELNPAKLWELRRAIFGVGAMQVVFTASVITGLLLLLTSFSWQAALIGGLGIAMSSTAMALQLMNEKGMNHNEGGQLGFAVLLFQDMAVIPILAVIPLLAGETASSDWYRIALKIVSFAALLICGRYLLRPLFRLIVKSGVREVFTAGALLVVLGSALFMEMIGFSMAMGTFIAGVLLADSEYRHELEISIEPFKGLLLGLFFISVGMSLDIGILWHYLPQVLLGVVILVLIKGLVLYGIAWLARLRFSTRLQFSAVLSQGGEFAFVVFSTSMAMGVLNSEQMALLLVVVTLSMMTTPLVMQMTDAVLSRRYNDAKIDEEPFVENNHPEVILVGFGRMGQVVGRLLMANKVNVTVLEHDVGSLSTMRKYGYKVYYGDATDLNLLRAAGAEHAKAIVITSNEPEATMEIVHLCQRHFPQLQIIARARGRVEAHELLKAGVTEFSRETFSSALELGRKTLIELGMHPHQAYRAQQHFRRLDMQLLRKLVDESPEEVSNVSRVKEARRELEELFNEEMRQEHHQPDIWDESLTDAIPQVNREKRPIDKQEN

Flanking regions ( +/- flanking 50bp)

TGATGCTTATCGCCAATGGTTACAAGCACCGTTAGAGGGGGAACACGCGGATGGAAGGTAATTGGATGATAAAAGCCGTGCTGTTTTTCTTATGTGCTGCCGTGATTATGGTCCCCATTGCACAACGCTTAAAAATTGGTGCGGTATTAGGCTATTTAATTGCTGGTATTGCGATTGGCCCTTGGGGATTAGGGTTATTTAAAGATGTTGATTACATCTTACACTTTTCTGAATTAGGGGTTGTTTTTTTAATGTTCCTGATTGGGCTGGAGTTAAATCCAGCTAAGCTTTGGGAGTTACGGCGAGCAATATTTGGTGTCGGCGCCATGCAGGTTGTCTTTACTGCATCTGTTATCACAGGGCTACTTTTACTCTTAACTTCTTTTTCGTGGCAAGCAGCATTGATTGGTGGCCTAGGTATCGCCATGTCATCAACTGCGATGGCTTTACAATTGATGAATGAAAAAGGAATGAATCATAACGAAGGAGGGCAGTTGGGTTTTGCGGTTTTACTCTTTCAAGATATGGCCGTTATTCCTATTCTTGCGGTGATCCCTTTACTTGCTGGCGAAACAGCCAGTAGTGATTGGTATCGTATTGCCCTAAAAATAGTCTCATTCGCTGCATTATTAATTTGTGGCCGCTATTTATTGCGCCCACTATTTCGCTTAATTGTTAAATCGGGTGTGAGAGAAGTTTTTACCGCCGGTGCGCTATTAGTGGTATTAGGGTCAGCACTCTTTATGGAAATGATTGGCTTTTCCATGGCGATGGGAACTTTTATTGCAGGGGTATTATTAGCTGACTCTGAATATCGTCATGAATTAGAAATCTCGATTGAACCTTTTAAAGGCTTATTGTTAGGGTTGTTTTTTATCTCCGTCGGCATGTCCCTCGATATAGGTATATTGTGGCATTATTTACCGCAAGTGTTACTGGGCGTTGTCATTTTAGTCTTGATTAAAGGGTTGGTACTTTATGGTATCGCTTGGTTAGCGAGATTACGCTTTTCGACACGTTTGCAATTTTCAGCCGTATTAAGCCAAGGCGGTGAATTTGCTTTTGTTGTTTTTTCTACCTCTATGGCGATGGGGGTATTAAATAGTGAACAGATGGCATTGCTTTTGGTTGTCGTAACGCTTTCAATGATGACTACGCCACTTGTGATGCAAATGACAGACGCCGTGTTATCGCGCCGTTATAATGATGCAAAGATAGACGAAGAGCCTTTTGTTGAAAATAACCATCCAGAAGTGATCCTGGTGGGCTTTGGTCGTATGGGACAGGTAGTCGGGCGCCTACTTATGGCAAATAAAGTCAATGTGACCGTATTAGAGCATGACGTTGGTAGTTTAAGTACCATGCGTAAATATGGTTATAAAGTTTATTATGGCGATGCGACAGACTTGAATTTATTACGTGCTGCGGGGGCTGAACACGCGAAAGCCATTGTGATCACCAGTAATGAGCCTGAAGCGACAATGGAAATTGTCCATTTATGCCAGCGCCATTTTCCTCAATTACAAATTATTGCCAGAGCAAGAGGACGGGTTGAAGCACATGAGCTGTTAAAAGCAGGGGTAACAGAGTTTAGTCGAGAAACCTTCTCGAGTGCTTTAGAGCTAGGACGTAAAACTTTAATTGAACTTGGTATGCATCCACATCAGGCCTATCGTGCACAACAGCATTTTCGTCGTCTAGATATGCAGTTATTAAGAAAGTTGGTGGACGAATCACCCGAAGAAGTCTCGAATGTTTCACGTGTTAAAGAGGCTCGTCGTGAATTAGAAGAGCTGTTTAATGAAGAGATGAGACAAGAGCACCACCAGCCTGATATTTGGGACGAATCGTTAACTGATGCTATCCCTCAAGTAAATAGAGAAAAAAGACCCATTGATAAACAGGAGAACTGACCCCATGTCTGCAACCCGTAAGCGTTTTATTGCTGGCGCAGTATGTCCCC