Homologs in group_1734

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11790 FBDBKF_11790 100.0 Morganella morganii S1 kefB glutathione-regulated potassium-efflux system protein KefB
EHELCC_14515 EHELCC_14515 100.0 Morganella morganii S2 kefB glutathione-regulated potassium-efflux system protein KefB
NLDBIP_15610 NLDBIP_15610 100.0 Morganella morganii S4 kefB glutathione-regulated potassium-efflux system protein KefB
HKOGLL_19285 HKOGLL_19285 100.0 Morganella morganii S5 kefB glutathione-regulated potassium-efflux system protein KefB
F4V73_RS14865 F4V73_RS14865 92.6 Morganella psychrotolerans kefB glutathione-regulated potassium-efflux system protein KefB
PMI_RS13855 PMI_RS13855 72.9 Proteus mirabilis HI4320 kefB glutathione-regulated potassium-efflux system protein KefB

Distribution of the homologs in the orthogroup group_1734

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1734

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B2VK47 0.0 835 69 4 596 3 kefB Glutathione-regulated potassium-efflux system protein KefB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B1JIU4 0.0 834 71 3 598 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664Q5 0.0 834 71 3 598 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGX5 0.0 834 71 3 598 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis (strain Pestoides F)
Q1CCS7 0.0 834 71 3 598 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R473 0.0 834 71 3 598 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJC4 0.0 834 71 3 598 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis
Q1C2S9 0.0 834 71 3 598 3 kefB Glutathione-regulated potassium-efflux system protein KefB Yersinia pestis bv. Antiqua (strain Antiqua)
A8AQP0 0.0 820 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TEY9 0.0 812 69 4 599 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XN76 0.0 810 69 4 599 3 kefB Glutathione-regulated potassium-efflux system protein KefB Klebsiella pneumoniae (strain 342)
Q6CZU5 0.0 806 69 3 599 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4TXF9 0.0 798 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella schwarzengrund (strain CVM19633)
B5R2A8 0.0 798 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella enteritidis PT4 (strain P125109)
B5FJN1 0.0 798 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella dublin (strain CT_02021853)
A4WFE4 0.0 798 69 4 596 3 kefB Glutathione-regulated potassium-efflux system protein KefB Enterobacter sp. (strain 638)
Q8ZLL3 0.0 796 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MT17 0.0 796 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TKN2 0.0 796 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella heidelberg (strain SL476)
B5F8G9 0.0 796 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella agona (strain SL483)
Q8Z1Y7 0.0 795 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella typhi
B4SUV7 0.0 795 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella newport (strain SL254)
C0Q0D3 0.0 793 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi C (strain RKS4594)
Q57J15 0.0 793 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella choleraesuis (strain SC-B67)
B5BH03 0.0 793 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain AKU_12601)
Q5PL21 0.0 793 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7N1D2 0.0 790 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O81 (strain ED1a)
A7ME23 0.0 786 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Cronobacter sakazakii (strain ATCC BAA-894)
A9MN27 0.0 785 68 5 602 3 kefB Glutathione-regulated potassium-efflux system protein KefB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B1IPB4 0.0 785 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q3YWS1 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella sonnei (strain Ss046)
B7LS57 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I2Q9 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SE11)
A8A5F8 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O9:H4 (strain HS)
B7L4M7 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain 55989 / EAEC)
B2U3F5 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P45522 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12)
B1X6K0 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / DH10B)
C4ZUK6 0.0 783 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain K12 / MC4100 / BW2952)
B7UK61 0.0 782 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R5T2 0.0 782 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain UTI89 / UPEC)
Q8FCY0 0.0 782 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AGN6 0.0 782 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O1:K1 / APEC
B7M1Q2 0.0 782 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O8 (strain IAI1)
B7MCW6 0.0 782 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZSM6 0.0 782 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8X878 0.0 778 69 5 596 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O157:H7
B1LHF1 0.0 778 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli (strain SMS-3-5 / SECEC)
B7NDV9 0.0 776 68 5 605 3 kefB Glutathione-regulated potassium-efflux system protein KefB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
C6DG97 0.0 773 69 3 599 3 kefB Glutathione-regulated potassium-efflux system protein KefB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q31VU0 0.0 765 68 6 607 3 kefB Glutathione-regulated potassium-efflux system protein KefB Shigella boydii serotype 4 (strain Sb227)
Q83PY0 0.0 722 66 5 572 5 kefB Putative glutathione-regulated potassium-efflux system protein KefB Shigella flexneri
B5Y1Z8 1.12e-152 456 42 6 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae (strain 342)
B7N7S2 2.07e-151 453 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q83SQ3 2.81e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri
B1LFY1 3.09e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SMS-3-5 / SECEC)
A6T4I3 3.12e-151 452 40 6 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P03819 3.72e-151 452 40 5 614 1 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12)
B1IRC9 3.72e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XC48 3.72e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / DH10B)
C4ZPX3 3.72e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain K12 / MC4100 / BW2952)
B7L4H0 5.25e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain 55989 / EAEC)
A7ZHE0 5.25e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0TLU2 5.54e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q326I6 6.73e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 4 (strain Sb227)
B2U255 6.73e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6HZ28 6.73e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain SE11)
A7ZVZ9 6.73e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O9:H4 (strain HS)
B7M0E4 6.73e-151 452 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O8 (strain IAI1)
B5YZ83 8.82e-151 451 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA20 8.82e-151 451 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O157:H7
B7LVT8 9.72e-151 451 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7MNQ4 1.29e-150 451 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O81 (strain ED1a)
B7NHF1 1.29e-150 451 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UI93 1.29e-150 451 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1RGF1 1.71e-150 451 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli (strain UTI89 / UPEC)
B7MAH0 1.71e-150 451 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FLA1 2.28e-150 450 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A4W6F3 3.33e-150 450 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Enterobacter sp. (strain 638)
Q3Z5W2 3.37e-150 450 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella sonnei (strain Ss046)
A8ALQ4 3.59e-149 447 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MQG6 1.27e-148 446 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A9MYL9 2.48e-148 445 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TJ42 2.65e-148 445 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella heidelberg (strain SL476)
B5BL23 2.95e-148 445 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain AKU_12601)
C0Q4N0 2.95e-148 445 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi C (strain RKS4594)
Q5PIL3 2.95e-148 445 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T6L2 2.95e-148 445 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella newport (strain SL254)
B5R1S4 2.95e-148 445 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella enteritidis PT4 (strain P125109)
B5FI29 2.95e-148 445 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella dublin (strain CT_02021853)
B5F767 3.7e-148 444 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella agona (strain SL483)
B4TWT1 4.12e-148 444 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella schwarzengrund (strain CVM19633)
Q0T8E8 7.07e-148 444 40 5 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Shigella flexneri serotype 5b (strain 8401)
Q57TH4 1.08e-147 443 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella choleraesuis (strain SC-B67)
Q8Z9K0 2.34e-147 442 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhi
Q8ZRW2 4.16e-147 442 40 5 621 3 kefC Glutathione-regulated potassium-efflux system protein KefC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A7MIA0 1.59e-140 425 40 6 614 3 kefC Glutathione-regulated potassium-efflux system protein KefC Cronobacter sakazakii (strain ATCC BAA-894)
Q9X756 7.86e-135 410 41 6 578 3 kefC Glutathione-regulated potassium-efflux system protein KefC Klebsiella aerogenes
P44933 3.42e-124 383 37 10 564 3 kefBC Glutathione-regulated potassium-efflux system protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZTZ7 2.27e-78 273 36 10 532 1 KEA1 K(+) efflux antiporter 1, chloroplastic Arabidopsis thaliana
O65272 1.44e-77 271 36 9 530 1 KEA2 K(+) efflux antiporter 2, chloroplastic Arabidopsis thaliana
Q9M0Z3 4.85e-75 258 33 15 603 1 KEA3 K(+) efflux antiporter 3, chloroplastic Arabidopsis thaliana
Q0ZAH7 1.06e-63 225 31 10 576 3 kefB Putative K(+) efflux antiporter KefB Alkalimonas amylolytica
P39830 8.53e-44 168 28 7 523 1 ybaL Putative cation/proton antiporter YbaL Escherichia coli (strain K12)
Q8VYR9 9.75e-39 154 34 8 351 1 KEA5 K(+) efflux antiporter 5 Arabidopsis thaliana
B5X0N6 1.35e-34 142 32 6 356 1 KEA6 K(+) efflux antiporter 6 Arabidopsis thaliana
Q9ZUN3 2.73e-30 129 30 6 357 1 KEA4 K(+) efflux antiporter 4 Arabidopsis thaliana
Q2W031 7.08e-27 117 30 11 355 1 magA Iron transporter MagA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P52071 8.71e-24 104 33 6 253 3 None Uncharacterized protein in phaC 3'region (Fragment) Methylorubrum extorquens
B3VQ24 9.19e-24 107 26 9 361 3 gerT Probable Na(+)/H(+) antiporter GerT Bacillus cereus
Q9KI10 1.26e-23 106 28 8 357 1 gerN Na(+)/H(+)-K(+) antiporter GerN Bacillus cereus
P26235 3.58e-18 90 26 12 375 1 napA Na(+)/H(+) antiporter Enterococcus hirae
Q6UWJ1 2.69e-15 83 27 14 377 1 TMCO3 Transmembrane and coiled-coil domain-containing protein 3 Homo sapiens
Q8BH01 1.88e-14 80 26 12 381 2 Tmco3 Transmembrane and coiled-coil domain-containing protein 3 Mus musculus
O31615 2.37e-14 80 27 7 283 3 cpaA Putative Na(+)/H(+) antiporter YjbQ Bacillus subtilis (strain 168)
Q9SUQ7 8.58e-14 78 22 14 382 1 CHX17 Cation/H(+) antiporter 17 Arabidopsis thaliana
D3FSJ3 4.26e-12 72 30 14 343 1 amhT Ammonium/H(+) antiporter subunit AmhT Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q55736 2.09e-09 64 26 11 267 3 nhaS5 Na(+)/H(+) antiporter NhaS5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P72973 8.72e-08 58 27 8 245 3 nhaS4 Na(+)/H(+) antiporter NhaS4 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O07536 9.45e-07 55 23 8 276 1 khtU K(+)/H(+) antiporter subunit KhtU Bacillus subtilis (strain 168)
Q55190 4.34e-06 53 26 10 330 1 nhaS3 High-affinity Na(+)/H(+) antiporter NhaS3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P56509 1.62e-05 51 30 1 127 4 Mfer_0534 Uncharacterized protein Mfer_0534 Methanothermus fervidus (strain ATCC 43054 / DSM 2088 / JCM 10308 / V24 S)
P40309 6.49e-05 50 22 17 432 1 KHA1 K(+)/H(+) antiporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q59027 7.43e-05 49 29 1 99 4 MJ1633 Uncharacterized protein MJ1633 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58671 0.000121 48 26 11 297 3 MJ1275 Probable Na(+)/H(+) antiporter 3 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9FFR9 0.00051 47 22 16 389 2 CHX18 Cation/H(+) antiporter 18 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_15000
Feature type CDS
Gene kefB
Product glutathione-regulated potassium-efflux system protein KefB
Location 7878 - 9731 (strand: -1)
Length 1854 (nucleotides) / 617 (amino acids)
In genomic island -

Contig

Accession ZDB_373
Length 137108 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1734
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00999 Sodium/hydrogen exchanger family
PF02254 TrkA-N domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0475 Inorganic ion transport and metabolism (P) P Kef-type K+ transport system, membrane component KefB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11747 glutathione-regulated potassium-efflux system protein KefB - -

Protein Sequence

MEPADGNLLHAGIVFLAAAVVMVPVAQRLRIGAVLGYLLAGIAIGPWGLGFIKNVNELLHFSELGVVFLMFLIGLELNPRELWKLRRSIFGTGTAQVVFSALILGVLLWLTDFSWQAAVVGGLGMAMSSTAMALQLMDEKGMTNNDSGQMGFSVLLFQDMAVIPILAVIPLLGGETAGSDWYRIGIKILAFAGLLIGGRYLLRPLFRLVVKSGVSEVFTAASLLVVIGSAVFMEQLGFSMALGTFIAGVMLADTEYRHELEITIEPFKGLLLGMFFISVGMSLNIGVLWQYLPQILLGVIVLVSVKMTVLYLLAHLTCRRSGRLQFAGVLSQGGEFAFVLFSAALASRVITDHQMALLLVVVTLSMMTTPLLMQGIDMILARRYNNAEPGTGETPFVEDNHPHVILVGFGRMGQVIGRLLMANKIHPTVLEKDVSAVSAMRRYGYKVYYGDATGLALLRSAGAETAKVIVITCDKPEDTMTIVQLCQEHFPHLQIIARARGRVEAHELLTHGVTQFSRETFSSALELARKTLIGLGTHPAEAHRAQQLFRRLDMQLLRELIPQAEEEISHISRVKEARRELENLFDNEMKREKHLPDSWNLTEDSPGSGRTETGAEK

Flanking regions ( +/- flanking 50bp)

GGCGTATTGTGACTGGCTGCGGGCACCGCAACTGACCGGAGGGCGTAAAAATGGAGCCAGCTGACGGCAACCTGCTGCATGCAGGTATTGTGTTTCTCGCGGCAGCCGTGGTGATGGTGCCGGTGGCGCAGCGGCTGCGTATCGGCGCGGTACTGGGATATCTGCTGGCGGGGATTGCTATCGGCCCGTGGGGGCTGGGCTTTATCAAGAACGTCAATGAGCTGCTGCACTTCTCTGAGCTTGGTGTGGTGTTCCTGATGTTTCTTATCGGGCTGGAGCTGAATCCGCGTGAACTGTGGAAACTGCGGCGATCTATTTTCGGTACCGGCACCGCGCAGGTGGTGTTCTCCGCCCTGATCCTCGGGGTGCTGCTCTGGCTGACGGATTTCTCCTGGCAGGCGGCAGTGGTCGGCGGGCTGGGAATGGCGATGTCCTCCACAGCGATGGCATTACAGCTGATGGATGAAAAAGGCATGACCAACAACGACAGCGGCCAGATGGGATTCTCAGTGCTGCTGTTCCAGGATATGGCGGTGATCCCTATCCTTGCTGTTATTCCTCTGCTGGGCGGGGAAACGGCGGGCAGTGACTGGTATCGCATCGGTATCAAGATTCTGGCCTTTGCCGGACTGCTGATCGGCGGACGCTATCTGCTGCGGCCATTGTTCCGGCTGGTGGTAAAATCCGGGGTCAGTGAAGTCTTTACCGCCGCCTCGCTGCTGGTGGTGATCGGCTCGGCGGTGTTTATGGAGCAGCTCGGGTTTTCCATGGCGCTCGGAACATTTATCGCGGGTGTGATGCTGGCGGATACGGAATACCGCCATGAGCTGGAGATCACCATCGAGCCGTTTAAAGGGCTGCTGCTGGGGATGTTCTTTATTTCTGTCGGTATGTCACTGAATATCGGCGTGCTGTGGCAGTATCTGCCGCAAATTCTGCTGGGTGTGATTGTACTGGTGAGCGTCAAAATGACGGTGCTGTATCTGCTGGCACATCTGACCTGCCGGCGCAGCGGGCGCTTACAGTTTGCCGGGGTGCTCAGTCAGGGTGGGGAATTTGCATTCGTGCTGTTCTCGGCGGCGCTGGCCAGCCGTGTGATTACGGATCATCAGATGGCGCTGCTGCTGGTGGTGGTCACCCTTTCCATGATGACCACGCCGCTGCTGATGCAGGGCATCGATATGATTCTGGCGCGCCGTTACAATAATGCCGAACCGGGAACGGGCGAAACCCCGTTTGTGGAGGATAACCACCCGCATGTGATTCTGGTCGGTTTCGGGCGGATGGGGCAGGTCATCGGCCGCCTGCTGATGGCGAACAAAATACATCCGACGGTACTGGAAAAAGATGTCAGCGCGGTCAGTGCCATGCGCCGTTACGGCTATAAGGTTTATTACGGGGATGCGACAGGACTCGCATTGTTGCGCTCTGCCGGGGCAGAGACGGCAAAGGTGATTGTCATTACCTGTGATAAGCCGGAAGATACTATGACCATTGTGCAGTTGTGTCAGGAGCACTTCCCGCATCTGCAGATTATTGCCCGCGCCCGGGGACGGGTGGAGGCACACGAGCTGCTTACACACGGTGTAACACAGTTCAGCCGCGAAACCTTCTCGTCAGCGCTGGAACTGGCGCGCAAAACCCTGATCGGGCTGGGCACGCATCCGGCGGAAGCACACCGGGCGCAGCAATTATTCCGCAGGCTGGATATGCAGTTGCTGCGTGAGCTTATCCCGCAGGCGGAAGAGGAAATTTCGCATATCTCCCGCGTGAAAGAGGCGCGGCGCGAGCTGGAAAATCTGTTTGATAATGAAATGAAACGGGAAAAACATCTGCCGGACAGCTGGAACCTGACGGAAGACTCACCGGGCAGCGGACGGACAGAGACAGGAGCAGAAAAATGAGCAACCGGAAACGGTTTATTGCGGGTGCGGTATGCCCTGAGTGTCAGGCA