Homologs in group_344

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11985 FBDBKF_11985 96.5 Morganella morganii S1 dppB dipeptide ABC transporter permease DppB
FBDBKF_20665 FBDBKF_20665 97.0 Morganella morganii S1 dppB Dipeptide transporter permease DppB
EHELCC_14320 EHELCC_14320 96.5 Morganella morganii S2 dppB dipeptide ABC transporter permease DppB
NLDBIP_15415 NLDBIP_15415 96.5 Morganella morganii S4 dppB dipeptide ABC transporter permease DppB
LHKJJB_15195 LHKJJB_15195 96.5 Morganella morganii S3 dppB dipeptide ABC transporter permease DppB
HKOGLL_14315 HKOGLL_14315 96.5 Morganella morganii S5 dppB dipeptide ABC transporter permease DppB
PMI_RS14060 PMI_RS14060 85.8 Proteus mirabilis HI4320 dppB dipeptide ABC transporter permease DppB

Distribution of the homologs in the orthogroup group_344

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_344

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AEF8 0.0 588 84 0 339 1 dppB Dipeptide transport system permease protein DppB Escherichia coli (strain K12)
P0AEF9 0.0 588 84 0 339 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG0 0.0 588 84 0 339 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O157:H7
A0A0H2ZGW7 2.47e-160 454 66 1 339 1 dppB Di/tripeptide transport system permease protein DppB Pseudomonas aeruginosa (strain UCBPP-PA14)
P45096 2.89e-146 418 62 2 337 3 dppB Dipeptide transport system permease protein DppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94311 1.18e-102 308 49 2 337 3 dppB Dipeptide transport system permease protein DppB Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q8FJK9 1.55e-88 271 42 3 342 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32IB7 3.9e-88 270 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE94 3.9e-88 270 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain UTI89 / UPEC)
P75798 3.9e-88 270 41 3 342 1 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain K12)
Q0TJL7 3.9e-88 270 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A970 3.9e-88 270 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O1:K1 / APEC
Q0T6D1 6.36e-88 269 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri serotype 5b (strain 8401)
Q8X6V7 8.53e-88 269 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O157:H7
Q83S26 1.48e-87 268 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri
Q323W3 5.89e-87 266 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Shigella boydii serotype 4 (strain Sb227)
Q3Z3V2 1.53e-86 266 41 3 342 3 gsiC Glutathione transport system permease protein GsiC Shigella sonnei (strain Ss046)
Q8Z862 3.86e-86 265 42 3 342 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhi
Q57RB0 3.86e-86 265 42 3 342 3 gsiC Glutathione transport system permease protein GsiC Salmonella choleraesuis (strain SC-B67)
Q8ZQM2 6.28e-86 264 42 3 342 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PGP5 1.02e-84 261 42 3 342 3 gsiC Glutathione transport system permease protein GsiC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6D3B1 4.66e-80 249 39 2 338 3 gsiC Glutathione transport system permease protein GsiC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P42062 2.71e-77 242 38 4 338 3 appB Oligopeptide transport system permease protein AppB Bacillus subtilis (strain 168)
P77308 7.94e-76 239 45 2 318 1 ddpB Probable D,D-dipeptide transport system permease protein DdpB Escherichia coli (strain K12)
Q2YJK1 2.02e-70 224 39 5 338 3 BAB2_1050 Putative peptide transport system permease protein BAB2_1050 Brucella abortus (strain 2308)
Q8VQK4 2.02e-70 224 39 5 338 3 BruAb2_1031 Putative peptide transport system permease protein BruAb2_1031 Brucella abortus biovar 1 (strain 9-941)
Q8YDG7 2.47e-70 224 39 5 338 3 BMEII0209 Putative peptide transport system permease protein BMEII0209 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FUX0 2.08e-69 222 39 5 338 3 BRA1092 Putative peptide transport system permease protein BRA1092/BS1330_II1084 Brucella suis biovar 1 (strain 1330)
Q53191 1.17e-67 218 37 3 334 3 NGR_a01430 Probable peptide ABC transporter permease protein y4tP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P26903 1.42e-67 217 34 5 341 2 dppB Dipeptide transport system permease protein DppB Bacillus subtilis (strain 168)
P0AGH3 5.16e-67 216 38 5 296 1 sapB Putrescine export system permease protein SapB Escherichia coli (strain K12)
P0AGH4 5.16e-67 216 38 5 296 3 sapB Peptide transport system permease protein SapB Escherichia coli O157:H7
Q8FWN8 1.42e-65 212 37 4 338 3 BRA0408 Putative peptide permease protein BRA0408/BS1330_II0405 Brucella suis biovar 1 (strain 1330)
Q8YBN9 9.24e-65 210 37 4 338 3 BMEII0860 Putative peptide permease protein BMEII0860 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU90 9.24e-65 210 37 4 338 3 BOV_A0351 Putative peptide permease protein BOV_A0351 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P0A2J3 6.14e-61 201 38 4 282 2 sapB Peptide transport system permease protein SapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J4 6.14e-61 201 38 4 282 3 sapB Peptide transport system permease protein SapB Salmonella typhi
P08005 1.12e-60 199 35 4 338 1 oppB Oligopeptide transport system permease protein OppB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33591 1.35e-60 199 33 3 341 1 nikB Nickel transport system permease protein NikB Escherichia coli (strain K12)
P0AFH5 6.84e-60 197 35 4 338 3 oppB Oligopeptide transport system permease protein OppB Shigella flexneri
P0AFH2 6.84e-60 197 35 4 338 1 oppB Oligopeptide transport system permease protein OppB Escherichia coli (strain K12)
P0AFH3 6.84e-60 197 35 4 338 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFH4 6.84e-60 197 35 4 338 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O157:H7
P24138 1.35e-59 197 37 4 340 1 oppB Oligopeptide transport system permease protein OppB Bacillus subtilis (strain 168)
P45054 3.28e-57 190 33 4 338 3 oppB Oligopeptide transport system permease protein OppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A2RI75 1.13e-51 176 32 5 314 1 dppB Dipeptide transport system permease protein DppB Lactococcus lactis subsp. cremoris (strain MG1363)
Q2FVE8 1.43e-46 163 29 5 340 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3K104 6.4e-46 161 28 5 340 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0A4N8 2.24e-43 155 29 2 336 3 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N7 2.24e-43 155 29 2 336 1 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. lactis (strain IL1403)
A9CKL3 1.56e-42 154 28 5 377 3 yejB Peptidoglycan transport system permease protein YejB Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2YXY7 8.87e-42 151 28 4 332 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NWT4 4.99e-41 149 28 4 332 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MW2)
Q6G9H8 4.99e-41 149 28 4 332 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MSSA476)
Q5HG38 4.99e-41 149 28 4 332 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain COL)
Q2FYQ5 4.99e-41 149 28 4 332 1 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH55 4.99e-41 149 28 4 332 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain USA300)
Q7A5Q6 5.04e-41 149 28 4 332 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain N315)
Q99UA0 5.04e-41 149 28 4 332 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GH25 1.04e-40 148 28 4 332 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MRSA252)
P66967 3.68e-38 141 29 7 339 3 BQ2027_MB1314C Putative peptide transport permease protein Mb1314c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ7 3.68e-38 141 29 7 339 1 Rv1283c Putative peptide transport permease protein Rv1283c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ6 3.68e-38 141 29 7 339 3 MT1320 Putative peptide transport permease protein MT1320 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P45286 1.64e-33 129 27 3 273 3 sapB Peptide transport system permease protein SapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AFU0 1.29e-30 122 26 7 380 1 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli (strain K12)
P0AFU1 1.29e-30 122 26 7 380 3 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli O157:H7
P75554 1.72e-20 94 24 3 285 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47323 1.77e-19 92 23 8 340 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P0A4M8 2.63e-17 86 33 0 131 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M7 2.63e-17 86 33 0 131 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8YDG8 2.64e-06 52 31 3 146 3 BMEII0207/BMEII0208 Putative peptide transport system permease protein BMEII0207/BMEII0208 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK0 2.64e-06 52 31 3 146 3 BAB2_1051 Putative peptide transport system permease protein BAB2_1051 Brucella abortus (strain 2308)
Q8VQK5 2.64e-06 52 31 3 146 3 BruAb2_1032 Putative peptide transport system permease protein BruAb2_1032 Brucella abortus biovar 1 (strain 9-941)
Q8FUW9 2.71e-06 52 33 3 127 3 BRA1093 Putative peptide transport system permease protein BRA1093/BS1330_II1085 Brucella suis biovar 1 (strain 1330)
A0A0H2ZFV0 0.000119 47 26 3 141 1 dppC Di/tripeptide transport system permease protein DppC Pseudomonas aeruginosa (strain UCBPP-PA14)
P51000 0.000464 45 24 5 153 3 dppC Dipeptide transport system permease protein DppC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14670
Feature type CDS
Gene dppB
Product dipeptide ABC transporter permease DppB
Location 169993 - 171012 (strand: 1)
Length 1020 (nucleotides) / 339 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_344
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component
PF19300 Binding-prot-dependent transport system membrane comp, N-term

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0601 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)		 EP ABC-type dipeptide/oligopeptide/nickel transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12369 dipeptide transport system permease protein ABC transporters -

Protein Sequence

MLQFILRRVGMVIPTFIGITLLTFIFVHLIPGDPVTIMAGERGISPERHAQLMAALGLDQPYWKQYLHYINGVLHGDLGISLKSRQPVWDEFVPRFKATLELATCAMIFAISVGIPAGVLAAVKRGSVFDHTVIGISLTGYSMPIFWWGIMLIMLVSVNLDLTPVSGRLADSVFLDDTQPLTGFMLIDTLIWGEDGDFKDAVMHLILPSIVLGTIPLAVIVRMTRSAMLEVLGEDYIRTARAKGLSRLRVIVVHALRNALLPVVTVIGLQVGVMLAGAILTETIFSWPGIGRWLIDALQRRDYPVVQGGVLLIAILIILVNLCVDLLYGVINPRIRHKK

Flanking regions ( +/- flanking 50bp)

GTCTTTATGACCTGAGCGCTGTCAGCGGGCATTACAAGGGAATCAGGGGTATGCTGCAATTTATCCTCCGACGGGTAGGGATGGTTATACCGACATTTATCGGTATCACATTACTGACGTTTATATTTGTTCATCTGATCCCGGGCGACCCGGTCACGATTATGGCGGGTGAACGCGGGATTTCTCCGGAGCGTCACGCACAGTTAATGGCGGCACTCGGATTAGATCAACCTTACTGGAAACAGTATCTTCATTACATCAATGGCGTTCTGCACGGCGACCTTGGTATCTCATTAAAGAGCCGCCAGCCGGTGTGGGATGAATTTGTTCCCCGCTTTAAAGCCACGCTGGAACTTGCTACCTGCGCAATGATTTTTGCCATCTCTGTGGGCATTCCGGCAGGTGTGCTGGCGGCGGTCAAACGCGGTTCGGTGTTTGATCATACGGTTATCGGGATTTCACTGACCGGCTATTCCATGCCGATTTTCTGGTGGGGCATCATGCTTATCATGCTGGTGTCGGTCAATCTTGACCTTACCCCGGTATCCGGAAGGCTTGCCGACAGTGTTTTCCTGGATGACACTCAGCCGCTCACCGGATTTATGCTGATTGATACCCTGATCTGGGGCGAAGACGGGGATTTTAAAGATGCCGTGATGCATCTTATCTTACCTTCCATTGTCCTCGGCACTATTCCGCTGGCGGTGATTGTCCGTATGACGCGCTCCGCGATGCTGGAAGTCCTGGGTGAAGATTATATCCGTACCGCACGCGCCAAAGGGCTGAGCCGTCTGCGGGTGATTGTGGTGCATGCGCTGCGTAATGCATTGTTACCGGTCGTGACAGTAATCGGCTTACAGGTCGGTGTGATGCTGGCAGGTGCAATTCTGACAGAAACTATTTTCTCCTGGCCCGGTATCGGGCGCTGGCTGATTGATGCACTGCAACGCCGTGACTATCCGGTGGTTCAGGGCGGCGTACTGCTGATCGCTATTCTCATTATCCTGGTTAACCTGTGTGTGGATTTACTCTACGGTGTCATTAATCCGCGGATCCGCCACAAAAAATAAGAGGAGCGCACGATGTCTGATTCAACGAACAATGTTGTTACCCGCGCGCC