Homologs in group_1718

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11990 FBDBKF_11990 93.5 Morganella morganii S1 dppA dipeptide ABC transporter periplasmic-binding protein DppA
EHELCC_14315 EHELCC_14315 93.5 Morganella morganii S2 dppA dipeptide ABC transporter periplasmic-binding protein DppA
NLDBIP_15410 NLDBIP_15410 93.5 Morganella morganii S4 dppA dipeptide ABC transporter periplasmic-binding protein DppA
LHKJJB_15200 LHKJJB_15200 93.5 Morganella morganii S3 dppA dipeptide ABC transporter periplasmic-binding protein DppA
HKOGLL_14320 HKOGLL_14320 93.5 Morganella morganii S5 dppA dipeptide ABC transporter periplasmic-binding protein DppA
PMI_RS14065 PMI_RS14065 79.1 Proteus mirabilis HI4320 - ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_1718

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1718

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P23847 0.0 910 79 1 536 1 dppA Dipeptide-binding protein Escherichia coli (strain K12)
A0A0H2ZGV2 0.0 615 53 4 537 1 dppA1 Di/tripeptide-binding protein 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HVS1 0.0 613 55 3 511 1 PA4500 Dipeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P33950 0.0 612 56 1 513 1 hbpA Heme-binding protein A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZGN2 0.0 611 54 3 511 1 dppA3 Di/tripeptide-binding protein 3 Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGV7 0.0 529 50 2 506 1 dppA4 Di/tripeptide-binding protein 4 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HVS4 6.73e-167 486 44 1 506 1 PA4497 Tripeptide-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZGW2 6.88e-167 486 44 1 506 1 dppA2 Di/tripeptide-binding protein 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZI72 9.2e-161 471 42 1 503 1 dppA5 Probable di/tripeptide-binding protein 5 Pseudomonas aeruginosa (strain UCBPP-PA14)
P36634 1.15e-121 371 36 2 515 2 sapA Peptide transport periplasmic protein SapA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q47622 2.14e-117 360 36 1 506 3 sapA Probable ABC transporter periplasmic-binding protein SapA Escherichia coli (strain K12)
P45285 1.35e-87 283 29 5 527 3 sapA Peptide transport periplasmic protein SapA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1RE95 1.55e-55 197 29 16 556 3 gsiB Glutathione-binding protein GsiB Escherichia coli (strain UTI89 / UPEC)
Q8CW88 1.55e-55 197 29 16 556 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A968 1.55e-55 197 29 16 556 3 gsiB Glutathione-binding protein GsiB Escherichia coli O1:K1 / APEC
Q8X6V9 2.57e-55 197 29 16 556 3 gsiB Glutathione-binding protein GsiB Escherichia coli O157:H7
Q323W4 8.07e-55 196 29 16 556 3 gsiB Glutathione-binding protein GsiB Shigella boydii serotype 4 (strain Sb227)
Q57RB1 1e-54 195 29 10 468 3 gsiB Glutathione-binding protein GsiB Salmonella choleraesuis (strain SC-B67)
Q8ZQM3 1.1e-54 195 29 10 468 3 gsiB Glutathione-binding protein GsiB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3Z3V3 1.22e-54 195 29 16 556 3 gsiB Glutathione-binding protein GsiB Shigella sonnei (strain Ss046)
Q8Z863 1.5e-54 195 29 10 468 3 gsiB Glutathione-binding protein GsiB Salmonella typhi
Q0TJL8 1.51e-54 195 29 16 556 3 gsiB Glutathione-binding protein GsiB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q821B3 1.69e-54 194 28 13 552 3 gsiB Glutathione-binding protein GsiB Shigella flexneri
Q32IB6 1.8e-54 194 29 16 556 3 gsiB Glutathione-binding protein GsiB Shigella dysenteriae serotype 1 (strain Sd197)
P75797 2.95e-54 194 29 16 556 1 gsiB Glutathione-binding protein GsiB Escherichia coli (strain K12)
Q5PGP4 5.87e-54 193 29 10 468 3 gsiB Glutathione-binding protein GsiB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0T6D2 1.79e-53 192 28 13 553 3 gsiB Glutathione-binding protein GsiB Shigella flexneri serotype 5b (strain 8401)
Q6D3B0 4.3e-52 188 30 11 454 3 gsiB Glutathione-binding protein GsiB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P76128 1.36e-44 168 25 9 541 2 ddpA Probable D,D-dipeptide-binding periplasmic protein DdpA Escherichia coli (strain K12)
P42061 5.57e-43 164 26 18 557 1 appA Oligopeptide-binding protein AppA Bacillus subtilis (strain 168)
P33590 9.69e-33 134 26 15 469 1 nikA Nickel-binding periplasmic protein Escherichia coli (strain K12)
P24141 9.37e-32 132 25 14 470 1 oppA Oligopeptide-binding protein OppA Bacillus subtilis (strain 168)
P26906 1.46e-29 125 26 26 576 1 dppE Dipeptide-binding protein DppE Bacillus subtilis (strain 168)
A0A0H3JTL0 6.92e-28 120 26 17 491 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FVE7 1.38e-27 119 26 17 489 1 cntA Metal-staphylopine-binding protein CntA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8FWN7 4.18e-27 118 29 16 426 3 BRA0409 Putative ABC transporter peptide-binding protein BRA0409/BS1330_II0406 Brucella suis biovar 1 (strain 1330)
Q2YK66 4.18e-27 118 29 16 426 3 BAB2_0812 Putative ABC transporter peptide-binding protein BAB2_0812 Brucella abortus (strain 2308)
Q577J8 4.18e-27 118 29 16 426 3 BruAb2_0792 Putative ABC transporter peptide-binding protein BruAb2_0792 Brucella abortus biovar 1 (strain 9-941)
A5VU91 4.18e-27 118 29 16 426 3 BOV_A0352 Putative ABC transporter peptide-binding protein BOV_A0352 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBP0 4.9e-27 118 29 16 426 3 BMEII0859 Putative ABC transporter peptide-binding protein BMEII0859 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q46863 5.82e-26 115 25 19 538 1 ygiS Probable deoxycholate-binding periplasmic protein YgiS Escherichia coli (strain K12)
Q8YDG6 2.77e-24 109 28 18 431 3 BMEII0210 Putative peptide-binding periplasmic protein BMEII0210 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK2 1.28e-23 107 27 17 431 3 BAB2_1049 Putative peptide-binding periplasmic protein BAB2_1049 Brucella abortus (strain 2308)
Q8VQK3 1.28e-23 107 27 17 431 3 BruAb2_1030 Putative peptide-binding periplasmic protein BruAb2_1030 Brucella abortus biovar 1 (strain 9-941)
Q8FUX2 9.42e-23 105 27 18 431 3 BRA1090 Putative peptide-binding periplasmic protein BRA1090/BS1330_II1082 Brucella suis biovar 1 (strain 1330)
P23843 1.76e-22 104 23 19 487 1 oppA Periplasmic oligopeptide-binding protein OppA Escherichia coli (strain K12)
P06109 1.01e-21 102 25 16 436 3 xp55 Protein XP55 Streptomyces lividans
P06202 6.81e-20 96 23 22 492 1 oppA Periplasmic oligopeptide-binding protein OppA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77348 7.82e-20 96 22 17 476 1 mppA Periplasmic murein peptide-binding protein MppA Escherichia coli (strain K12)
P71370 1.79e-19 95 23 22 549 3 oppA Periplasmic oligopeptide-binding protein OppA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9RU24 6.95e-19 93 22 19 579 1 DR_1571 Probable ABC transporter-binding protein DR_1571 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q2G2P5 7.81e-17 87 25 12 351 1 nikA Nickel-binding protein NikA Staphylococcus aureus (strain NCTC 8325 / PS 47)
O07570 1.61e-12 73 25 19 378 3 yhjP Uncharacterized protein YhjP Bacillus subtilis (strain 168)
P55669 4.39e-12 72 27 22 409 3 NGR_a01440 Probable peptide ABC transporter periplasmic-binding protein y4tO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P31306 1.23e-11 70 26 13 344 1 sarA Oligopeptide-binding protein SarA Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P55691 5.24e-11 68 23 24 518 3 NGR_a00920 Uncharacterized protein y4wM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A2RI74 5.76e-10 65 29 9 210 1 dppA Dipeptide-binding protein Lactococcus lactis subsp. cremoris (strain MG1363)
P18791 1.25e-09 64 25 13 300 1 amiA Oligopeptide-binding protein AmiA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2YKJ5 2.8e-09 63 21 17 435 3 BAB2_0664 Putative binding protein BAB2_0664 Brucella abortus (strain 2308)
Q577X5 2.8e-09 63 21 17 435 3 BruAb2_0648 Putative binding protein BruAb2_0648 Brucella abortus biovar 1 (strain 9-941)
P35592 2.82e-09 63 23 21 507 3 aliA Oligopeptide-binding protein AliA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8YC41 6.11e-09 62 21 17 433 3 BMEII0691 Putative binding protein BMEII0691 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P0A4G1 3.07e-08 60 29 6 171 1 aliB Oligopeptide-binding protein AliB Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4G0 3.07e-08 60 29 6 171 3 aliB Oligopeptide-binding protein AliB Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9CEK0 5.2e-08 59 23 21 495 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis (strain IL1403)
Q8FW84 6.16e-08 59 21 17 435 3 BRA0576 Putative binding protein BRA0576/BS1330_II0571 Brucella suis biovar 1 (strain 1330)
Q07741 1.71e-06 54 22 12 365 1 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. lactis
Q02VA9 2.55e-06 53 22 13 366 3 oppA Oligopeptide-binding protein OppA Lactococcus lactis subsp. cremoris (strain SK11)
P66772 8.29e-06 52 21 14 406 3 BQ2027_MB1311C Uncharacterized protein Mb1311c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGU5 8.29e-06 52 21 14 406 1 Rv1280c Uncharacterized protein Rv1280c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGU4 8.29e-06 52 21 14 406 3 MT1317 Uncharacterized protein MT1317 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9X4Y1 0.000192 48 23 17 397 2 agpA Periplasmic alpha-galactoside-binding protein Rhizobium meliloti (strain 1021)
A9CIN5 0.000369 47 24 15 295 3 yepA Peptidoglycan-binding protein YepA Agrobacterium fabrum (strain C58 / ATCC 33970)
P44572 0.000625 46 20 19 450 3 HI_0213 Putative binding protein HI_0213 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14665
Feature type CDS
Gene -
Product dipeptide ABC transporter periplasmic-binding protein DppA
Location 168180 - 169793 (strand: 1)
Length 1614 (nucleotides) / 537 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1718
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00496 Bacterial extracellular solute-binding proteins, family 5 Middle

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0747 Amino acid transport and metabolism (E) E ABC-type transport system, periplasmic component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12368 dipeptide transport system substrate-binding protein ABC transporters
Bacterial chemotaxis		 -

Protein Sequence

MKVAKRKTGLMKLSVTLIALAVSASVNAAGTLVFCSEGSPEGFNPQLFTSGTTYDASSVPLYNRLVEFKAGTTELEPGLAETWDVSADGKTYTFHLRKGVKFHTTKEFKPTRDFNADDVIFTFDRQKNAENPYHKVSGGSYEYFSGMDMDKIIEKIEKVDDNTVRFQLSRSEAPFLANLGMDFASILSAEYADQMLKAGTPEKVDLNPVGTGPFVLQQYQKDSRILYKANDDYWNGRPQLDRLVFSITPDASVRYAKLQKNECQVMPYPNPADLDRMRADKNIVLKEQPGLNVGYLSYNVEKKPLDNVKVRQALSMAVNKDAIIEAVYQGAGQKAKNLIPPTMWGYNKDLQDYPYDPEKAKALLKEAGMENGFEIDLWAMPVQRPYNPNARRMAEMIQADWAKVGVKAKIVTYEWGEYLKRAKAGEPQTVMMGWTGDNGDPDNFFATLFSCAAKEQGSNYSKWCDQSFENIILPARTTADPKERAKLYEQAQVVMKEQEPALIVAHSTVYEPVRKEVKGYVVDPLGKHHFDKVSIEK

Flanking regions ( +/- flanking 50bp)

ACCGGACCGCAGACAAACACAACATACAATGACAGGCGGAGATAACGATGATGAAAGTCGCCAAACGTAAGACAGGGTTGATGAAGCTGAGTGTCACACTGATTGCACTGGCAGTGTCGGCAAGTGTTAACGCGGCAGGCACGCTGGTTTTCTGTTCGGAAGGGTCACCGGAAGGGTTTAACCCGCAGTTGTTTACCTCCGGAACAACCTATGATGCGAGCTCGGTTCCGCTCTATAACCGGCTGGTCGAGTTTAAAGCCGGAACGACAGAACTGGAGCCGGGTCTGGCAGAGACCTGGGACGTGAGTGCGGATGGTAAAACGTACACTTTCCATCTGCGCAAAGGGGTTAAATTCCACACCACTAAAGAGTTCAAGCCGACCCGTGATTTTAATGCTGATGATGTGATTTTCACGTTTGATCGTCAGAAAAATGCGGAGAATCCGTATCACAAAGTGTCCGGCGGCAGTTACGAATATTTCAGCGGCATGGATATGGATAAAATCATCGAAAAAATTGAGAAAGTCGATGATAACACTGTCCGTTTTCAGCTGAGCCGCTCAGAAGCCCCTTTCCTGGCAAACCTCGGAATGGACTTTGCCTCCATTCTTTCTGCTGAATATGCGGATCAGATGCTGAAAGCCGGAACACCGGAAAAAGTGGATCTGAATCCTGTCGGCACCGGTCCGTTTGTGTTGCAGCAGTATCAGAAAGATTCCCGCATCCTGTATAAAGCTAATGATGATTACTGGAATGGTCGTCCGCAACTGGATCGCCTGGTGTTCTCTATCACGCCTGATGCCTCTGTCCGCTATGCTAAATTGCAGAAAAATGAATGTCAGGTAATGCCGTACCCGAACCCGGCTGATTTGGATCGCATGCGCGCGGATAAAAACATTGTACTGAAAGAGCAGCCAGGGCTGAATGTCGGCTATCTCTCTTATAACGTTGAGAAAAAACCACTGGATAATGTCAAAGTCCGCCAGGCGCTGAGCATGGCCGTGAATAAAGACGCTATTATCGAAGCGGTTTACCAGGGAGCAGGACAGAAAGCGAAAAATCTGATTCCGCCAACCATGTGGGGCTATAACAAAGACTTACAGGACTATCCGTACGATCCTGAAAAAGCAAAAGCATTGCTGAAAGAAGCCGGAATGGAAAACGGGTTTGAAATTGACCTGTGGGCAATGCCGGTTCAGCGTCCGTATAACCCGAATGCGCGTCGTATGGCTGAGATGATCCAGGCTGACTGGGCGAAAGTCGGCGTGAAAGCCAAAATCGTAACCTATGAGTGGGGTGAGTACCTCAAGCGCGCGAAAGCGGGTGAACCTCAGACAGTGATGATGGGCTGGACAGGCGACAACGGGGATCCGGATAACTTCTTCGCGACACTCTTCAGCTGTGCCGCGAAAGAACAGGGTTCGAATTACTCAAAATGGTGTGATCAATCCTTTGAAAACATCATCCTGCCGGCGCGTACCACCGCTGATCCGAAAGAGCGCGCCAAGCTGTATGAGCAGGCTCAGGTCGTGATGAAAGAGCAGGAACCGGCGCTGATTGTTGCGCACTCCACAGTGTATGAGCCTGTCCGCAAAGAAGTGAAAGGCTATGTGGTTGATCCGCTGGGCAAACATCACTTTGATAAAGTCTCAATCGAAAAATAATAAGTCAGTAATTAGTGTCTCCGGTTCGCCGTCTTTATAAGGGCGGCGAA