Homologs in group_1616

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10660 FBDBKF_10660 97.0 Morganella morganii S1 poxB ubiquinone-dependent pyruvate dehydrogenase
EHELCC_14995 EHELCC_14995 97.0 Morganella morganii S2 poxB ubiquinone-dependent pyruvate dehydrogenase
NLDBIP_14825 NLDBIP_14825 97.0 Morganella morganii S4 poxB ubiquinone-dependent pyruvate dehydrogenase
LHKJJB_14520 LHKJJB_14520 97.0 Morganella morganii S3 poxB ubiquinone-dependent pyruvate dehydrogenase
HKOGLL_13140 HKOGLL_13140 97.0 Morganella morganii S5 poxB ubiquinone-dependent pyruvate dehydrogenase
PMI_RS15995 PMI_RS15995 82.9 Proteus mirabilis HI4320 poxB ubiquinone-dependent pyruvate dehydrogenase

Distribution of the homologs in the orthogroup group_1616

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1616

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P07003 0.0 871 74 1 573 1 poxB Pyruvate dehydrogenase [ubiquinone] Escherichia coli (strain K12)
P10343 1.46e-145 428 62 2 353 4 None Uncharacterized 42.6 kDa protein in isoamylase 3'region Pseudomonas amyloderamosa
P96591 1.68e-110 345 36 5 571 2 ydaP Putative thiamine pyrophosphate-containing protein YdaP Bacillus subtilis (strain 168)
Q54970 4.07e-65 226 29 3 513 3 spxB Pyruvate oxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P37063 3.46e-64 224 30 11 547 1 pox5 Pyruvate oxidase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q57725 4.43e-57 204 28 14 560 3 ilvB Probable acetolactate synthase large subunit Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q41768 2.16e-56 203 28 10 559 3 ALS1 Acetolactate synthase 1, chloroplastic Zea mays
P37251 2.76e-56 202 27 9 550 1 ilvB Acetolactate synthase large subunit Bacillus subtilis (strain 168)
P27868 2.57e-55 199 28 14 556 3 ilvY Acetolactate synthase (Fragment) Arthrospira platensis
Q6K2E8 4.68e-55 200 28 10 553 2 ALS1 Acetolactate synthase 1, chloroplastic Oryza sativa subsp. japonica
Q7U5G1 1.08e-54 198 30 18 561 3 ilvB Acetolactate synthase large subunit Parasynechococcus marenigrum (strain WH8102)
P0DP90 2.52e-54 196 29 10 543 1 ilvG Acetolactate synthase isozyme 2 large subunit Escherichia coli (strain K12)
P17597 4.77e-54 197 27 7 555 1 ALS Acetolactate synthase, chloroplastic Arabidopsis thaliana
P0A623 9.03e-54 196 28 10 555 3 ilvB Acetolactate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WG41 9.03e-54 196 28 10 555 1 ilvB1 Acetolactate synthase large subunit IlvB1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG40 9.03e-54 196 28 10 555 3 ilvB1 Acetolactate synthase large subunit IlvB1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P27819 4.85e-53 194 27 9 559 3 None Acetolactate synthase 3, chloroplastic Brassica napus
P27818 6.98e-53 194 27 9 559 3 None Acetolactate synthase 1, chloroplastic Brassica napus
Q41769 8.82e-53 193 27 9 551 3 ALS2 Acetolactate synthase 2, chloroplastic Zea mays
P42463 9.24e-52 190 26 11 560 3 ilvB Acetolactate synthase large subunit Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P69684 1.38e-51 189 27 12 547 3 ilvB Acetolactate synthase large subunit Porphyra umbilicalis
P69683 1.38e-51 189 27 12 547 3 ilvB Acetolactate synthase large subunit Porphyra purpurea
O19929 2.2e-51 189 28 12 559 3 ilvB Acetolactate synthase large subunit Cyanidium caldarium
P09114 2.31e-51 190 27 9 549 1 ALS Acetolactate synthase 2, chloroplastic Nicotiana tabacum SURB
P09342 2.76e-51 190 27 9 549 1 ALS Acetolactate synthase 1, chloroplastic Nicotiana tabacum SURA
O08353 1.18e-50 187 27 13 569 3 ilvB Probable acetolactate synthase large subunit Methanococcus aeolicus
Q93PS3 1.68e-50 186 27 12 565 1 xsc Sulfoacetaldehyde acetyltransferase Desulfonispora thiosulfatigenes
P14874 2.4e-50 187 26 9 554 3 None Acetolactate synthase 2, chloroplastic Brassica napus
Q7XKQ8 3.3e-50 187 28 9 563 2 ALS2 Probable acetolactate synthase 2, chloroplastic Oryza sativa subsp. japonica
Q1XDF6 1.38e-49 184 26 12 550 3 ilvB Acetolactate synthase large subunit Neopyropia yezoensis
O33112 9.13e-49 182 27 11 557 3 ilvB Acetolactate synthase Mycobacterium leprae (strain TN)
P00893 1.12e-48 181 27 9 557 1 ilvI Acetolactate synthase isozyme 3 large subunit Escherichia coli (strain K12)
O78518 2.69e-48 180 26 11 547 3 ilvB Acetolactate synthase large subunit Guillardia theta
P07342 6.57e-48 181 26 11 557 1 ILV2 Acetolactate synthase catalytic subunit, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q59498 7.08e-47 177 26 11 556 3 ilvB Acetolactate synthase Mycobacterium avium
P40811 8.78e-46 173 26 9 557 3 ilvI Acetolactate synthase isozyme 3 large subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P08142 1.06e-43 167 26 10 557 1 ilvB Acetolactate synthase isozyme 1 large subunit Escherichia coli (strain K12)
P36620 1.66e-43 168 26 12 562 3 ilv1 Acetolactate synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A2I2F2I5 2.08e-43 168 25 10 561 3 cfoL Acetolactate synthase catalytic subunit, mitochondrial Aspergillus candidus
Q89AP7 3.19e-43 166 26 12 558 3 ilvI Acetolactate synthase large subunit Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O85293 6.42e-43 165 25 9 554 3 ilvI Acetolactate synthase large subunit Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q02137 4.56e-42 162 26 10 544 3 ilvB Acetolactate synthase large subunit Lactococcus lactis subsp. lactis (strain IL1403)
P45261 6.2e-42 162 25 8 555 3 ilvI Acetolactate synthase large subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57321 3.05e-40 157 25 9 554 3 ilvI Acetolactate synthase large subunit Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9RQ65 2.07e-39 155 25 11 555 3 ilvI Acetolactate synthase large subunit Buchnera aphidicola subsp. Schlechtendalia chinensis
P27696 6.77e-38 150 25 9 533 1 budB Acetolactate synthase, catabolic Klebsiella pneumoniae
Q04789 1.33e-37 150 25 8 537 2 alsS Acetolactate synthase Bacillus subtilis (strain 168)
Q6SSJ3 3.05e-37 150 24 13 566 3 ILV2 Acetolactate synthase, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q5KPJ5 5.79e-36 146 23 13 566 3 ILV2 Acetolactate synthase, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
D5AKX8 4.63e-34 140 24 13 575 2 xsc Sulfoacetaldehyde acetyltransferase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q84H44 4.72e-34 140 24 14 579 1 xsc Sulfoacetaldehyde acetyltransferase Castellaniella defragrans
Q04524 4.8e-34 139 24 7 529 3 budB Acetolactate synthase, catabolic Raoultella terrigena
Q9UJ83 6.28e-32 133 26 19 568 1 HACL1 2-hydroxyacyl-CoA lyase 1 Homo sapiens
Q92UW6 1.25e-31 132 26 16 574 3 xsc Probable sulfoacetaldehyde acetyltransferase Rhizobium meliloti (strain 1021)
Q8CHM7 2.32e-31 132 26 22 565 1 Hacl1 2-hydroxyacyl-CoA lyase 1 Rattus norvegicus
P0AEP7 2.49e-30 129 24 14 559 1 gcl Glyoxylate carboligase Escherichia coli (strain K12)
P0AEP8 2.49e-30 129 24 14 559 3 gcl Glyoxylate carboligase Escherichia coli O157:H7
A3SR25 4.86e-29 125 23 15 578 1 xsc Sulfoacetaldehyde acetyltransferase Roseovarius nubinhibens (strain ATCC BAA-591 / DSM 15170 / ISM)
Q9QXE0 1.48e-28 123 25 22 564 1 Hacl1 2-hydroxyacyl-CoA lyase 1 Mus musculus
P0DP89 1.35e-27 117 29 7 329 5 ilvG Putative acetolactate synthase isozyme 2 large subunit Escherichia coli (strain K12)
Q84H41 5.47e-27 119 23 14 574 1 xsc Sulfoacetaldehyde acetyltransferase Alcaligenes xylosoxydans xylosoxydans
Q4V1F5 6.08e-27 119 23 15 576 3 iolD2 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase 2 Bacillus cereus (strain ZK / E33L)
O06335 3.67e-26 116 25 18 559 2 ilvB2 Putative acetolactate synthase large subunit IlvB2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0DUV9 4.56e-24 110 23 13 553 1 None 2-hydroxyacyl-CoA lyase Actinomycetospora chiangmaiensis (strain DSM 45062 / JCM 15998 / CCTCC AA 205017 / NBRC 104400 / YIM 0006)
B7JPM3 2.62e-23 107 23 16 581 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus cereus (strain AH820)
Q63B73 3.14e-23 107 22 16 571 3 iolD1 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase 1 Bacillus cereus (strain ZK / E33L)
C1EVJ3 5.55e-23 107 22 16 565 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus cereus (strain 03BB102)
A0REB6 5.55e-23 107 22 16 565 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus thuringiensis (strain Al Hakam)
Q54DA9 9.41e-23 105 22 17 523 3 hacl1 2-hydroxyacyl-CoA lyase 1 Dictyostelium discoideum
Q81QB5 1.28e-22 105 23 16 575 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus anthracis
C3LHY1 1.28e-22 105 23 16 575 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PAZ3 1.28e-22 105 23 16 575 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus anthracis (strain A0248)
Q6HIK2 1.38e-22 105 23 16 575 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus thuringiensis subsp. konkukian (strain 97-27)
P9WG39 2.45e-22 104 24 10 531 1 ilvG Acetolactate synthase large subunit IlvG Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG38 2.45e-22 104 24 10 531 3 ilvG Acetolactate synthase large subunit IlvG Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66947 2.45e-22 104 24 10 531 3 ilvG Probable acetolactate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q723S8 5.12e-22 103 24 18 547 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Listeria monocytogenes serotype 4b (strain F2365)
Q9HUI8 9.93e-22 102 24 14 534 1 aruI Probable 2-ketoarginine decarboxylase AruI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42415 1.21e-20 99 23 15 537 1 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus subtilis (strain 168)
Q8Y9Y1 1.43e-20 99 23 14 536 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0CH62 3e-20 98 22 11 561 1 None Cyclohexane-1,2-dione hydrolase Azoarcus sp.
Q9P7P6 4.4e-20 97 22 19 553 3 SPAC186.09 Probable pyruvate decarboxylase C186.09 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A4IPB6 1.71e-19 95 25 24 584 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Geobacillus thermodenitrificans (strain NG80-2)
Q9LF46 3.65e-19 94 23 13 553 1 HACL 2-hydroxyacyl-CoA lyase Arabidopsis thaliana
Q5WKY8 4.08e-19 94 22 14 537 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Shouchella clausii (strain KSM-K16)
P0AFI0 4.54e-18 91 24 14 544 1 oxc Oxalyl-CoA decarboxylase Escherichia coli (strain K12)
P0AFI1 4.54e-18 91 24 14 544 3 oxc Oxalyl-CoA decarboxylase Escherichia coli O157:H7
O61856 6e-18 91 21 14 589 3 T26C12.1 2-hydroxyacyl-CoA lyase 2 Caenorhabditis elegans
Q8XP76 6.53e-18 90 21 18 562 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium perfringens (strain 13 / Type A)
Q92EQ4 1.12e-17 90 23 19 547 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A5YBJ6 1.14e-17 90 21 17 534 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Lacticaseibacillus casei
P39994 1.39e-17 89 22 12 485 1 PXP1 2-hydroxyacyl-CoA lyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5KYR0 1.65e-17 89 23 24 595 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Geobacillus kaustophilus (strain HTA426)
Q9KAG9 1.7e-17 89 21 12 522 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q65D03 3.88e-17 88 21 15 543 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q0TUZ2 4.33e-17 88 21 18 562 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q9HUR2 1.83e-16 86 26 11 417 3 mdlC Benzoylformate decarboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P20906 3.28e-16 85 26 13 354 1 mdlC Benzoylformate decarboxylase Pseudomonas putida
P33287 3.47e-16 85 21 19 567 1 cfp Pyruvate decarboxylase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A7ZAH8 3.71e-16 85 23 17 538 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P40149 2.1e-15 82 22 15 558 1 oxc Oxalyl-CoA decarboxylase Oxalobacter formigenes
B2V4K0 4.21e-15 82 21 16 540 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium botulinum (strain Alaska E43 / Type E3)
P51853 4.79e-15 81 25 6 266 1 bznB Benzaldehyde lyase Pseudomonas fluorescens
Q58077 8.25e-15 80 20 18 543 3 MJ0663 Uncharacterized protein MJ0663 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9Y7M1 1.33e-14 80 23 16 562 3 hac1 2-hydroxyacyl-CoA lyase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6NV04 1.94e-14 80 21 13 555 2 ilvbl 2-hydroxyacyl-CoA lyase 2 Danio rerio
A1L0T0 3.29e-14 79 22 17 581 1 ILVBL 2-hydroxyacyl-CoA lyase 2 Homo sapiens
Q9LCV9 9.67e-14 77 23 15 535 1 ceaS N(2)-(2-carboxyethyl)arginine synthase Streptomyces clavuligerus
A6QQT9 9.71e-14 77 22 15 576 2 ILVBL 2-hydroxyacyl-CoA lyase 2 Bos taurus
P51852 2.66e-13 76 23 15 538 1 ipdC Indole-3-pyruvate decarboxylase Azospirillum brasilense
B2TJ86 2.81e-13 76 21 16 540 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium botulinum (strain Eklund 17B / Type B)
Q8BU33 7.16e-13 75 23 14 504 1 Ilvbl 2-hydroxyacyl-CoA lyase 2 Mus musculus
Q92345 1.17e-12 74 22 20 559 1 SPAC1F8.07c Probable pyruvate decarboxylase C1F8.07c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q898E8 6.54e-11 68 20 17 557 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium tetani (strain Massachusetts / E88)
Q0JMH0 9.19e-11 68 23 17 554 3 Os01g0505400 2-hydroxyacyl-CoA lyase Oryza sativa subsp. japonica
O05031 3.43e-08 58 26 3 157 5 HI_0737 Putative uncharacterized protein HI_0737 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q742Q2 1.35e-07 58 23 19 553 3 kdc Alpha-keto-acid decarboxylase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P06672 1.82e-07 57 21 21 570 1 pdc Pyruvate decarboxylase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A0QBE6 4.2e-07 56 23 19 553 3 kdc Alpha-keto-acid decarboxylase Mycobacterium avium (strain 104)
P51850 6.8e-07 55 21 19 542 2 PDC1 Pyruvate decarboxylase 1 Pisum sativum
P87208 1.06e-06 55 21 21 521 3 pdcA Pyruvate decarboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P23234 1.58e-06 54 22 19 561 1 ipdC Indole-3-pyruvate decarboxylase Enterobacter cloacae
Q9CBD6 1.99e-06 54 23 19 554 3 kdc Alpha-keto-acid decarboxylase Mycobacterium leprae (strain TN)
Q09737 2.3e-06 54 26 10 242 3 SPAC13A11.06 Putative pyruvate decarboxylase C13A11.06 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O53554 3.24e-06 53 33 2 111 1 ilvX Putative acetolactate synthase large subunit IlvX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q07471 3.36e-06 53 20 17 490 1 THI3 Thiamine metabolism regulatory protein THI3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P51846 8.87e-06 52 20 22 587 2 PDC2 Pyruvate decarboxylase 2 Nicotiana tabacum
P83779 1.1e-05 52 19 16 481 1 PDC11 Pyruvate decarboxylase Candida albicans (strain SC5314 / ATCC MYA-2876)
P26263 1.19e-05 52 19 20 579 1 PDC6 Pyruvate decarboxylase isozyme 3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P33149 4e-05 50 20 15 501 3 PDC1 Pyruvate decarboxylase Kluyveromyces marxianus
P06169 5.31e-05 49 20 17 498 1 PDC1 Pyruvate decarboxylase isozyme 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FJA3 5.6e-05 49 20 19 539 1 PDC1 Pyruvate decarboxylase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O42873 5.72e-05 49 35 2 99 3 SPAC3G9.11c Putative pyruvate decarboxylase C3G9.11c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P34734 7.38e-05 49 20 17 500 3 PDC Pyruvate decarboxylase Hanseniaspora uvarum
Q9M040 0.0003 47 20 19 561 2 PDC4 Pyruvate decarboxylase 4 Arabidopsis thaliana
P9WG37 0.000358 47 33 1 95 1 kdc Alpha-keto-acid decarboxylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG36 0.000358 47 33 1 95 3 kdc Alpha-keto-acid decarboxylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U0P1 0.000358 47 33 1 95 3 kdc Alpha-keto-acid decarboxylase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KGY5 0.000358 47 33 1 95 3 kdc Alpha-keto-acid decarboxylase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U140 0.000358 47 33 1 95 3 kdc Alpha-keto-acid decarboxylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9FFT4 0.000414 47 20 18 506 2 PDC2 Pyruvate decarboxylase 2 Arabidopsis thaliana
Q12629 0.000673 46 20 16 486 1 PDC1 Pyruvate decarboxylase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14370
Feature type CDS
Gene poxB
Product ubiquinone-dependent pyruvate dehydrogenase
Location 101597 - 103318 (strand: 1)
Length 1722 (nucleotides) / 573 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1616
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00205 Thiamine pyrophosphate enzyme, central domain
PF02775 Thiamine pyrophosphate enzyme, C-terminal TPP binding domain
PF02776 Thiamine pyrophosphate enzyme, N-terminal TPP binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0028 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)		 EH Acetolactate synthase large subunit or other thiamine pyrophosphate-requiring enzyme

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00156 pyruvate dehydrogenase (quinone) [EC:1.2.5.1] Pyruvate metabolism
Metabolic pathways		 -

Protein Sequence

MKQTVAGYIAKMLADAGINRIWGVTGDSLNGLSDSLRKLGTIEWMGTRHEEVAAFAAGAEAHLTGRLAVCAGSCGPGNLHLINGLFDCQRNRVPVLAIAAHIPSGEIGSHYFQETHPQELFRECSVYCELVSNPEQIQQVLGIAMRKAILERGVAVVVIPGDVALKPAPESARNVWYEPSLPLVMPQRDELVKLADALNGAKNITLMCGAGCAGAHDEVLKLAETLKAPVVHALRGKEYLEYDNPYSVGMTGLIGFSSGYYAMENAGTLVLLGTHFPYRAFYPAKAKIIQVDINPGSLGAHCAVDMAVIGDIKATLNAIQPRLRAKEDRTHLDNALKHYQTARSDLDALATASKRELIHPQYLAKKISELANDDTVFTCDVGTPTVWAARYLTMNGKRRLIGSFNHGSMANAMAQAIGAQAIDRKRQVVAMCGDGGFSMLMGDFISLAQMKLPVKIVIFNNSVLGFVAMEMKAGGYLTDGTDLHNPDFAAMANAMGIKGIRVEDSELLDDALKTAFAHDGPVLVDVVTAKQELAMPPDIKFEQAKGFSLYMLRAIINGRGDEIVDLAKTNWLR

Flanking regions ( +/- flanking 50bp)

ACACCATTTTCCGAATCAGATTTGATAACCAGTAAGAGGGAAGGTTTACGATGAAGCAGACAGTCGCGGGTTATATCGCAAAAATGTTGGCGGATGCAGGAATCAACCGTATCTGGGGTGTCACAGGAGACTCGCTGAACGGGTTGAGTGACAGTTTACGCAAATTAGGCACGATTGAATGGATGGGAACACGGCATGAAGAGGTTGCGGCATTTGCCGCAGGTGCAGAAGCGCACCTGACCGGCAGGCTGGCAGTCTGTGCCGGTTCTTGTGGTCCCGGAAATCTCCATTTAATTAACGGGTTATTTGATTGTCAGCGTAACCGCGTACCGGTACTGGCGATTGCGGCGCATATTCCTTCCGGTGAGATTGGCAGCCATTATTTCCAGGAAACTCATCCGCAGGAATTATTCCGTGAATGCAGTGTTTATTGTGAGCTGGTGTCAAACCCGGAGCAGATTCAGCAGGTTCTGGGAATTGCCATGCGCAAAGCCATTCTTGAGCGGGGTGTGGCAGTTGTGGTTATCCCGGGGGATGTGGCGTTAAAACCTGCGCCGGAATCTGCCCGTAATGTCTGGTATGAACCCTCTCTGCCATTGGTGATGCCGCAGCGGGATGAACTGGTGAAGCTGGCGGATGCTCTCAATGGTGCGAAAAATATCACACTGATGTGTGGCGCGGGATGTGCCGGCGCACATGATGAAGTACTTAAACTGGCAGAAACACTGAAAGCCCCGGTGGTACATGCACTGCGGGGCAAAGAGTATCTGGAATACGATAATCCGTACAGTGTGGGAATGACCGGGCTTATCGGATTTTCGTCCGGTTACTATGCGATGGAAAATGCCGGTACTCTGGTGCTGCTCGGTACACATTTTCCGTATCGTGCCTTTTATCCGGCAAAAGCAAAAATTATTCAGGTGGATATCAACCCCGGCAGTCTCGGCGCGCACTGTGCTGTGGATATGGCTGTCATCGGGGATATCAAAGCTACTCTTAACGCGATCCAGCCCCGGTTGCGGGCTAAAGAAGACCGTACGCATCTTGATAATGCCCTGAAGCACTATCAGACTGCCCGCAGTGACCTGGATGCGCTGGCAACAGCAAGCAAACGGGAGCTTATCCACCCGCAGTATCTGGCGAAAAAAATCAGCGAGCTGGCAAATGACGATACTGTCTTCACCTGTGATGTCGGTACGCCGACTGTCTGGGCGGCACGTTATCTCACCATGAACGGGAAGCGACGGCTTATCGGCTCCTTTAATCACGGTTCGATGGCAAATGCGATGGCGCAGGCTATCGGCGCGCAGGCAATTGATCGCAAACGCCAGGTGGTAGCCATGTGTGGTGACGGCGGATTCAGTATGCTGATGGGCGATTTTATTTCGCTGGCACAAATGAAACTGCCGGTGAAAATTGTCATCTTTAACAATAGTGTATTGGGTTTTGTCGCGATGGAGATGAAAGCAGGCGGTTATTTAACGGATGGCACTGATCTGCATAATCCGGATTTTGCGGCTATGGCAAATGCAATGGGTATCAAAGGGATACGGGTTGAAGACAGTGAGTTACTGGATGATGCCCTGAAAACGGCATTTGCTCATGATGGCCCGGTTCTGGTGGATGTGGTTACCGCTAAACAGGAGCTGGCGATGCCGCCGGACATTAAATTTGAACAGGCTAAAGGATTCAGTCTTTATATGCTGCGCGCGATTATTAACGGGCGGGGTGATGAGATTGTCGATTTGGCAAAAACCAACTGGTTGCGCTGATACTATCTGAAGTTGCCGCAGTGTATCTGCGGCACTTTAATGCCTGTTAA