Homologs in group_1616

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10660 FBDBKF_10660 82.2 Morganella morganii S1 poxB ubiquinone-dependent pyruvate dehydrogenase
EHELCC_14995 EHELCC_14995 82.2 Morganella morganii S2 poxB ubiquinone-dependent pyruvate dehydrogenase
NLDBIP_14825 NLDBIP_14825 82.2 Morganella morganii S4 poxB ubiquinone-dependent pyruvate dehydrogenase
LHKJJB_14520 LHKJJB_14520 82.2 Morganella morganii S3 poxB ubiquinone-dependent pyruvate dehydrogenase
HKOGLL_13140 HKOGLL_13140 82.2 Morganella morganii S5 poxB ubiquinone-dependent pyruvate dehydrogenase
F4V73_RS14370 F4V73_RS14370 82.9 Morganella psychrotolerans poxB ubiquinone-dependent pyruvate dehydrogenase

Distribution of the homologs in the orthogroup group_1616

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1616

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P07003 0.0 885 74 1 572 1 poxB Pyruvate dehydrogenase [ubiquinone] Escherichia coli (strain K12)
P10343 9.59e-151 441 61 2 358 4 None Uncharacterized 42.6 kDa protein in isoamylase 3'region Pseudomonas amyloderamosa
P96591 1.44e-108 340 36 6 576 2 ydaP Putative thiamine pyrophosphate-containing protein YdaP Bacillus subtilis (strain 168)
Q54970 8.87e-76 254 29 5 546 3 spxB Pyruvate oxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P37063 7.75e-70 239 30 10 534 1 pox5 Pyruvate oxidase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P37251 1.95e-63 221 28 7 542 1 ilvB Acetolactate synthase large subunit Bacillus subtilis (strain 168)
P27819 1.22e-60 215 28 9 554 3 None Acetolactate synthase 3, chloroplastic Brassica napus
P27818 1.64e-60 215 28 9 554 3 None Acetolactate synthase 1, chloroplastic Brassica napus
Q57725 1.13e-59 211 27 12 560 3 ilvB Probable acetolactate synthase large subunit Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P27868 1.39e-59 211 28 14 573 3 ilvY Acetolactate synthase (Fragment) Arthrospira platensis
P17597 5.2e-59 211 27 8 554 1 ALS Acetolactate synthase, chloroplastic Arabidopsis thaliana
O19929 2.88e-58 207 28 11 541 3 ilvB Acetolactate synthase large subunit Cyanidium caldarium
Q41768 1.81e-57 206 27 9 554 3 ALS1 Acetolactate synthase 1, chloroplastic Zea mays
O78518 3.89e-57 204 27 11 540 3 ilvB Acetolactate synthase large subunit Guillardia theta
P09114 5.38e-57 206 27 7 550 1 ALS Acetolactate synthase 2, chloroplastic Nicotiana tabacum SURB
Q6K2E8 5.49e-57 205 27 8 551 2 ALS1 Acetolactate synthase 1, chloroplastic Oryza sativa subsp. japonica
P0DP90 7.14e-57 203 28 11 542 1 ilvG Acetolactate synthase isozyme 2 large subunit Escherichia coli (strain K12)
P0A623 7.26e-57 204 27 10 560 3 ilvB Acetolactate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WG41 7.26e-57 204 27 10 560 1 ilvB1 Acetolactate synthase large subunit IlvB1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG40 7.26e-57 204 27 10 560 3 ilvB1 Acetolactate synthase large subunit IlvB1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P42463 7.74e-57 204 28 13 563 3 ilvB Acetolactate synthase large subunit Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P14874 9.09e-57 204 27 9 554 3 None Acetolactate synthase 2, chloroplastic Brassica napus
P09342 9.24e-57 205 26 7 550 1 ALS Acetolactate synthase 1, chloroplastic Nicotiana tabacum SURA
Q41769 8.9e-56 202 27 8 554 3 ALS2 Acetolactate synthase 2, chloroplastic Zea mays
Q7U5G1 1.39e-55 201 28 14 563 3 ilvB Acetolactate synthase large subunit Parasynechococcus marenigrum (strain WH8102)
O08353 1.03e-54 198 28 12 570 3 ilvB Probable acetolactate synthase large subunit Methanococcus aeolicus
P00893 1.66e-53 194 28 9 557 1 ilvI Acetolactate synthase isozyme 3 large subunit Escherichia coli (strain K12)
Q7XKQ8 2.81e-53 195 26 9 568 2 ALS2 Probable acetolactate synthase 2, chloroplastic Oryza sativa subsp. japonica
P40811 6.06e-53 192 27 9 557 3 ilvI Acetolactate synthase isozyme 3 large subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O33112 1.05e-52 193 27 11 548 3 ilvB Acetolactate synthase Mycobacterium leprae (strain TN)
P69684 7.88e-51 187 27 12 549 3 ilvB Acetolactate synthase large subunit Porphyra umbilicalis
P69683 7.88e-51 187 27 12 549 3 ilvB Acetolactate synthase large subunit Porphyra purpurea
Q1XDF6 9.83e-51 187 27 12 560 3 ilvB Acetolactate synthase large subunit Neopyropia yezoensis
O85293 4.88e-50 184 26 8 554 3 ilvI Acetolactate synthase large subunit Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q93PS3 7.07e-50 184 26 11 557 1 xsc Sulfoacetaldehyde acetyltransferase Desulfonispora thiosulfatigenes
Q59498 3.38e-49 183 27 13 544 3 ilvB Acetolactate synthase Mycobacterium avium
P45261 3.26e-47 177 26 11 563 3 ilvI Acetolactate synthase large subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q89AP7 1.01e-46 176 26 11 556 3 ilvI Acetolactate synthase large subunit Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A0A2I2F2I5 1.47e-46 177 27 10 555 3 cfoL Acetolactate synthase catalytic subunit, mitochondrial Aspergillus candidus
P36620 8.3e-46 174 26 10 560 3 ilv1 Acetolactate synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P08142 3.7e-45 171 25 10 560 1 ilvB Acetolactate synthase isozyme 1 large subunit Escherichia coli (strain K12)
P07342 4.11e-45 172 25 13 564 1 ILV2 Acetolactate synthase catalytic subunit, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P57321 2.16e-44 169 25 9 554 3 ilvI Acetolactate synthase large subunit Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9RQ65 2.7e-44 169 26 11 556 3 ilvI Acetolactate synthase large subunit Buchnera aphidicola subsp. Schlechtendalia chinensis
Q02137 5.6e-43 165 26 11 547 3 ilvB Acetolactate synthase large subunit Lactococcus lactis subsp. lactis (strain IL1403)
Q6SSJ3 5.73e-41 161 24 14 560 3 ILV2 Acetolactate synthase, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P0AEP7 1.22e-40 159 26 14 580 1 gcl Glyoxylate carboligase Escherichia coli (strain K12)
P0AEP8 1.22e-40 159 26 14 580 3 gcl Glyoxylate carboligase Escherichia coli O157:H7
Q5KPJ5 2.19e-40 159 24 12 562 3 ILV2 Acetolactate synthase, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P27696 1.17e-39 155 24 8 545 1 budB Acetolactate synthase, catabolic Klebsiella pneumoniae
Q04789 1.54e-36 147 25 12 543 2 alsS Acetolactate synthase Bacillus subtilis (strain 168)
Q04524 2.03e-36 146 25 9 531 3 budB Acetolactate synthase, catabolic Raoultella terrigena
D5AKX8 5.35e-35 142 23 13 570 2 xsc Sulfoacetaldehyde acetyltransferase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q92UW6 5.93e-35 142 25 18 579 3 xsc Probable sulfoacetaldehyde acetyltransferase Rhizobium meliloti (strain 1021)
Q84H44 1.03e-34 142 24 13 563 1 xsc Sulfoacetaldehyde acetyltransferase Castellaniella defragrans
Q84H41 1.39e-31 132 23 10 565 1 xsc Sulfoacetaldehyde acetyltransferase Alcaligenes xylosoxydans xylosoxydans
P0DP89 1.82e-31 127 29 7 329 5 ilvG Putative acetolactate synthase isozyme 2 large subunit Escherichia coli (strain K12)
A3SR25 4.64e-29 125 22 15 577 1 xsc Sulfoacetaldehyde acetyltransferase Roseovarius nubinhibens (strain ATCC BAA-591 / DSM 15170 / ISM)
Q8CHM7 3.11e-28 122 23 16 557 1 Hacl1 2-hydroxyacyl-CoA lyase 1 Rattus norvegicus
Q9QXE0 2.12e-26 117 23 15 556 1 Hacl1 2-hydroxyacyl-CoA lyase 1 Mus musculus
Q9P7P6 2.45e-26 116 23 18 557 3 SPAC186.09 Probable pyruvate decarboxylase C186.09 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UJ83 6.46e-26 115 23 17 559 1 HACL1 2-hydroxyacyl-CoA lyase 1 Homo sapiens
Q4V1F5 1.09e-24 112 23 21 596 3 iolD2 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase 2 Bacillus cereus (strain ZK / E33L)
O06335 3.42e-24 110 22 15 556 2 ilvB2 Putative acetolactate synthase large subunit IlvB2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B7JPM3 8.56e-24 109 23 20 595 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus cereus (strain AH820)
C1EVJ3 1.35e-23 108 23 20 590 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus cereus (strain 03BB102)
A0REB6 1.35e-23 108 23 20 590 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus thuringiensis (strain Al Hakam)
Q9HUI8 1.94e-23 107 24 15 538 1 aruI Probable 2-ketoarginine decarboxylase AruI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54DA9 2.82e-23 107 21 14 522 3 hacl1 2-hydroxyacyl-CoA lyase 1 Dictyostelium discoideum
Q63B73 3.02e-23 107 23 21 596 3 iolD1 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase 1 Bacillus cereus (strain ZK / E33L)
Q81QB5 7.37e-23 106 23 19 585 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus anthracis
C3LHY1 7.37e-23 106 23 19 585 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PAZ3 7.37e-23 106 23 19 585 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus anthracis (strain A0248)
Q6HIK2 7.91e-23 106 23 19 585 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q5WKY8 9.54e-23 106 22 14 538 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Shouchella clausii (strain KSM-K16)
P42415 6.65e-22 103 22 14 516 1 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus subtilis (strain 168)
A4IPB6 2.28e-21 101 23 16 569 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Geobacillus thermodenitrificans (strain NG80-2)
P20906 5.14e-21 100 24 16 473 1 mdlC Benzoylformate decarboxylase Pseudomonas putida
Q0TUZ2 8.4e-21 100 22 18 562 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A5YBJ6 9e-21 100 22 17 521 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Lacticaseibacillus casei
P0DUV9 1.81e-20 99 23 15 554 1 None 2-hydroxyacyl-CoA lyase Actinomycetospora chiangmaiensis (strain DSM 45062 / JCM 15998 / CCTCC AA 205017 / NBRC 104400 / YIM 0006)
Q8XP76 1.88e-20 99 21 18 562 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium perfringens (strain 13 / Type A)
P9WG39 2.28e-20 98 22 8 529 1 ilvG Acetolactate synthase large subunit IlvG Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG38 2.28e-20 98 22 8 529 3 ilvG Acetolactate synthase large subunit IlvG Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66947 2.28e-20 98 22 8 529 3 ilvG Probable acetolactate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0CH62 2.84e-20 98 22 12 562 1 None Cyclohexane-1,2-dione hydrolase Azoarcus sp.
Q723S8 4.43e-20 97 22 14 518 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Listeria monocytogenes serotype 4b (strain F2365)
P0AFI0 4.58e-20 97 22 12 537 1 oxc Oxalyl-CoA decarboxylase Escherichia coli (strain K12)
P0AFI1 4.58e-20 97 22 12 537 3 oxc Oxalyl-CoA decarboxylase Escherichia coli O157:H7
Q65D03 5.37e-20 97 22 12 513 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8Y9Y1 4.34e-19 94 22 14 527 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5KYR0 5.1e-19 94 23 24 581 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Geobacillus kaustophilus (strain HTA426)
Q9KAG9 5.49e-19 94 20 13 508 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q58077 6.98e-19 93 23 18 543 3 MJ0663 Uncharacterized protein MJ0663 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A7ZAH8 3.5e-18 92 22 16 522 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P39994 4.63e-18 91 22 13 487 1 PXP1 2-hydroxyacyl-CoA lyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O61856 6.41e-18 90 23 17 605 3 T26C12.1 2-hydroxyacyl-CoA lyase 2 Caenorhabditis elegans
Q898E8 4.02e-17 88 20 17 536 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium tetani (strain Massachusetts / E88)
Q92EQ4 7.17e-17 87 21 13 519 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9LF46 8.25e-17 87 22 12 551 1 HACL 2-hydroxyacyl-CoA lyase Arabidopsis thaliana
Q9HUR2 3.73e-16 85 25 13 414 3 mdlC Benzoylformate decarboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B2V4K0 5.73e-16 84 22 16 540 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium botulinum (strain Alaska E43 / Type E3)
Q6NV04 3.27e-15 82 23 17 553 2 ilvbl 2-hydroxyacyl-CoA lyase 2 Danio rerio
A1L0T0 3.45e-15 82 21 14 580 1 ILVBL 2-hydroxyacyl-CoA lyase 2 Homo sapiens
B2TJ86 4.86e-15 82 22 16 540 3 iolD 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Clostridium botulinum (strain Eklund 17B / Type B)
P51853 6.04e-15 81 22 17 569 1 bznB Benzaldehyde lyase Pseudomonas fluorescens
Q92345 2.29e-14 79 22 19 561 1 SPAC1F8.07c Probable pyruvate decarboxylase C1F8.07c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8BU33 6.19e-14 78 21 16 589 1 Ilvbl 2-hydroxyacyl-CoA lyase 2 Mus musculus
P40149 1.81e-13 76 22 13 533 1 oxc Oxalyl-CoA decarboxylase Oxalobacter formigenes
P83779 1.99e-13 76 22 19 481 1 PDC11 Pyruvate decarboxylase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9Y7M1 2.77e-13 76 22 15 547 3 hac1 2-hydroxyacyl-CoA lyase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LCV9 3.94e-13 75 22 15 523 1 ceaS N(2)-(2-carboxyethyl)arginine synthase Streptomyces clavuligerus
A6QQT9 9.67e-13 74 22 17 585 2 ILVBL 2-hydroxyacyl-CoA lyase 2 Bos taurus
P33287 4.95e-12 72 20 21 562 1 cfp Pyruvate decarboxylase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q09737 6.17e-12 72 24 19 494 3 SPAC13A11.06 Putative pyruvate decarboxylase C13A11.06 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P51850 4.1e-10 66 21 21 567 2 PDC1 Pyruvate decarboxylase 1 Pisum sativum
P34734 8.7e-10 65 21 17 495 3 PDC Pyruvate decarboxylase Hanseniaspora uvarum
P51852 2e-09 63 20 12 539 1 ipdC Indole-3-pyruvate decarboxylase Azospirillum brasilense
P26263 2.65e-09 63 22 24 582 1 PDC6 Pyruvate decarboxylase isozyme 3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0JMH0 8.49e-09 62 22 18 556 3 Os01g0505400 2-hydroxyacyl-CoA lyase Oryza sativa subsp. japonica
O42873 1.03e-08 61 23 10 299 3 SPAC3G9.11c Putative pyruvate decarboxylase C3G9.11c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P06672 1.19e-08 61 20 20 572 1 pdc Pyruvate decarboxylase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q6FJA3 1.48e-08 61 21 18 536 1 PDC1 Pyruvate decarboxylase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O05031 2.45e-08 58 29 1 132 5 HI_0737 Putative uncharacterized protein HI_0737 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23234 3.27e-08 60 22 21 568 1 ipdC Indole-3-pyruvate decarboxylase Enterobacter cloacae
Q12629 4.5e-08 59 21 19 502 1 PDC1 Pyruvate decarboxylase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9CBD6 6.19e-08 59 23 23 562 3 kdc Alpha-keto-acid decarboxylase Mycobacterium leprae (strain TN)
P33149 1.7e-07 57 19 14 495 3 PDC1 Pyruvate decarboxylase Kluyveromyces marxianus
Q2UKV4 2.05e-07 57 21 19 536 3 pdcA Pyruvate decarboxylase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P87208 2.54e-07 57 21 20 523 3 pdcA Pyruvate decarboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P06169 3.06e-07 57 22 19 495 1 PDC1 Pyruvate decarboxylase isozyme 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4WXX9 5e-07 56 20 23 568 3 pdcA Pyruvate decarboxylase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A2Y5L9 5.55e-07 56 21 23 566 2 PDC1 Pyruvate decarboxylase 1 Oryza sativa subsp. indica
Q0CNV1 8.94e-07 55 21 24 533 3 pdcA Pyruvate decarboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9FFT4 1.58e-06 54 20 17 559 2 PDC2 Pyruvate decarboxylase 2 Arabidopsis thaliana
Q0DHF6 1.6e-06 54 21 23 566 2 PDC1 Pyruvate decarboxylase 1 Oryza sativa subsp. japonica
Q9M039 2.31e-06 54 20 18 565 2 PDC3 Pyruvate decarboxylase 3 Arabidopsis thaliana
P9WG36 2.71e-06 53 23 23 561 3 kdc Alpha-keto-acid decarboxylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WG37 2.8e-06 53 23 23 561 1 kdc Alpha-keto-acid decarboxylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U0P1 2.8e-06 53 23 23 561 3 kdc Alpha-keto-acid decarboxylase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KGY5 2.8e-06 53 23 23 561 3 kdc Alpha-keto-acid decarboxylase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U140 2.8e-06 53 23 23 561 3 kdc Alpha-keto-acid decarboxylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q07471 3.09e-06 53 19 17 494 1 THI3 Thiamine metabolism regulatory protein THI3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16467 5.62e-06 52 21 19 509 1 PDC5 Pyruvate decarboxylase isozyme 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9M040 6.4e-06 52 20 20 564 2 PDC4 Pyruvate decarboxylase 4 Arabidopsis thaliana
P51846 1.01e-05 52 20 20 586 2 PDC2 Pyruvate decarboxylase 2 Nicotiana tabacum
O53554 1.73e-05 51 31 2 111 1 ilvX Putative acetolactate synthase large subunit IlvX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O82647 4.41e-05 50 20 18 565 2 PDC1 Pyruvate decarboxylase 1 Arabidopsis thaliana
A7NRP8 7.06e-05 49 19 16 571 3 menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase Roseiflexus castenholzii (strain DSM 13941 / HLO8)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15995
Feature type CDS
Gene poxB
Product ubiquinone-dependent pyruvate dehydrogenase
Location 3553868 - 3555592 (strand: 1)
Length 1725 (nucleotides) / 574 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1616
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00205 Thiamine pyrophosphate enzyme, central domain
PF02775 Thiamine pyrophosphate enzyme, C-terminal TPP binding domain
PF02776 Thiamine pyrophosphate enzyme, N-terminal TPP binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0028 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)		 EH Acetolactate synthase large subunit or other thiamine pyrophosphate-requiring enzyme

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00156 pyruvate dehydrogenase (quinone) [EC:1.2.5.1] Pyruvate metabolism
Metabolic pathways		 -

Protein Sequence

MSKQTVATYIAKVLHNAGVKRIWGVTGDSLNGLSDSLRKMGTIEWMGTRHEEVAAFAAGAEAAINGELAVCAGSCGPGNLHLINGLFDCHRNHVPVLAIAAHIPSAEIGSNYFQETHPQELFRECSHYCELVSNPDQIPQILAIAMRTAILKKGVAVVVLPGDVALKPAPEDAHENWYPLQSPLIMPNRFEIEKLSEALNNAKNITLMCGAGCAQAHDEVVKLAQTLKAPVVHALRGKEYLEWNNPCSVGMTGLIGFSSGYHAMENADTLVLLGTQFPYRAFYPAKANIIQIDLNPSSIGSHCHVDMAFVGDVKATLNALQPRLKEKTDTAHLDASLKHYAKARKDLDALAQPSERELIHPQYLARRLSELANDDAVFTCDVGTPTVWAARYVKMNGKRRLIGSFNHGSMANAMAQAIGIQALDRKRQVVAMCGDGGFTMLMGDFISLAQMNLPVKVVIFNNSVLGFVAMEMKAGGYLTDGTDLHNPDFAAIANAAGIKGIRVEKGEDLDEALKTAFEHDGPVIVDVVTAKQELSMPPEIKFEQAKGFSLYMMKAIINGRGDEIVQLAKTNWLR

Flanking regions ( +/- flanking 50bp)

GGGCAGCATGTAGAGAGATTACCCACTAAAATAAAAAGGAAATGCGTCACATGAGTAAGCAAACAGTTGCAACCTATATTGCTAAAGTGCTCCATAATGCAGGTGTGAAACGTATTTGGGGGGTGACGGGCGATTCATTGAATGGATTAAGTGATAGCTTGCGCAAAATGGGTACCATTGAATGGATGGGCACACGCCATGAAGAAGTCGCGGCTTTTGCCGCCGGAGCAGAAGCGGCTATCAATGGTGAATTAGCCGTTTGTGCCGGCTCCTGTGGACCAGGTAACTTACACTTAATTAATGGACTTTTTGATTGTCATCGTAATCATGTTCCCGTGTTAGCGATTGCCGCTCATATTCCCTCTGCTGAAATTGGTAGTAATTACTTTCAAGAAACTCATCCTCAAGAGTTGTTTCGTGAATGTAGTCACTATTGTGAATTAGTCTCTAATCCCGATCAGATCCCACAAATTCTGGCTATCGCTATGCGCACCGCTATTTTGAAAAAGGGTGTTGCGGTGGTGGTATTACCCGGTGATGTAGCGTTAAAACCCGCTCCAGAAGATGCCCATGAAAATTGGTATCCACTACAATCACCACTGATTATGCCGAATCGTTTTGAAATCGAAAAACTTTCTGAGGCACTGAATAACGCTAAAAATATCACCTTAATGTGTGGTGCCGGTTGTGCTCAAGCACATGATGAAGTGGTGAAACTAGCACAAACCTTAAAAGCCCCTGTTGTGCATGCACTACGTGGTAAAGAGTATCTTGAGTGGAATAATCCATGTAGCGTGGGAATGACGGGTCTTATCGGTTTTTCATCGGGTTATCACGCAATGGAGAATGCCGATACTTTAGTACTGTTAGGTACTCAATTCCCTTATCGCGCTTTCTATCCTGCCAAAGCTAATATTATTCAAATTGACCTTAATCCAAGTAGCATTGGCTCACATTGCCATGTGGATATGGCTTTTGTTGGAGATGTCAAAGCAACCCTTAATGCATTACAACCGCGATTAAAAGAGAAAACAGATACCGCACATCTTGATGCCTCGTTAAAACATTATGCTAAAGCACGCAAAGATTTAGATGCATTGGCTCAACCTAGTGAGCGTGAGTTGATCCACCCTCAGTATTTAGCACGTCGATTAAGTGAATTAGCCAACGATGATGCGGTATTTACCTGTGATGTTGGCACGCCAACAGTTTGGGCAGCACGTTACGTGAAAATGAATGGTAAACGTCGTTTAATTGGTTCATTTAACCATGGCTCAATGGCGAATGCGATGGCGCAAGCTATTGGTATTCAAGCACTGGACAGAAAACGTCAAGTTGTGGCGATGTGCGGTGACGGTGGTTTTACCATGTTAATGGGTGATTTCATCTCATTGGCTCAAATGAACTTACCGGTGAAAGTGGTGATTTTTAATAACAGCGTATTAGGTTTTGTGGCGATGGAAATGAAAGCGGGGGGCTATTTGACTGATGGCACCGATTTACATAATCCTGATTTTGCCGCTATTGCCAATGCGGCGGGAATTAAAGGTATTCGCGTTGAGAAAGGCGAAGATCTTGATGAAGCATTAAAAACAGCCTTTGAACATGATGGCCCTGTTATTGTGGATGTGGTAACCGCAAAACAAGAGCTTTCCATGCCTCCGGAAATTAAATTTGAGCAGGCCAAAGGTTTTAGCTTGTATATGATGAAAGCGATTATTAATGGTCGTGGCGATGAAATAGTGCAATTAGCGAAAACCAACTGGTTGCGCTAATCATTAAACGCATAATCGTTATATTGCGAGTTGCAGGGGCTAATAGCCTA