Homologs in group_123

Help

10 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04870 FBDBKF_04870 22.2 Morganella morganii S1 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
EHELCC_06160 EHELCC_06160 22.2 Morganella morganii S2 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
NLDBIP_06480 NLDBIP_06480 22.2 Morganella morganii S4 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
LHKJJB_03360 LHKJJB_03360 22.2 Morganella morganii S3 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
HKOGLL_06835 HKOGLL_06835 22.2 Morganella morganii S5 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
F4V73_RS08975 F4V73_RS08975 19.6 Morganella psychrotolerans - type I secretion system permease/ATPase
F4V73_RS09455 F4V73_RS09455 21.4 Morganella psychrotolerans - type I secretion system permease/ATPase
F4V73_RS09470 F4V73_RS09470 22.3 Morganella psychrotolerans - peptidase domain-containing ABC transporter
F4V73_RS13135 F4V73_RS13135 22.4 Morganella psychrotolerans - peptidase domain-containing ABC transporter
F4V73_RS14180 F4V73_RS14180 32.4 Morganella psychrotolerans - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_123

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_123

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
G7CBF5 1.53e-49 187 30 14 536 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
A0R6H8 6.37e-46 176 28 12 572 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WQJ7 1.54e-43 167 30 11 538 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ6 1.54e-43 167 30 11 538 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63394 1.54e-43 167 30 11 538 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
G7CBF6 6.22e-43 165 31 16 516 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
A0R6H7 1.13e-40 159 28 19 597 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45861 3.52e-38 151 26 12 517 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
O06967 7.05e-37 148 33 5 307 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q1QX69 1.71e-36 147 32 4 311 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q12C33 2.2e-36 146 28 16 545 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q1BUV6 2.22e-36 146 26 16 582 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
Q39E73 3.17e-36 146 26 15 578 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9WYC4 4.17e-36 145 24 19 595 1 TM_0288 Uncharacterized ABC transporter ATP-binding protein TM_0288 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P71082 5e-36 145 30 6 317 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
O31707 5.95e-36 145 24 14 542 3 yknU Uncharacterized ABC transporter ATP-binding protein YknU Bacillus subtilis (strain 168)
Q9LSJ2 7.44e-36 147 27 18 521 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9LSJ2 3.72e-23 108 28 9 302 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q8T9W2 9.95e-36 145 32 9 330 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
P40416 1.11e-35 145 31 9 327 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2LVL0 1.2e-35 144 25 17 589 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q142P6 1.93e-35 144 37 5 233 3 msbA ATP-dependent lipid A-core flippase Paraburkholderia xenovorans (strain LB400)
Q3KJ31 3.65e-35 143 27 17 523 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
Q6BXD7 3.65e-35 144 31 7 330 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P9WQJ9 4.42e-35 144 29 12 517 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ8 4.42e-35 144 29 12 517 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63392 4.42e-35 144 29 12 517 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZR72 8.85e-35 144 37 4 239 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q9ZR72 1.02e-29 128 32 5 258 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
P55469 9.5e-35 142 28 12 439 3 NGR_a03510 Uncharacterized ABC transporter ATP-binding protein y4gM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2SZW0 1.46e-34 141 27 13 554 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q6CX96 1.72e-34 142 31 7 326 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6FIK3 5.37e-34 140 30 5 335 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q5E0F2 5.77e-34 139 26 13 502 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q63VX7 8.63e-34 139 26 13 554 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 8.63e-34 139 26 13 554 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 8.63e-34 139 26 13 554 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
Q6AJW3 1.05e-33 138 29 6 313 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9C7F8 1.08e-33 140 37 5 236 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9C7F8 2.07e-31 133 31 5 290 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
P26760 1.1e-33 139 31 8 344 1 apxIB Toxin RTX-I translocation ATP-binding protein Actinobacillus pleuropneumoniae
P08716 1.12e-33 139 31 9 340 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q54BU4 1.3e-33 140 32 11 324 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
P10089 1.38e-33 139 31 9 340 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q47258 1.4e-33 139 31 9 340 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q9LSJ6 1.48e-33 140 26 17 513 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 7.87e-24 110 30 4 237 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q8FDZ8 1.57e-33 139 31 9 340 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63359 1.7e-33 138 34 7 291 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 1.7e-33 138 34 7 291 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 1.7e-33 138 34 7 291 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
Q9M0G9 2.15e-33 138 30 9 343 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q2G2M9 2.76e-33 137 34 2 229 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 2.76e-33 137 34 2 229 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 2.76e-33 137 34 2 229 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 2.76e-33 137 34 2 229 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 2.76e-33 137 34 2 229 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 2.76e-33 137 34 2 229 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 2.76e-33 137 34 2 229 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 2.76e-33 137 34 2 229 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
P23886 2.95e-33 137 28 18 550 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q5PGH0 3.29e-33 137 34 7 291 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8XXB6 4.19e-33 137 26 17 596 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6YUU5 4.91e-33 138 27 18 517 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q6YUU5 1.77e-22 105 33 4 233 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q2YU20 6.95e-33 136 34 2 229 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9FUT3 7.44e-33 137 25 16 510 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
Q9CHL8 1.04e-32 135 26 12 495 1 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. lactis (strain IL1403)
Q5X498 1.05e-32 135 26 11 498 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Paris)
Q751N2 1.14e-32 136 28 9 411 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q46717 1.29e-32 136 31 9 322 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O157:H7
A1USS5 1.44e-32 135 25 14 498 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q0A4U4 1.58e-32 135 26 14 534 3 msbA ATP-dependent lipid A-core flippase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7RX59 1.69e-32 136 31 9 348 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P70864 1.74e-32 135 25 14 498 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis
P97046 2.11e-32 135 26 11 491 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
Q9ZNB0 2.15e-32 135 34 8 348 3 SCO0742 Uncharacterized ABC transporter ATP-binding protein SCO0742 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5WVN2 2.4e-32 134 25 11 498 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Lens)
Q5ZUH9 2.4e-32 134 25 10 490 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2SIN5 2.99e-32 134 24 11 494 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q00449 3.56e-32 136 38 3 220 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q00449 5.74e-28 123 31 4 265 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q4KJB2 4.94e-32 134 26 18 525 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q933I3 6.16e-32 134 30 9 339 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
Q2K342 6.6e-32 133 38 2 211 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P0DKX5 7.04e-32 134 33 7 306 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX6 7.04e-32 134 33 7 306 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
Q1LQD3 7.64e-32 133 26 19 598 3 msbA ATP-dependent lipid A-core flippase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q00564 8.54e-32 134 29 7 330 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q3Z3K7 9.07e-32 133 35 6 258 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
Q83LP0 9.51e-32 133 35 6 258 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
Q32E34 9.51e-32 133 35 6 258 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 9.51e-32 133 35 6 258 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
P60752 9.51e-32 133 35 6 258 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
P60753 9.51e-32 133 35 6 258 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
Q3SFZ6 9.83e-32 132 32 6 305 3 msbA ATP-dependent lipid A-core flippase Thiobacillus denitrificans (strain ATCC 25259)
Q1RDU4 1.02e-31 132 35 6 258 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
Q8FJB1 1.02e-31 132 35 6 258 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 1.02e-31 132 35 6 258 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9CJB8 1.11e-31 133 29 5 306 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q9RCG7 1.53e-31 133 30 9 340 3 paxB Exotoxin translocation ATP-binding protein PaxB Pasteurella aerogenes
O07550 1.67e-31 132 29 6 314 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
P55122 1.9e-31 133 30 11 340 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
P23702 1.98e-31 132 31 8 344 1 ltxB Leukotoxin export ATP-binding protein LtxB Aggregatibacter actinomycetemcomitans
Q9CMG7 2.07e-31 132 28 13 450 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q04473 2.13e-31 132 30 8 340 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q9LSJ5 2.52e-31 133 26 17 512 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9LSJ5 1.37e-26 119 32 4 237 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q93FG6 2.6e-31 132 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P08183 2.65e-31 133 28 7 342 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 3.15e-23 108 32 7 257 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
Q933E0 2.79e-31 132 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Bibersteinia trehalosi
P0C086 2.9e-31 132 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C087 2.9e-31 132 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P16532 3.01e-31 132 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH2 3.01e-31 132 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH6 3.03e-31 132 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH0 3.06e-31 132 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q8T9W4 3.67e-31 133 34 5 237 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8T9W4 1.07e-21 103 34 4 233 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q7NZU6 3.71e-31 131 32 7 301 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q89A96 3.82e-31 131 26 5 331 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1KF14 4.16e-31 132 29 15 490 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 1.12e-26 119 30 6 308 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q9LSJ8 4.88e-31 132 25 16 516 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q9LSJ8 7.67e-27 119 31 3 236 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
O53645 5.02e-31 132 29 15 490 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 6.15e-27 119 31 8 308 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A1U9YI12 5.13e-31 132 33 8 287 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 5.34e-29 126 32 7 303 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
Q9NP58 5.16e-31 132 31 6 325 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
Q93FH3 5.81e-31 131 30 8 336 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q2NUA5 5.88e-31 130 27 16 503 3 msbA ATP-dependent lipid A-core flippase Sodalis glossinidius (strain morsitans)
Q6FZF2 5.98e-31 130 25 15 499 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella quintana (strain Toulouse)
Q59R09 6.78e-31 131 30 8 346 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q483B6 6.82e-31 130 28 5 305 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
O31708 6.97e-31 130 24 13 520 3 yknV Uncharacterized ABC transporter ATP-binding protein YknV Bacillus subtilis (strain 168)
Q9HUG8 7.32e-31 130 27 15 501 3 msbA ATP-dependent lipid A-core flippase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q10418 7.83e-31 131 25 13 530 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q9C7F2 8.68e-31 131 36 4 233 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9C7F2 1.03e-30 131 30 4 280 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q71ED1 1.11e-30 129 27 18 535 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium vitis
Q6G2Z5 1.13e-30 130 25 14 485 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q9NP78 1.17e-30 130 29 7 315 1 ABCB9 ABC-type oligopeptide transporter ABCB9 Homo sapiens
Q66CI3 1.19e-30 129 26 22 564 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 1.19e-30 129 26 22 564 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 1.19e-30 129 26 22 564 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 1.19e-30 129 26 22 564 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q9LJX0 1.22e-30 131 36 3 233 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q9LJX0 2.29e-22 105 32 3 220 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q4UMZ3 1.23e-30 129 32 2 224 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
G5EFD4 1.38e-30 130 30 7 309 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
Q5F4X8 1.44e-30 129 30 3 296 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q6D437 1.48e-30 129 37 4 232 3 msbA ATP-dependent lipid A-core flippase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q08D64 1.6e-30 130 30 6 317 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
P54718 1.69e-30 129 34 2 229 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
P54719 1.73e-30 129 29 6 319 3 yfiC Uncharacterized ABC transporter ATP-binding protein YfiC Bacillus subtilis (strain 168)
B5X0E4 2.11e-30 130 32 4 252 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 6.84e-25 113 34 5 227 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
Q9JJ59 2.27e-30 130 27 11 415 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Mus musculus
Q9QYJ4 2.38e-30 129 27 11 418 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Rattus norvegicus
Q48P40 2.4e-30 129 27 16 518 3 msbA ATP-dependent lipid A-core flippase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5RFQ9 3.32e-30 129 29 9 348 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
Q2HIE9 3.35e-30 128 31 6 335 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q1MAB5 3.41e-30 128 38 2 211 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P9WQJ3 3.81e-30 128 25 11 520 1 Rv1272c Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ2 3.81e-30 128 25 11 520 3 MT1310 Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63398 3.81e-30 128 25 11 520 3 BQ2027_MB1303C Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A125QXJ1 5.31e-30 129 30 6 322 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q6F9X0 5.49e-30 127 31 7 312 3 msbA ATP-dependent lipid A-core flippase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6LPK6 6.26e-30 127 26 14 498 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
Q8G0T8 6.6e-30 127 26 17 545 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella suis biovar 1 (strain 1330)
P94367 7.17e-30 127 30 9 330 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
Q4FS42 7.53e-30 127 25 12 510 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q87EF0 9.75e-30 127 30 6 308 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q3SP57 9.95e-30 127 30 5 339 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P21447 1.17e-29 128 33 3 236 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P21447 7.88e-25 113 32 6 277 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P0C529 1.17e-29 127 26 17 545 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus biovar 1 (strain 9-941)
Q2YQ73 1.17e-29 127 26 17 545 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus (strain 2308)
Q9KQW9 1.28e-29 126 26 13 495 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q61102 1.3e-29 127 29 9 384 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
Q87VF3 1.46e-29 126 27 16 518 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0CL93 1.52e-29 127 30 8 350 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q704E8 1.62e-29 127 30 9 380 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q0VQP5 1.69e-29 126 30 5 310 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4PH16 1.76e-29 127 29 6 318 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
P0CL92 1.79e-29 127 30 8 350 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q46Y89 1.95e-29 126 34 3 233 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P16875 2.23e-29 127 35 6 241 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16875 1.57e-28 124 34 3 234 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q8YH20 2.4e-29 125 26 17 545 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9JXR3 2.41e-29 126 29 3 296 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P59653 2.47e-29 126 24 16 536 1 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P16877 2.49e-29 127 35 3 234 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16877 1.67e-25 115 30 7 284 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q9DC29 2.51e-29 127 29 6 322 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
P21439 2.7e-29 127 33 3 231 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 4.91e-22 104 31 11 311 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
J9VF33 2.72e-29 127 33 4 240 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VF33 1.5e-24 112 34 5 229 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P21440 2.92e-29 127 32 3 231 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 1.78e-23 109 34 5 226 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q9JW59 2.92e-29 125 29 3 296 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9CXJ4 3.01e-29 126 28 8 338 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
F2T1C4 3.09e-29 127 29 12 358 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2T1C4 1.35e-26 119 34 6 241 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q9LHK4 3.2e-29 127 25 14 499 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q9LHK4 8.35e-22 103 33 3 227 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q08201 3.37e-29 127 32 3 231 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 1.66e-23 109 31 6 296 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q5RKI8 3.55e-29 126 28 8 338 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
O70595 3.9e-29 126 25 12 517 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
P34713 4.09e-29 126 33 6 254 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P34713 3.68e-22 105 30 3 231 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
Q4ZZ16 4.17e-29 125 27 17 520 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. syringae (strain B728a)
O75027 4.29e-29 125 30 9 375 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q92GP9 4.74e-29 125 29 4 254 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
F2RP52 4.88e-29 126 29 12 358 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RP52 1.35e-26 119 35 4 237 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2PRR1 4.88e-29 126 29 12 358 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2PRR1 1.35e-26 119 35 4 237 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
A0A095C325 4.92e-29 126 33 3 240 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
A0A095C325 7.46e-26 116 36 5 227 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
Q6C6N0 5.09e-29 125 27 9 410 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9NUT2 5.33e-29 125 29 8 338 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
A0A059JJ46 5.39e-29 126 29 12 358 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JJ46 1.48e-26 119 35 5 237 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
P0A2V1 5.82e-29 124 35 2 223 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium radiobacter
P0A2V0 5.82e-29 124 35 2 223 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium fabrum (strain C58 / ATCC 33970)
G5EG61 6e-29 126 33 3 232 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
G5EG61 2.63e-27 121 33 2 224 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
Q9LVM1 6.16e-29 125 28 7 345 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
Q9FHF1 6.42e-29 125 31 6 294 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FHF1 9.16e-21 100 32 4 219 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
P21448 6.67e-29 125 32 3 236 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 1.03e-23 110 32 4 226 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
Q5P2S7 7.55e-29 124 28 19 534 3 msbA ATP-dependent lipid A-core flippase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
P59852 7.86e-29 125 29 9 339 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
Q68W42 7.95e-29 124 29 3 244 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9PEE7 8.79e-29 124 30 6 308 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
P54537 9.39e-29 117 35 8 222 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q03727 1.05e-28 124 24 16 536 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q7AKE5 1.05e-28 124 39 5 231 2 ramB ABC transporter ATP-binding protein RamB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P11599 1.12e-28 124 30 7 337 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Proteus vulgaris
P06795 1.3e-28 125 32 3 236 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 2.39e-24 112 32 6 274 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P21449 1.31e-28 125 31 3 236 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21449 1.23e-24 112 31 5 274 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P43245 1.34e-28 125 32 3 236 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
P43245 3.03e-21 102 32 5 226 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
Q54RU1 1.44e-28 124 31 5 267 3 abcB6 ABC transporter B family member 6 Dictyostelium discoideum
P23174 1.64e-28 124 32 3 231 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 5.08e-24 110 33 4 242 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
Q89A97 1.84e-28 123 24 5 319 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P78966 1.88e-28 124 28 10 335 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 7.43e-25 113 35 6 227 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0I4C5 2.06e-28 123 36 3 221 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
Q3BTC8 2.19e-28 123 29 17 467 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
P18767 2.41e-28 122 36 2 211 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium meliloti (strain 1021)
P16876 2.42e-28 124 35 3 234 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16876 1.63e-27 121 33 4 239 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q54BT3 2.63e-28 124 33 4 234 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q54BT3 4.16e-21 101 32 3 231 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q4WLN7 3.58e-28 123 31 6 316 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 3.6e-28 124 33 6 245 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 1.48e-25 115 33 5 234 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q88D92 3.75e-28 122 28 17 500 3 msbA ATP-dependent lipid A-core flippase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P12866 4.22e-28 123 37 6 238 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12866 2.94e-21 102 29 6 232 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8T9W1 4.41e-28 123 35 7 237 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
Q9LHD1 5.08e-28 123 26 17 512 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9LHD1 4.23e-26 117 33 3 219 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q1QBW0 5.11e-28 122 31 8 296 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
J9VWU3 5.2e-28 122 30 8 332 2 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q56A55 6.71e-28 122 29 9 347 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Danio rerio
Q8PKS5 7.28e-28 121 28 17 467 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
O07549 7.79e-28 122 23 13 513 1 yheH Probable multidrug resistance ABC transporter ATP-binding/permease protein YheH Bacillus subtilis (strain 168)
O14286 7.83e-28 122 27 5 334 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q13BH6 7.87e-28 121 34 2 226 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB5)
Q8D2U8 7.9e-28 121 24 20 511 3 msbA ATP-dependent lipid A-core flippase Wigglesworthia glossinidia brevipalpis
Q8RY46 8.42e-28 122 29 9 321 1 ABCB26 ABC transporter B family member 26, chloroplastic Arabidopsis thaliana
Q5H0H0 1.04e-27 120 35 3 217 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 1.04e-27 120 35 3 217 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q83D84 1.1e-27 120 31 8 301 3 msbA ATP-dependent lipid A-core flippase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q20Z38 1.12e-27 120 35 2 224 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q2M3G0 1.13e-27 122 31 4 251 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 3.47e-23 108 35 6 236 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q7VR44 1.17e-27 120 32 5 233 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
Q9FNU2 1.33e-27 120 31 7 309 2 ABCB25 ABC transporter B family member 25 Oryza sativa subsp. japonica
H2LNR5 1.36e-27 121 31 7 322 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
E7F6F7 1.55e-27 121 31 8 323 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q02592 1.7e-27 121 27 4 310 2 hmt1 Heavy metal tolerance protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8P8W4 1.87e-27 120 30 7 311 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 1.87e-27 120 30 7 311 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q7VL52 1.9e-27 120 33 5 236 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A0A348AXX9 2e-27 121 30 6 308 2 kk1G ABC-type transporter kk1G Curvularia clavata
A0A348AXX9 7.36e-17 88 28 11 285 2 kk1G ABC-type transporter kk1G Curvularia clavata
Q9Y8G2 2.05e-27 121 28 15 415 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G2 3.37e-25 114 35 7 258 2 atrC ABC multidrug transporter atrC Emericella nidulans
A0A1U8QG99 2.26e-27 121 28 15 415 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QG99 3.52e-25 114 35 7 258 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q983H5 2.47e-27 119 37 2 211 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P36619 2.52e-27 121 31 3 244 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36619 6.85e-26 116 30 8 301 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5BAY0 2.55e-27 121 31 4 247 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 8.65e-26 116 33 6 234 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q31FG2 2.7e-27 119 28 6 319 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q0WML0 2.77e-27 120 35 4 238 1 ABCB27 ABC transporter B family member 27 Arabidopsis thaliana
Q6N1Y7 2.79e-27 119 34 2 225 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9Y8G1 2.79e-27 120 31 4 247 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q9Y8G1 1.03e-25 116 33 6 234 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q00748 2.8e-27 120 33 3 234 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q00748 6.58e-19 94 30 6 235 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
F2RPA4 2.81e-27 120 33 5 250 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 8.35e-20 97 28 6 321 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
Q15UY7 3.03e-27 119 29 9 313 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q89UT8 3.22e-27 119 28 6 338 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5QU36 3.42e-27 119 27 18 504 3 msbA ATP-dependent lipid A-core flippase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
P9WQJ0 3.51e-27 119 34 4 227 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W5 3.64e-27 119 34 4 227 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 3.64e-27 119 34 4 227 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7N6C6 3.65e-27 119 34 4 232 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9M0M2 3.66e-27 120 34 5 238 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9M0M2 1.25e-20 100 33 4 219 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q1QH37 3.9e-27 119 33 2 225 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q5LI72 4.48e-27 112 36 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P22638 4.78e-27 119 30 7 316 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2KYS6 4.98e-27 119 29 7 302 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
Q9SGY1 5.08e-27 120 30 7 291 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9SGY1 2.81e-25 114 31 4 237 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
P47261 5.35e-27 119 21 12 550 3 MG015 Putative ABC transporter ATP-binding protein MG015 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q64Z80 6.32e-27 112 36 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q87R16 7.03e-27 118 24 12 486 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A0A059JK44 7.28e-27 119 33 5 250 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 6.01e-20 98 28 6 321 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
P0CU83 7.44e-27 119 34 4 228 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 8.55e-21 100 29 6 321 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q7MJ07 7.89e-27 118 24 12 480 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q1GZI0 8.19e-27 118 30 6 309 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q57538 8.19e-27 118 27 14 450 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
F2Q5G0 9.77e-27 119 34 4 228 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 5.81e-20 98 28 6 321 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2SQT8 1e-26 119 34 4 238 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2SQT8 5.07e-26 117 31 4 238 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
A0A0D1BUH6 1.02e-26 119 30 8 324 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 7.17e-20 97 34 3 224 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q5NIG3 1.04e-26 118 29 5 285 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JW6 1.04e-26 118 29 5 285 1 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain FSC 198)
Q8K985 1.07e-26 117 27 6 325 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q0BKJ3 1.08e-26 118 29 5 285 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1U9 1.08e-26 118 29 5 285 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain LVS)
Q2ULH4 1.08e-26 118 29 7 345 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q07QX6 1.14e-26 117 34 2 226 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q2G506 1.14e-26 118 35 4 245 1 atm1 ATM1-type heavy metal exporter Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
P77265 1.15e-26 117 30 7 313 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
Q1RJ91 1.16e-26 117 29 6 253 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
Q2J0F4 1.22e-26 117 33 4 244 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain HaA2)
Q8DAV2 1.32e-26 117 24 12 480 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q57180 1.34e-26 117 33 4 228 3 HI_1051 Uncharacterized ABC transporter ATP-binding protein HI_1051 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4WPP6 1.4e-26 118 26 15 426 2 mdr2 ABC multidrug transporter mdr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9ZCM8 1.49e-26 117 29 2 224 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
K3VYH8 1.61e-26 118 35 6 235 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
K3VYH8 2.57e-09 63 39 1 87 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
P33116 1.72e-26 117 27 6 255 3 spaT Subtilin transport ATP-binding protein SpaT Bacillus subtilis
P34712 1.94e-26 118 31 5 233 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 1.29e-24 112 33 4 233 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
Q47908 1.97e-26 117 29 5 285 3 msbA ATP-dependent lipid A-core flippase Francisella novicida
Q9JI39 2.19e-26 117 25 16 493 1 Abcb10 ATP-binding cassette sub-family B member 10, mitochondrial Mus musculus
S0EGU4 2.32e-26 118 34 4 232 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EGU4 1.05e-09 65 26 10 341 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q9FWX8 2.6e-26 118 34 4 221 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9FWX8 1.06e-22 106 31 4 236 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q06034 3.29e-26 117 33 6 241 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q06034 4.43e-18 92 29 2 217 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q9M1Q9 4.06e-26 117 31 4 238 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9M1Q9 1.1e-23 109 34 4 219 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
P57552 4.36e-26 115 27 5 298 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P97998 4.43e-26 116 27 11 322 3 MDL1 ATP-dependent permease MDL1 Candida albicans
Q8LPK2 4.82e-26 117 32 4 234 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q8LPK2 6.95e-25 113 31 4 235 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q9FWX7 5.37e-26 117 34 4 221 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 2.43e-24 112 32 4 237 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
P45081 5.61e-26 115 28 7 285 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6Q876 5.89e-26 117 33 8 235 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 8.19e-26 116 32 4 245 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
P54683 5.95e-26 117 33 5 236 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
Q21NS8 5.95e-26 115 32 2 220 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q3IGX5 7.49e-26 115 28 9 314 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas translucida (strain TAC 125)
Q5B1Q2 7.93e-26 115 30 7 321 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P35598 7.99e-26 115 24 18 581 3 exp8 Putative ABC transporter ATP-binding protein exp8 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P0AAG5 8.69e-26 115 31 8 325 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 8.69e-26 115 31 8 325 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 8.69e-26 115 31 8 325 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
B2GUP8 8.83e-26 115 26 8 345 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
H6TB12 1.02e-25 116 35 5 222 1 mdr Sophorolipid transporter Starmerella bombicola
H6TB12 1.37e-25 115 33 5 244 1 mdr Sophorolipid transporter Starmerella bombicola
P75094 1.16e-25 115 21 10 500 3 MPN_019 Putative ABC transporter ATP-binding protein MG015 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q54W24 1.35e-25 115 23 10 511 3 abcB4 ABC transporter B family member 4 Dictyostelium discoideum
Q9SYI3 1.38e-25 115 34 3 212 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 1.79e-25 115 28 11 375 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9QY30 1.75e-25 115 37 3 224 1 Abcb11 Bile salt export pump Mus musculus
Q9QY30 9.67e-24 110 31 4 227 1 Abcb11 Bile salt export pump Mus musculus
Q65U21 2e-25 114 35 3 221 3 msbA ATP-dependent lipid A-core flippase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O95342 2.09e-25 115 32 4 227 1 ABCB11 Bile salt export pump Homo sapiens
O95342 5.05e-23 107 35 3 224 1 ABCB11 Bile salt export pump Homo sapiens
Q8LPQ6 2.46e-25 114 34 6 240 2 ABCB28 ABC transporter B family member 28 Arabidopsis thaliana
B2KWH4 2.5e-25 115 35 5 237 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 3.75e-22 105 27 4 275 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
Q4QPI4 2.63e-25 113 29 8 331 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q03203 2.88e-25 113 29 5 232 3 nisT Nisin transport ATP-binding protein NisT Lactococcus lactis subsp. lactis
Q21WN9 3.03e-25 113 31 8 314 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q4WD46 3.31e-25 114 32 4 235 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WD46 3.78e-21 102 33 4 242 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9GTN7 3.79e-25 114 28 8 336 1 tagA Serine protease/ABC transporter B family protein tagA Dictyostelium discoideum
Q3J7R8 4.13e-25 113 34 4 228 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q23868 4.76e-25 114 34 9 240 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
O80725 5.03e-25 114 31 4 233 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 1.3e-23 109 33 4 219 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
Q47JR8 5.23e-25 112 35 5 237 3 msbA ATP-dependent lipid A-core flippase Dechloromonas aromatica (strain RCB)
Q8A1M1 5.55e-25 106 37 8 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
O34979 6.23e-25 106 35 6 223 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
Q9Y7M7 7.43e-25 112 28 9 354 3 mdl1 ATP-dependent permease MDL1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P54954 7.58e-25 107 32 7 237 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
O34677 7.86e-25 106 33 7 221 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q2UPC0 8.23e-25 112 33 2 226 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q7VWD8 1.33e-24 111 30 7 303 3 msbA ATP-dependent lipid A-core flippase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
O70014 1.37e-24 106 36 7 225 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q8FCJ1 1.37e-24 106 36 7 225 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 1.37e-24 106 36 7 225 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q32AY3 1.38e-24 106 36 7 225 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q7W9N7 1.39e-24 111 30 7 303 3 msbA ATP-dependent lipid A-core flippase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH20 1.39e-24 111 30 7 303 3 msbA ATP-dependent lipid A-core flippase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P94366 1.89e-24 110 28 5 335 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Bacillus subtilis (strain 168)
O70127 2.32e-24 112 31 4 227 1 Abcb11 Bile salt export pump Rattus norvegicus
O70127 1.69e-23 109 35 3 224 1 Abcb11 Bile salt export pump Rattus norvegicus
P57551 2.34e-24 110 26 9 332 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q60AA3 2.62e-24 110 29 6 303 3 msbA ATP-dependent lipid A-core flippase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B8K1W2 2.8e-24 111 36 4 224 1 Abcb11e Bile salt export pump Canis lupus familiaris
B8K1W2 3.17e-24 111 30 10 315 1 Abcb11e Bile salt export pump Canis lupus familiaris
Q1R597 2.96e-24 105 36 7 217 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q8LPT1 3.22e-24 111 31 5 250 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q8LPT1 3.64e-20 99 31 5 235 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
P44407 3.46e-24 110 25 20 591 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P36370 5.33e-24 110 28 9 312 1 Tap1 Antigen peptide transporter 1 Rattus norvegicus
Q9NRK6 6.28e-24 110 24 17 527 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q88RL5 7.55e-24 106 33 8 234 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q45460 7.65e-24 107 34 6 210 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q080T2 8.04e-24 109 28 7 301 3 msbA ATP-dependent lipid A-core flippase Shewanella frigidimarina (strain NCIMB 400)
O34900 8.2e-24 104 32 7 225 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
P33311 9.54e-24 109 27 12 349 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P37774 1.12e-23 103 35 10 231 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q9N0V3 1.52e-23 109 31 5 228 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q9N0V3 5.66e-19 95 34 3 224 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q4HVU7 1.64e-23 108 28 7 339 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q480N3 1.65e-23 108 23 15 536 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q8X5N2 1.68e-23 103 35 7 225 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q9SYI2 1.87e-23 108 32 4 237 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9SYI2 1.22e-20 100 32 3 212 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9M3B9 2.22e-23 108 30 5 247 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q9M3B9 8e-19 94 30 5 236 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q0A8P9 2.26e-23 102 40 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5WUF8 2.71e-23 102 37 8 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
P10346 2.78e-23 102 33 6 220 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P21958 2.91e-23 107 28 11 343 1 Tap1 Antigen peptide transporter 1 Mus musculus
P27675 2.93e-23 102 32 8 222 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
P71355 2.98e-23 107 23 15 561 3 HI_0663 Uncharacterized ABC transporter ATP-binding protein HI_0663 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q28433 3.43e-23 107 27 8 319 2 TAP1 Antigen peptide transporter 1 Gorilla gorilla gorilla
P45769 3.53e-23 102 32 5 230 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q0P9X7 3.62e-23 102 30 6 220 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1VZQ5 5.13e-23 101 30 6 220 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q4ZRT7 5.16e-23 102 34 9 229 3 pstB1 Phosphate import ATP-binding protein PstB 1 Pseudomonas syringae pv. syringae (strain B728a)
Q880A6 5.16e-23 102 34 9 229 3 pstB1 Phosphate import ATP-binding protein PstB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q492S9 5.46e-23 106 30 5 233 3 msbA ATP-dependent lipid A-core flippase Blochmanniella pennsylvanica (strain BPEN)
Q03518 5.54e-23 107 27 8 319 1 TAP1 Antigen peptide transporter 1 Homo sapiens
O31711 5.83e-23 101 32 5 209 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q48HD9 8.26e-23 101 34 9 229 3 pstB1 Phosphate import ATP-binding protein PstB 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7N3S7 8.39e-23 101 36 10 220 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2NU23 9.6e-23 100 37 7 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q5ZT78 1.05e-22 100 36 8 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8NSN2 1.12e-22 103 29 6 257 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q66FK0 1.37e-22 100 36 8 220 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 1.37e-22 100 36 8 220 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 1.37e-22 100 36 8 220 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 1.37e-22 100 36 8 220 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
P63372 1.51e-22 100 34 8 223 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P63371 1.51e-22 100 34 8 223 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype III (strain NEM316)
Q5X2Z8 1.53e-22 99 37 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q4WSI1 1.56e-22 106 32 5 231 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 2.47e-21 102 30 5 280 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q38WL5 1.76e-22 102 33 6 227 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q31ZH4 2.5e-22 99 36 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
P74981 2.58e-22 100 34 6 219 1 hmuV Hemin import ATP-binding protein HmuV Yersinia enterocolitica
Q3SRG8 2.67e-22 99 38 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q32EX7 2.75e-22 99 36 8 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q0HJG0 3.1e-22 99 35 6 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-4)
Q8ZX91 3.31e-22 99 33 9 229 3 pstB Phosphate import ATP-binding protein PstB Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q8LGU1 3.33e-22 105 25 6 327 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 2.92e-11 70 26 6 221 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q0HVQ0 3.42e-22 99 35 6 233 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-7)
Q3JYY5 3.74e-22 99 35 8 212 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P75957 3.93e-22 99 36 8 227 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q3Z300 4.17e-22 98 36 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 4.17e-22 98 36 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 4.17e-22 98 36 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 4.17e-22 98 36 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q11JI6 4.36e-22 98 37 10 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Chelativorans sp. (strain BNC1)
Q9LZJ5 5.03e-22 104 23 14 484 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q9LZJ5 2.83e-11 70 25 5 222 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
O34992 5.34e-22 101 32 6 210 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q1QCN2 6.24e-22 98 35 7 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q83RS0 6.3e-22 98 36 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q9KHT9 6.53e-22 101 30 5 210 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 6.53e-22 101 30 5 210 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q57213 7.06e-22 97 35 6 189 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P29018 7.32e-22 103 27 20 548 1 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Escherichia coli (strain K12)
Q92887 7.62e-22 104 31 6 223 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q92887 2.38e-19 96 30 4 221 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q3ATY5 8.02e-22 98 34 7 209 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q2W450 8.17e-22 97 38 8 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q47Y12 8.71e-22 99 32 8 245 3 pstB Phosphate import ATP-binding protein PstB Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q13X01 8.84e-22 98 36 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Paraburkholderia xenovorans (strain LB400)
Q8X8E3 9.09e-22 97 36 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q4L8L7 9.11e-22 97 31 6 208 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q39GT7 1.04e-21 99 35 8 211 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q97IE0 1.06e-21 97 30 8 236 3 pstB Phosphate import ATP-binding protein PstB Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P36497 1.11e-21 103 29 7 317 3 pedD Pediocin PA-1 transport/processing ATP-binding protein PedD Pediococcus acidilactici
Q54U44 1.16e-21 103 23 16 513 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q54U44 1.51e-16 87 26 7 259 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q9U2G5 1.22e-21 103 27 10 364 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q9U2G5 3.57e-16 86 27 5 302 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q3J7S3 1.3e-21 97 37 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
O32169 1.64e-21 99 31 8 231 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q2FRT7 1.65e-21 100 35 9 220 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q9HT70 1.73e-21 99 33 8 235 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 1.73e-21 99 33 8 235 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
P61482 1.76e-21 97 35 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 1.76e-21 97 35 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 1.76e-21 97 35 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Y0C6 1.79e-21 97 37 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8FRX8 2.01e-21 99 30 5 235 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q1BWI2 2.09e-21 98 35 8 206 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q2SXD1 2.52e-21 97 37 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q57QD7 2.59e-21 96 34 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q8EEV5 2.62e-21 96 35 6 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q63SP4 2.86e-21 96 35 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q62J04 2.86e-21 96 35 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
Q48PU6 2.88e-21 98 32 8 242 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5LUD0 2.9e-21 96 38 9 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q0HTS8 2.96e-21 101 25 18 519 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-7)
Q0HHH4 2.96e-21 101 25 18 519 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-4)
Q1QLB0 3.19e-21 96 36 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q7A7E3 3.48e-21 98 30 7 225 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 3.48e-21 98 30 7 225 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9X0Y8 3.85e-21 96 33 7 218 3 pstB Phosphate import ATP-binding protein PstB Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5HC57 3.87e-21 95 32 6 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ehrlichia ruminantium (strain Welgevonden)
Q5FFC0 3.87e-21 95 32 6 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ehrlichia ruminantium (strain Gardel)
Q8RCU0 3.97e-21 95 34 6 199 3 pstB1 Phosphate import ATP-binding protein PstB 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P48243 4.31e-21 95 34 8 222 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1IGZ0 4.43e-21 98 32 8 235 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q2IF17 4.76e-21 95 37 7 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Anaeromyxobacter dehalogenans (strain 2CP-C)
Q5UW69 4.95e-21 96 31 6 223 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P45022 5.17e-21 96 29 10 236 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9EXN5 5.18e-21 100 28 1 208 3 mchF Probable microcin-H47 secretion/processing ATP-binding protein MchF Escherichia coli
Q11SW8 5.27e-21 95 33 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q2IWV8 5.31e-21 95 36 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rhodopseudomonas palustris (strain HaA2)
P0AAF9 5.37e-21 95 34 8 215 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 5.37e-21 95 34 8 215 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 5.37e-21 95 34 8 215 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 5.37e-21 95 34 8 215 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q3B276 5.89e-21 95 32 6 207 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
P0A9U0 5.9e-21 95 35 5 217 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9T8 5.9e-21 95 35 5 217 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T9 5.9e-21 95 35 5 217 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
Q3IQI3 5.94e-21 96 35 8 233 3 pstB2 Phosphate import ATP-binding protein PstB 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q8K984 6.3e-21 100 27 5 291 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O34392 6.36e-21 95 32 6 211 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q8RQL7 6.44e-21 95 33 7 203 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P36372 6.51e-21 100 31 3 229 1 Tap2 Antigen peptide transporter 2 Rattus norvegicus
Q4FTM3 6.91e-21 95 33 5 235 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8EDF0 7.03e-21 100 24 20 523 3 msbA ATP-dependent lipid A-core flippase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VR29 7.48e-21 95 31 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Blochmanniella floridana
Q4QK92 7.63e-21 95 29 7 244 3 pstB Phosphate import ATP-binding protein PstB Haemophilus influenzae (strain 86-028NP)
Q9PF03 7.67e-21 97 33 9 235 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q8SQI5 7.78e-21 100 30 6 237 3 ECU01_0200 Probable ABC transporter ECU01_0200/ECU01_1410 Encephalitozoon cuniculi (strain GB-M1)
O35379 8.29e-21 100 28 8 283 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
O35379 1.57e-15 84 30 3 210 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
Q2J3T0 8.43e-21 95 36 8 214 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14175
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 49446 - 51161 (strand: 1)
Length 1716 (nucleotides) / 571 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_123
Orthogroup size 11
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1132 Defense mechanisms (V) V ABC-type multidrug transport system, ATPase and permease component

Protein Sequence

MYQDLRALLRPFHSLLITALIFQGIAGIASLLPWLALHQWVSFYPDSYNGWLAVAAVGGIVWLAAQTLAFHITHVMDARCSHGLRLQLSDKMRSLPLNWFVQQGRAGVEHYVQQDINALHQLVAHAPADLVRLILVPLLAALLLLMINPLLLVLSLLPPVGAFLCFRLMRSDRYRDIFSERDSTLRTLFEDYRTLAENPLVAQQFPGRGILRKTELALLHFTSVFHHWVTKIGRPGAMAQVFLSSVLLTGWLLLCTVLTGQTLSPADLVLFILLLRNIAEPVTAMGHGADALQAAVAASARIRQLLAHPQMQYGERQYDDSTPLPESVPLTVQSVTLYPDREENSVSILKNVSLTVAAGECIAIVGPSGAGKSSLLRLIARFMDPSGGMITLAGQPLSAWSRHGLNQLVTVVMQNSEPLPGTLRDNLMLFNPQASPGQIQQALAAARFDSVIAMQEKGMDAVTGTDVHLSGGEAQRLAIARALIAQSPLLLADEPTSALDPDNAAHIFAALTGGTGTRVIVTHDLALARCADRLVFMVKGTVAATGTHDELLAQCPSYRHFARQQEVSHES

Flanking regions ( +/- flanking 50bp)

TGATATAACCGGCACTCCGATACTCTCCGCAGAGAACTGCGGAGAACATTATGTATCAGGATCTGCGGGCGCTGTTGCGTCCTTTTCACTCTTTACTTATTACGGCGCTTATCTTTCAGGGTATTGCCGGTATCGCATCATTACTTCCCTGGTTGGCACTTCATCAGTGGGTCAGCTTCTATCCGGACAGTTATAACGGCTGGCTGGCAGTTGCTGCTGTGGGGGGTATTGTCTGGCTGGCAGCTCAGACACTGGCGTTTCATATCACCCATGTTATGGATGCCCGGTGCAGTCACGGTCTTCGCCTGCAACTCTCAGACAAGATGCGCAGTCTGCCGCTGAACTGGTTTGTGCAGCAGGGTCGCGCTGGCGTGGAGCACTATGTTCAGCAGGATATCAATGCATTACATCAGTTGGTGGCACATGCGCCCGCTGATCTTGTCCGCCTGATCCTGGTTCCGTTACTGGCGGCATTGCTGTTGCTGATGATCAACCCTCTTCTTCTGGTCTTATCACTTCTGCCGCCCGTCGGTGCGTTTTTGTGTTTCCGGCTGATGCGCTCAGACCGCTACCGTGACATTTTTTCAGAGCGCGATAGTACATTGCGCACCTTATTTGAAGATTACCGCACCCTTGCCGAAAATCCGCTCGTTGCGCAGCAATTTCCCGGACGCGGAATTTTGCGCAAAACAGAACTGGCGTTGCTGCATTTCACCTCAGTTTTTCATCATTGGGTCACCAAAATCGGGCGTCCCGGTGCGATGGCGCAGGTGTTTCTCAGCTCTGTGTTACTGACCGGCTGGCTGCTGCTTTGCACTGTACTGACCGGGCAAACACTGTCCCCGGCTGATCTGGTGCTGTTTATTTTGTTGCTGCGCAATATTGCCGAACCGGTAACCGCCATGGGACACGGAGCCGATGCATTACAGGCGGCGGTGGCTGCGTCAGCGCGTATCCGTCAGTTACTGGCGCACCCGCAGATGCAGTACGGAGAGAGACAATATGACGACAGCACACCTTTGCCGGAATCCGTCCCGCTGACAGTACAGAGCGTAACTCTGTACCCGGACCGGGAAGAAAACAGTGTGTCGATCCTGAAAAATGTCAGTCTGACGGTTGCGGCGGGCGAATGCATTGCCATTGTTGGCCCGTCCGGCGCCGGGAAAAGTTCTCTGCTGCGCCTGATTGCGCGGTTTATGGATCCGTCAGGCGGCATGATCACCCTGGCGGGACAGCCGTTGTCTGCCTGGTCGCGGCACGGATTGAATCAGCTGGTGACGGTTGTGATGCAAAACAGTGAGCCGCTGCCCGGCACACTGCGCGATAACCTGATGCTGTTTAACCCGCAGGCATCCCCGGGGCAGATACAGCAAGCGCTGGCGGCTGCCCGCTTTGACAGTGTGATTGCCATGCAGGAAAAAGGAATGGATGCAGTGACAGGCACGGATGTTCACCTTTCCGGCGGCGAAGCTCAGCGGCTGGCAATTGCGCGGGCGCTGATTGCGCAAAGCCCGCTGCTGCTGGCAGATGAACCGACATCGGCGCTGGACCCGGATAATGCCGCGCATATTTTTGCCGCACTGACCGGTGGTACAGGAACCCGGGTGATTGTCACTCATGATCTTGCGCTGGCGCGCTGCGCTGATCGGCTGGTATTTATGGTGAAGGGTACTGTTGCGGCAACCGGCACACATGATGAGCTGCTGGCGCAATGCCCGTCTTACCGGCACTTTGCGCGGCAGCAGGAGGTTTCTCATGAAAGCTAATCTGCTTAAGACCAATCCGCTGATAAATCTTATTTTTTCCATGAAAGGCA