Homologs in group_123

Help

10 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04870 FBDBKF_04870 21.8 Morganella morganii S1 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
EHELCC_06160 EHELCC_06160 21.8 Morganella morganii S2 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
NLDBIP_06480 NLDBIP_06480 21.8 Morganella morganii S4 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
LHKJJB_03360 LHKJJB_03360 21.8 Morganella morganii S3 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
HKOGLL_06835 HKOGLL_06835 21.8 Morganella morganii S5 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
F4V73_RS08975 F4V73_RS08975 21.3 Morganella psychrotolerans - type I secretion system permease/ATPase
F4V73_RS09455 F4V73_RS09455 22.4 Morganella psychrotolerans - type I secretion system permease/ATPase
F4V73_RS09470 F4V73_RS09470 21.1 Morganella psychrotolerans - peptidase domain-containing ABC transporter
F4V73_RS13135 F4V73_RS13135 21.2 Morganella psychrotolerans - peptidase domain-containing ABC transporter
F4V73_RS14175 F4V73_RS14175 32.4 Morganella psychrotolerans - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_123

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_123

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
G7CBF6 8.45e-43 164 29 15 539 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
A0R6H7 4.9e-38 150 27 10 555 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WQJ7 1.7e-35 143 26 9 563 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ6 1.7e-35 143 26 9 563 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63394 1.7e-35 143 26 9 563 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q03727 1.09e-33 139 27 5 343 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P59653 4.28e-33 137 26 5 349 1 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P23886 1.21e-32 135 29 11 454 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
O06967 1.19e-31 132 29 8 332 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q10418 3.55e-30 129 30 8 306 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q704E8 6.84e-30 128 26 15 493 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q61102 3.23e-29 126 26 14 492 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
O75027 7.64e-29 125 25 11 478 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q4UMZ3 1.89e-28 123 29 2 221 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9X2W0 2.23e-28 122 23 8 448 1 mcjD Microcin-J25 export ATP-binding/permease protein McjD Escherichia coli
P59852 4.59e-28 122 27 6 324 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
P97046 1.13e-27 120 27 5 324 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
Q9CJB8 1.56e-27 120 26 7 319 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q00564 5e-27 119 26 7 343 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
O07550 6.12e-27 118 22 14 517 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
Q92GP9 1.12e-26 117 28 2 221 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P54718 2.27e-26 116 24 8 455 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
E7F6F7 2.4e-26 117 23 7 448 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q9CHL8 3.4e-26 116 26 5 324 1 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. lactis (strain IL1403)
P36497 1.63e-25 114 27 5 323 3 pedD Pediocin PA-1 transport/processing ATP-binding protein PedD Pediococcus acidilactici
O31708 1.86e-25 114 24 7 362 3 yknV Uncharacterized ABC transporter ATP-binding protein YknV Bacillus subtilis (strain 168)
Q68W42 1.95e-25 114 26 4 245 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCM8 3.86e-25 113 26 2 222 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
H2LNR5 5.42e-25 113 23 8 445 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
P61482 1.06e-24 105 33 7 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 1.06e-24 105 33 7 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 1.06e-24 105 33 7 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q32EX7 1.1e-24 105 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
P75957 1.43e-24 105 32 7 231 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q57QD7 1.47e-24 105 32 7 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q2SZW0 1.51e-24 111 29 8 325 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2UPC0 1.54e-24 112 31 4 240 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P54719 1.94e-24 110 26 8 329 3 yfiC Uncharacterized ABC transporter ATP-binding protein YfiC Bacillus subtilis (strain 168)
Q31ZH4 5.36e-24 103 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q3Z300 5.85e-24 103 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 5.85e-24 103 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 5.85e-24 103 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 5.85e-24 103 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A0A1U9YI12 6.13e-24 110 34 4 218 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 2.94e-17 89 29 6 237 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
Q07QX6 7.45e-24 109 31 6 242 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q9KQW9 8.27e-24 108 32 3 219 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1KF14 1.01e-23 109 25 13 524 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 4.15e-15 82 24 6 358 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
O53645 1.03e-23 109 25 13 524 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 2.34e-15 83 25 7 342 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P45861 1.08e-23 108 25 21 572 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
Q4PH16 1.2e-23 108 25 12 451 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q6FIK3 1.37e-23 108 23 10 459 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q83D84 1.8e-23 107 24 13 472 3 msbA ATP-dependent lipid A-core flippase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q8X8E3 1.87e-23 102 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
P45081 2.16e-23 107 31 5 235 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2HIE9 2.35e-23 107 24 13 454 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P55469 2.69e-23 107 28 5 235 3 NGR_a03510 Uncharacterized ABC transporter ATP-binding protein y4gM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3KJ31 3.27e-23 107 22 14 570 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
P40416 3.99e-23 107 24 10 424 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A095C325 4.25e-23 107 24 16 536 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
A0A095C325 8.31e-18 91 30 4 213 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
H6TB12 4.7e-23 107 26 5 366 1 mdr Sophorolipid transporter Starmerella bombicola
H6TB12 4.09e-15 82 29 4 211 1 mdr Sophorolipid transporter Starmerella bombicola
Q6Q876 5.21e-23 107 32 4 231 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 8.22e-19 94 30 4 214 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q1QH37 5.57e-23 106 30 5 235 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q63VX7 6.27e-23 106 29 8 325 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 6.27e-23 106 29 8 325 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 6.27e-23 106 29 8 325 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
Q2SIN5 7.97e-23 105 24 14 490 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
F2SQT8 1.15e-22 106 29 6 264 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2SQT8 1.88e-19 96 29 6 271 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0A2V1 1.48e-22 105 28 6 298 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium radiobacter
P0A2V0 1.48e-22 105 28 6 298 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium fabrum (strain C58 / ATCC 33970)
P23702 1.54e-22 105 28 7 305 1 ltxB Leukotoxin export ATP-binding protein LtxB Aggregatibacter actinomycetemcomitans
P26760 2.08e-22 105 27 6 318 1 apxIB Toxin RTX-I translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q9LSJ6 2.13e-22 105 33 4 205 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 1.06e-17 90 30 4 229 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9RCG7 2.15e-22 105 26 7 314 3 paxB Exotoxin translocation ATP-binding protein PaxB Pasteurella aerogenes
Q83RS0 2.25e-22 99 32 7 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q2G506 3.33e-22 104 24 5 329 1 atm1 ATM1-type heavy metal exporter Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
P16875 4.3e-22 104 36 4 190 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16875 9.55e-18 90 28 6 252 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P0CL93 4.31e-22 104 23 17 559 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CL92 4.47e-22 103 23 17 559 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q5UW69 5.89e-22 99 29 7 252 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q46717 6.04e-22 103 26 6 318 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O157:H7
P77265 6.17e-22 103 31 4 216 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
J9VF33 6.54e-22 104 24 16 536 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VF33 9.07e-18 91 30 3 223 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P36619 6.57e-22 104 26 9 342 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36619 1.23e-15 84 30 5 228 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q89UT8 7.07e-22 103 27 2 236 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q39E73 8.22e-22 102 29 8 313 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q03203 9.02e-22 102 30 5 207 3 nisT Nisin transport ATP-binding protein NisT Lactococcus lactis subsp. lactis
Q13BH6 9.08e-22 102 30 3 232 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB5)
A0A348AXX9 9.98e-22 103 31 3 228 2 kk1G ABC-type transporter kk1G Curvularia clavata
A0A348AXX9 4.85e-11 69 33 1 101 2 kk1G ABC-type transporter kk1G Curvularia clavata
Q8T9W2 1.05e-21 102 28 10 314 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
Q8RCU0 1.18e-21 97 30 6 217 3 pstB1 Phosphate import ATP-binding protein PstB 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3SP57 1.41e-21 102 28 3 242 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P71355 1.42e-21 102 25 4 312 3 HI_0663 Uncharacterized ABC transporter ATP-binding protein HI_0663 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q71ED1 1.51e-21 102 25 5 311 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium vitis
Q7VZ31 1.51e-21 97 34 6 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8T0 1.51e-21 97 34 6 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK40 1.51e-21 97 34 6 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9CXJ4 1.54e-21 102 30 4 227 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
A0A0D1BUH6 1.63e-21 102 26 21 554 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 3.06e-17 89 32 4 212 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q6MU19 1.68e-21 99 31 9 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5QU36 1.73e-21 102 24 12 412 3 msbA ATP-dependent lipid A-core flippase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q1CI46 2.18e-21 96 34 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFR4 2.18e-21 96 34 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q1C6Q8 2.18e-21 96 34 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q2SSS4 2.24e-21 99 31 9 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q1BUV6 2.32e-21 101 29 7 313 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
Q93FG6 2.51e-21 101 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q2K342 2.56e-21 101 31 4 215 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6G2Z5 2.6e-21 101 31 3 216 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
G5EFD4 2.94e-21 101 22 11 474 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
Q933I3 3.34e-21 101 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
P70864 3.62e-21 100 32 4 201 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis
A1USS5 3.68e-21 100 32 4 201 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q6N1Y7 3.93e-21 100 29 6 242 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q4KJB2 4.25e-21 100 24 10 404 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
F2RPA4 4.35e-21 101 31 5 227 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 9.77e-21 100 32 7 261 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
Q93FH3 4.39e-21 100 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH0 4.51e-21 100 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
J9VWU3 4.63e-21 100 22 17 559 2 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
O07549 4.81e-21 100 24 9 352 1 yheH Probable multidrug resistance ABC transporter ATP-binding/permease protein YheH Bacillus subtilis (strain 168)
P0C086 4.97e-21 100 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH6 4.97e-21 100 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C087 4.97e-21 100 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P16532 5.24e-21 100 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH2 5.24e-21 100 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q933E0 5.88e-21 100 27 5 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Bibersteinia trehalosi
P0CU83 5.97e-21 101 31 5 227 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 2.67e-20 99 31 6 261 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q2L219 6.15e-21 95 34 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella avium (strain 197N)
Q483B6 6.25e-21 100 22 13 507 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P22638 6.28e-21 100 28 4 241 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
F2Q5G0 6.96e-21 100 31 5 227 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 8.75e-21 100 32 7 261 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
A0A059JK44 7.02e-21 100 31 5 227 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 8.75e-21 100 32 7 261 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
Q21NS8 7.12e-21 100 27 5 265 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9M0G9 7.26e-21 100 27 2 241 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q20Z38 7.38e-21 100 29 5 240 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q5RKI8 7.75e-21 100 31 4 220 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
Q89A97 8.03e-21 99 21 8 380 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q669P3 8.86e-21 94 34 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q54RU1 9.03e-21 100 27 5 244 3 abcB6 ABC transporter B family member 6 Dictyostelium discoideum
Q6CX96 9.59e-21 100 23 13 430 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q1RJ91 1.02e-20 99 27 3 218 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
Q1QX69 1.05e-20 99 23 14 502 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q4WSI1 1.06e-20 100 26 11 376 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 7.53e-18 91 30 5 220 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P9WQJ3 1.06e-20 99 28 5 313 1 Rv1272c Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ2 1.06e-20 99 28 5 313 3 MT1310 Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63398 1.06e-20 99 28 5 313 3 BQ2027_MB1303C Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q3IL62 1.27e-20 94 29 6 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
P15031 1.42e-20 94 32 6 233 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
A0A1U8QG99 1.52e-20 99 30 6 229 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QG99 7.89e-13 75 26 5 240 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q751N2 1.59e-20 99 24 13 433 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q9Y8G2 1.66e-20 99 30 6 229 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G2 8.91e-13 75 26 5 240 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q08D64 1.84e-20 99 29 3 218 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
Q5WVN2 2e-20 98 31 3 216 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Lens)
Q5E0F2 2.11e-20 98 23 17 514 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3J7R8 2.2e-20 98 27 9 318 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
P08716 2.26e-20 98 26 6 308 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q87R16 2.26e-20 98 29 2 219 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q02592 2.32e-20 99 27 4 232 2 hmt1 Heavy metal tolerance protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9FUT3 2.37e-20 98 27 2 241 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
Q4WPP6 2.45e-20 99 29 3 214 2 mdr2 ABC multidrug transporter mdr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5RFQ9 2.51e-20 98 30 4 220 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
Q6AMR9 2.52e-20 93 31 4 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9LSJ2 2.65e-20 99 32 6 216 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9LSJ2 8.8e-19 94 26 6 323 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
P75094 2.79e-20 98 27 3 219 3 MPN_019 Putative ABC transporter ATP-binding protein MG015 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
S0EGU4 2.83e-20 99 29 4 225 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P55122 2.95e-20 98 27 6 303 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
O31707 3.07e-20 97 24 13 504 3 yknU Uncharacterized ABC transporter ATP-binding protein YknU Bacillus subtilis (strain 168)
P10089 3.11e-20 98 26 6 308 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q8G0T8 3.11e-20 98 27 5 311 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella suis biovar 1 (strain 1330)
Q47258 3.13e-20 98 26 6 308 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q8FDZ8 3.19e-20 98 26 6 308 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O14286 3.66e-20 98 22 13 455 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0VQP5 3.97e-20 97 22 16 517 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2J0F4 3.98e-20 97 30 6 250 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain HaA2)
Q4HVU7 4.14e-20 97 26 8 315 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9NP58 4.2e-20 98 28 3 245 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
P0C529 4.24e-20 97 27 5 311 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus biovar 1 (strain 9-941)
Q2YQ73 4.24e-20 97 27 5 311 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus (strain 2308)
Q15UY7 4.38e-20 97 23 16 572 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2YU20 4.4e-20 97 28 4 230 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q73P71 4.72e-20 93 28 6 238 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q1LQD3 4.87e-20 97 25 10 327 3 msbA ATP-dependent lipid A-core flippase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P9WQJ0 4.92e-20 97 32 3 226 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9LVM1 4.98e-20 97 24 8 362 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
Q9NUT2 5.03e-20 97 30 4 220 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
Q2G2M9 5.13e-20 97 28 4 230 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 5.13e-20 97 28 4 230 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 5.13e-20 97 28 4 230 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 5.13e-20 97 28 4 230 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 5.13e-20 97 28 4 230 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 5.13e-20 97 28 4 230 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 5.13e-20 97 28 4 230 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 5.13e-20 97 28 4 230 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
Q6BXD7 5.28e-20 97 23 13 486 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P0A4W5 5.38e-20 97 32 3 226 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 5.38e-20 97 32 3 226 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q6FZF2 5.53e-20 97 33 4 200 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella quintana (strain Toulouse)
Q92V71 5.64e-20 93 32 7 227 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium meliloti (strain 1021)
Q5ZUH9 6.77e-20 97 31 3 216 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A0A125QXJ1 7e-20 97 28 2 241 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q57180 7.45e-20 97 24 9 417 3 HI_1051 Uncharacterized ABC transporter ATP-binding protein HI_1051 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q04473 7.7e-20 97 27 5 303 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q8DAV2 8.27e-20 96 28 3 219 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q4WLN7 8.31e-20 97 26 5 292 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q7MJ07 9.45e-20 96 28 3 219 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q5E0B3 1.04e-19 92 31 6 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q48P40 1.11e-19 96 25 10 405 3 msbA ATP-dependent lipid A-core flippase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6LPK2 1.19e-19 91 32 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photobacterium profundum (strain SS9)
Q82VL9 1.24e-19 91 31 8 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9M0M2 1.29e-19 97 33 4 200 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9M0M2 1.5e-17 90 29 3 204 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9LSJ8 1.43e-19 96 27 11 316 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q9LSJ8 4.7e-17 89 29 2 202 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q1IKM7 1.44e-19 90 32 7 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Koribacter versatilis (strain Ellin345)
Q142P6 1.47e-19 95 28 9 339 3 msbA ATP-dependent lipid A-core flippase Paraburkholderia xenovorans (strain LB400)
Q9DC29 1.47e-19 96 29 2 217 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
P78966 1.62e-19 96 33 6 210 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.87e-17 90 35 4 199 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8YH20 1.7e-19 95 27 5 311 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9PEE7 1.71e-19 95 31 6 229 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
P47261 1.79e-19 95 25 3 232 3 MG015 Putative ABC transporter ATP-binding protein MG015 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q56A55 1.84e-19 95 31 4 229 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Danio rerio
Q9ZNB0 1.85e-19 95 26 8 404 3 SCO0742 Uncharacterized ABC transporter ATP-binding protein SCO0742 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B2KWH4 1.9e-19 96 27 9 325 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 4.22e-16 85 29 4 206 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
Q9LSJ5 1.94e-19 96 27 7 307 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9LSJ5 3.01e-19 95 31 6 223 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9ZR72 2e-19 96 32 3 203 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q9ZR72 2.23e-13 77 28 4 203 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q5WUF8 2.13e-19 90 31 7 236 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q6AJW3 2.15e-19 95 24 9 336 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P12866 2.21e-19 96 24 6 336 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12866 1.46e-14 80 30 4 188 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2KDV1 2.47e-19 91 32 8 233 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7VL52 2.64e-19 95 28 7 270 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0I4C5 2.69e-19 95 29 7 213 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
Q87HN4 2.96e-19 93 33 7 211 3 modC Molybdenum import ATP-binding protein ModC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87EF0 3.05e-19 94 31 6 229 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q7MJ01 3.1e-19 90 32 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio vulnificus (strain YJ016)
Q8DAV6 3.1e-19 90 32 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio vulnificus (strain CMCP6)
Q4WTT9 3.19e-19 95 31 6 258 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 6.12e-16 85 28 5 235 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q46Y89 3.47e-19 94 25 10 328 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
O70595 3.65e-19 95 29 2 217 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
P16876 3.72e-19 95 33 4 208 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16876 1.05e-15 84 30 4 206 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q2ULH4 3.76e-19 95 24 18 484 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q6F0V4 4.1e-19 92 31 9 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q1MAB5 4.26e-19 94 30 4 215 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9LJX0 4.36e-19 95 30 4 218 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q9LJX0 3.19e-13 76 25 6 337 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q2RZ08 4.41e-19 90 35 8 220 3 hmuV Hemin import ATP-binding protein HmuV Salinibacter ruber (strain DSM 13855 / M31)
Q9WYC4 4.66e-19 94 26 9 316 1 TM_0288 Uncharacterized ABC transporter ATP-binding protein TM_0288 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P45082 4.81e-19 94 36 7 225 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JI39 4.82e-19 94 32 5 209 1 Abcb10 ATP-binding cassette sub-family B member 10, mitochondrial Mus musculus
Q9FHF1 4.88e-19 95 31 2 197 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FHF1 1.51e-16 87 30 4 204 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q00748 5.32e-19 95 35 4 194 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q00748 6.83e-15 82 22 18 560 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
P35071 5.42e-19 95 28 7 252 2 CFTR Cystic fibrosis transmembrane conductance regulator Bos taurus
P35071 1.26e-07 58 25 5 208 2 CFTR Cystic fibrosis transmembrane conductance regulator Bos taurus
Q4ZZ16 5.45e-19 94 25 10 405 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. syringae (strain B728a)
Q83CV2 6e-19 89 30 7 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q2NUA5 6.72e-19 94 31 8 224 3 msbA ATP-dependent lipid A-core flippase Sodalis glossinidius (strain morsitans)
Q03519 6.92e-19 94 29 1 198 1 TAP2 Antigen peptide transporter 2 Homo sapiens
Q1MMZ3 7.07e-19 90 32 8 239 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6C6N0 7.98e-19 94 23 11 427 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q15TB1 8.81e-19 89 29 5 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q44613 9.09e-19 89 28 4 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q39T41 9.21e-19 89 32 5 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q1RK34 9.41e-19 88 31 9 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia bellii (strain RML369-C)
Q31FG2 9.9e-19 93 23 6 314 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5X498 1.03e-18 93 30 3 216 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Paris)
Q00449 1.04e-18 94 36 4 187 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q00449 3.12e-18 92 27 6 278 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
P57551 1.08e-18 93 24 9 322 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q2LVL0 1.1e-18 93 24 6 297 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q9HUG8 1.12e-18 93 24 18 562 3 msbA ATP-dependent lipid A-core flippase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0VT01 1.22e-18 93 30 4 212 3 macB Macrolide export ATP-binding/permease protein MacB Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q59R09 1.29e-18 93 21 10 441 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q07DW5 1.42e-18 93 27 6 250 3 CFTR Cystic fibrosis transmembrane conductance regulator Muntiacus reevesi
Q07DW5 1.94e-07 58 26 5 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Muntiacus reevesi
O80725 1.46e-18 93 32 3 203 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 4.44e-16 85 29 5 237 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
Q5NN23 1.48e-18 88 35 6 197 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q8E8K8 1.49e-18 90 33 7 213 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5ZT78 1.5e-18 88 30 6 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q6D664 1.5e-18 88 32 7 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P54954 1.51e-18 89 29 8 237 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q5H0H0 1.56e-18 92 32 6 224 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 1.56e-18 92 32 6 224 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P16877 1.59e-18 93 33 4 208 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16877 1.3e-15 84 26 5 260 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q3IM24 1.61e-18 89 30 6 235 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A0A059JJ46 1.63e-18 93 32 7 258 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JJ46 2.99e-17 89 29 5 236 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
Q6LPK6 1.69e-18 92 29 2 218 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
F2T1C4 1.78e-18 93 32 7 258 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2T1C4 5.86e-17 88 28 5 236 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q9FNU2 1.83e-18 92 28 11 321 2 ABCB25 ABC transporter B family member 25 Oryza sativa subsp. japonica
Q8LPQ6 1.84e-18 92 27 4 247 2 ABCB28 ABC transporter B family member 28 Arabidopsis thaliana
Q8P8W4 2e-18 92 29 7 267 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 2e-18 92 29 7 267 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q9NRK6 2.11e-18 92 30 3 206 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
B5X0E4 2.15e-18 93 33 5 222 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 1.8e-14 80 25 6 243 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
Q6PQZ2 2.16e-18 93 27 6 251 2 CFTR Cystic fibrosis transmembrane conductance regulator Sus scrofa
Q6PQZ2 6.66e-08 59 27 6 208 2 CFTR Cystic fibrosis transmembrane conductance regulator Sus scrofa
Q480N3 2.28e-18 92 25 5 294 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q8K985 2.3e-18 92 27 4 230 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q07LY2 2.3e-18 88 32 7 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
P37774 2.39e-18 88 31 9 229 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q54BU4 2.47e-18 92 27 5 236 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q5X2Z8 2.5e-18 87 30 6 232 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q09YJ4 2.51e-18 92 27 6 250 3 CFTR Cystic fibrosis transmembrane conductance regulator Muntiacus muntjak
Q09YJ4 1.86e-07 58 26 5 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Muntiacus muntjak
Q63H62 2.55e-18 89 28 6 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
P63359 2.96e-18 91 28 4 221 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 2.96e-18 91 28 4 221 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 2.96e-18 91 28 4 221 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
Q5B1Q2 3.06e-18 92 26 5 292 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q7RX59 3.15e-18 92 23 14 487 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q8LPK2 3.2e-18 92 31 6 233 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q8LPK2 5e-18 92 30 3 213 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q2M3G0 3.67e-18 92 25 12 461 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 7.45e-14 78 25 4 260 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q00555 3.68e-18 92 27 5 226 1 CFTR Cystic fibrosis transmembrane conductance regulator Ovis aries
Q00555 1.56e-07 58 26 5 207 1 CFTR Cystic fibrosis transmembrane conductance regulator Ovis aries
Q31I88 3.68e-18 88 31 11 269 3 pstB Phosphate import ATP-binding protein PstB Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q63GR8 3.72e-18 89 29 7 238 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q9RR46 4.14e-18 90 30 8 228 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q74AT2 4.17e-18 87 34 7 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q65U21 4.17e-18 91 28 2 207 3 msbA ATP-dependent lipid A-core flippase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q07E16 4.2e-18 92 28 7 240 3 CFTR Cystic fibrosis transmembrane conductance regulator Mustela putorius furo
Q07E16 2.17e-09 64 26 6 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Mustela putorius furo
O34900 4.28e-18 87 32 8 218 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q3Z3K7 4.37e-18 91 28 4 221 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
Q5PGH0 4.4e-18 91 28 4 221 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
O67154 4.41e-18 87 32 8 221 3 pstB Phosphate import ATP-binding protein PstB Aquifex aeolicus (strain VF5)
Q7W9N7 4.43e-18 91 25 5 315 3 msbA ATP-dependent lipid A-core flippase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH20 4.43e-18 91 25 5 315 3 msbA ATP-dependent lipid A-core flippase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P68580 4.49e-18 91 22 7 375 3 sunT Sublancin-168-processing and transport ATP-binding protein sunT Bacillus phage SPbeta
P68579 4.49e-18 91 22 7 375 3 sunT SPbeta prophage-derived sublancin-168-processing and transport ATP-binding protein SunT Bacillus subtilis (strain 168)
Q73EL7 4.52e-18 89 29 7 238 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81ZF5 4.56e-18 89 29 7 238 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q9SGY1 4.6e-18 92 30 7 207 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9SGY1 1.55e-17 90 28 3 222 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q7VWD8 4.63e-18 91 25 5 315 3 msbA ATP-dependent lipid A-core flippase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P94367 4.64e-18 91 23 9 399 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
Q6HP89 4.65e-18 89 29 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q9JXR3 4.69e-18 91 26 8 325 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8NVB5 4.83e-18 87 29 5 205 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MW2)
Q6G799 4.83e-18 87 29 5 205 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MSSA476)
Q2ISN3 4.83e-18 87 33 7 223 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain HaA2)
Q9JW59 4.95e-18 91 25 5 322 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q6YUU5 5.14e-18 92 33 3 207 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q6YUU5 5.38e-17 88 31 3 197 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q12NL5 5.29e-18 86 33 6 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
P23174 5.33e-18 91 28 3 226 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 2.73e-16 86 29 4 224 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
Q3SFZ6 5.36e-18 90 26 7 304 3 msbA ATP-dependent lipid A-core flippase Thiobacillus denitrificans (strain ATCC 25259)
Q6NBX6 5.45e-18 87 33 8 235 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9C7F2 5.46e-18 91 28 4 229 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9C7F2 1.52e-17 90 23 15 558 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
P36370 5.5e-18 91 30 4 220 1 Tap1 Antigen peptide transporter 1 Rattus norvegicus
O70014 5.65e-18 87 30 7 237 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q73F67 5.92e-18 87 28 6 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81J16 6.08e-18 87 29 6 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9M1Q9 6.21e-18 91 32 3 203 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9M1Q9 6.61e-17 88 29 5 224 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
P21449 6.68e-18 91 28 3 232 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21449 1.05e-16 87 29 4 215 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
F2RP52 7.15e-18 91 31 7 258 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RP52 3.41e-17 89 29 5 236 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2PRR1 7.15e-18 91 31 7 258 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2PRR1 3.41e-17 89 29 5 236 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q52402 7.21e-18 90 30 9 305 3 aarD Transport ATP-binding protein AarD Providencia stuartii
Q20Y31 7.71e-18 87 32 7 224 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q7VR44 7.85e-18 90 26 9 279 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
Q83LP0 8.26e-18 90 28 4 221 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
Q0ASG3 8.35e-18 87 31 8 235 3 pstB Phosphate import ATP-binding protein PstB Maricaulis maris (strain MCS10)
Q6HPN0 8.38e-18 87 28 6 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 8.38e-18 87 28 6 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 8.38e-18 87 28 6 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q1RDU4 8.41e-18 90 28 4 221 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
Q8FJB1 8.41e-18 90 28 4 221 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 8.41e-18 90 28 4 221 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0AAG5 8.79e-18 90 26 3 283 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 8.79e-18 90 26 3 283 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 8.79e-18 90 26 3 283 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
Q32E34 9.02e-18 90 28 4 221 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 9.02e-18 90 28 4 221 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
P60752 9.02e-18 90 28 4 221 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
P60753 9.02e-18 90 28 4 221 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
Q07DY5 9.05e-18 91 28 5 213 3 CFTR Cystic fibrosis transmembrane conductance regulator Colobus guereza
Q07DY5 3.39e-10 67 26 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Colobus guereza
Q1GZI0 9.13e-18 90 32 6 230 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q5F4X8 9.28e-18 90 25 5 322 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8UIW7 9.32e-18 87 30 7 222 3 phnC Phosphonates import ATP-binding protein PhnC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7A470 9.81e-18 87 28 6 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain N315)
Q99S47 9.81e-18 87 28 6 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q32AY3 1.05e-17 86 31 7 235 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q8FCJ1 1.06e-17 86 31 7 235 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 1.06e-17 86 31 7 235 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9GTN7 1.12e-17 90 28 3 228 1 tagA Serine protease/ABC transporter B family protein tagA Dictyostelium discoideum
Q2QL83 1.15e-17 90 28 7 234 3 CFTR Cystic fibrosis transmembrane conductance regulator Microcebus murinus
Q2QL83 1.84e-09 64 26 5 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Microcebus murinus
Q8DMY0 1.16e-17 87 30 8 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04HV8 1.16e-17 87 30 8 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P21440 1.18e-17 90 30 4 215 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 1.97e-17 90 27 3 226 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q7NZU6 1.18e-17 90 22 4 393 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q4ZLS1 1.22e-17 86 33 6 207 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q9LHD1 1.26e-17 90 30 5 208 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9LHD1 1.57e-17 90 30 2 202 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q5HDY6 1.28e-17 86 28 6 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain COL)
Q2FW34 1.28e-17 86 28 6 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FER7 1.28e-17 86 28 6 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain USA300)
P71082 1.29e-17 89 26 9 319 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
P97998 1.38e-17 90 30 5 209 3 MDL1 ATP-dependent permease MDL1 Candida albicans
P33311 1.44e-17 90 26 9 312 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54537 1.46e-17 85 29 5 208 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q48CA0 1.57e-17 86 33 6 207 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8UCM5 1.63e-17 85 30 6 230 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q66CI3 1.68e-17 89 27 4 221 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 1.68e-17 89 27 4 221 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 1.68e-17 89 27 4 221 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 1.68e-17 89 27 4 221 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q87UI3 1.76e-17 86 33 6 207 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7N6C6 1.78e-17 89 29 4 207 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q3BTC8 1.78e-17 89 30 8 283 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
P29018 1.79e-17 89 31 8 312 1 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Escherichia coli (strain K12)
Q64Z80 1.86e-17 84 29 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q00554 1.87e-17 90 28 5 207 2 CFTR Cystic fibrosis transmembrane conductance regulator Oryctolagus cuniculus
Q00554 1.75e-09 64 26 5 207 2 CFTR Cystic fibrosis transmembrane conductance regulator Oryctolagus cuniculus
P21439 1.94e-17 90 26 3 227 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 2.73e-15 83 30 7 223 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
Q31GF5 1.95e-17 85 29 6 238 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5LI72 2.07e-17 84 29 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q6GEL4 2.11e-17 86 27 10 250 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain MRSA252)
Q9FWX7 2.19e-17 89 31 4 205 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 1.32e-16 87 28 3 218 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9SYI3 2.22e-17 89 31 4 204 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 3.94e-16 85 30 9 276 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q03PY6 2.29e-17 86 29 9 242 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q2KYS6 2.29e-17 89 25 6 313 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
Q00552 2.51e-17 89 28 5 207 2 CFTR Cystic fibrosis transmembrane conductance regulator Cavia porcellus
Q00552 9.42e-10 65 26 6 209 2 CFTR Cystic fibrosis transmembrane conductance regulator Cavia porcellus
Q0WML0 2.64e-17 89 28 5 239 1 ABCB27 ABC transporter B family member 27 Arabidopsis thaliana
Q00PJ2 2.65e-17 89 28 5 213 3 CFTR Cystic fibrosis transmembrane conductance regulator Atelerix albiventris
Q00PJ2 2.02e-09 64 25 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Atelerix albiventris
Q2QL74 2.74e-17 89 27 6 215 3 CFTR Cystic fibrosis transmembrane conductance regulator Didelphis virginiana
Q2QL74 5.92e-10 66 26 7 244 3 CFTR Cystic fibrosis transmembrane conductance regulator Didelphis virginiana
P47705 2.82e-17 86 28 6 243 3 MG467 Putative ABC transporter ATP-binding protein MG467 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5U820 2.89e-17 89 27 7 240 2 CFTR Cystic fibrosis transmembrane conductance regulator Canis lupus familiaris
Q5U820 6.92e-10 65 27 5 203 2 CFTR Cystic fibrosis transmembrane conductance regulator Canis lupus familiaris
B2GUP8 2.96e-17 89 28 5 235 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
Q6GEL3 3.02e-17 85 29 6 211 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MRSA252)
Q8D740 3.09e-17 87 33 9 218 3 modC Molybdenum import ATP-binding protein ModC Vibrio vulnificus (strain CMCP6)
Q839D4 3.19e-17 85 30 7 221 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8PKS5 3.25e-17 88 29 8 283 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
P57383 3.32e-17 84 26 6 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5NZT6 3.35e-17 84 32 7 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2NU23 3.39e-17 84 31 7 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q9C7F8 3.48e-17 89 28 4 229 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9C7F8 5.29e-17 88 27 5 251 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q2YYM4 3.51e-17 85 30 6 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L885 3.57e-17 85 27 5 212 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus haemolyticus (strain JCSC1435)
Q8RI39 3.62e-17 87 30 8 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9FWX8 3.63e-17 89 30 4 208 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9FWX8 1.14e-15 84 28 3 208 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q1R597 3.87e-17 84 30 7 235 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
O34392 3.91e-17 84 30 5 194 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q2QLA3 3.99e-17 89 29 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Equus caballus
Q2QLA3 3.72e-10 66 26 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Equus caballus
P45022 4.29e-17 84 31 9 224 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87R20 4.35e-17 84 32 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9TSP5 4.35e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Papio anubis
Q9TSP5 3.99e-10 66 25 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Papio anubis
Q09YK5 4.43e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Ateles geoffroyi
Q09YK5 1.72e-08 61 25 6 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Ateles geoffroyi
Q9TUQ2 4.43e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca nemestrina
Q9TUQ2 3.82e-10 66 26 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca nemestrina
Q00553 4.43e-17 89 28 6 209 2 CFTR Cystic fibrosis transmembrane conductance regulator Macaca mulatta
Q00553 3.92e-10 66 26 5 208 2 CFTR Cystic fibrosis transmembrane conductance regulator Macaca mulatta
Q7JII7 4.43e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca fuscata fuscata
Q7JII7 3.92e-10 66 26 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca fuscata fuscata
Q7JII8 4.43e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca fascicularis
Q7JII8 3.92e-10 66 26 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca fascicularis
Q87VF3 4.46e-17 88 24 11 407 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2QLF9 4.47e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Callithrix jacchus
Q2QLF9 1.07e-08 62 25 6 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Callithrix jacchus
Q07DV2 4.47e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Aotus nancymaae
Q07DV2 1.82e-08 61 25 6 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Aotus nancymaae
P06795 4.48e-17 89 27 3 237 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 2.97e-16 86 28 4 215 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
Q2JLH7 4.48e-17 85 27 7 259 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6D7D0 4.5e-17 86 34 9 217 3 modC Molybdenum import ATP-binding protein ModC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2IBE4 4.67e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Pongo abelii
Q2IBE4 4.46e-09 63 25 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Pongo abelii
Q2QLB4 4.71e-17 89 28 5 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Plecturocebus moloch
Q2QLB4 8.35e-09 62 22 12 333 3 CFTR Cystic fibrosis transmembrane conductance regulator Plecturocebus moloch
P57066 4.73e-17 84 32 6 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9PHQ1 4.82e-17 84 28 7 227 3 pstB Phosphate import ATP-binding protein PstB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q3B2U2 4.83e-17 84 28 6 216 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q09YH0 4.83e-17 89 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Saimiri boliviensis boliviensis
Q09YH0 1.85e-08 61 25 6 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Saimiri boliviensis boliviensis
Q5HVF4 4.86e-17 84 28 7 227 3 pstB Phosphate import ATP-binding protein PstB Campylobacter jejuni (strain RM1221)
Q108U0 5.09e-17 89 28 5 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Loxodonta africana
Q108U0 1.32e-09 65 26 5 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Loxodonta africana
Q08201 5.11e-17 88 27 3 227 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 7.97e-17 88 30 4 215 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q65P77 5.29e-17 85 29 5 219 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q2IBA1 5.32e-17 88 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Chlorocebus aethiops
Q2IBA1 4.31e-10 66 25 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Chlorocebus aethiops
Q07DX5 5.41e-17 88 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Nomascus leucogenys
Q07DX5 2.05e-07 57 26 6 223 3 CFTR Cystic fibrosis transmembrane conductance regulator Nomascus leucogenys
Q4ZT65 5.43e-17 88 32 7 213 3 syfD Probable syringafactin export ATP-binding/permease protein SyfD Pseudomonas syringae pv. syringae (strain B728a)
Q2QLE5 5.55e-17 88 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Pan troglodytes
Q2QLE5 5.87e-09 62 25 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Pan troglodytes
Q8PKT0 5.56e-17 84 29 6 236 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas axonopodis pv. citri (strain 306)
P21448 5.57e-17 88 28 3 226 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 8.92e-17 87 29 4 215 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
Q2IBF6 5.8e-17 88 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Gorilla gorilla gorilla
Q2IBF6 5.3e-09 63 25 5 208 3 CFTR Cystic fibrosis transmembrane conductance regulator Gorilla gorilla gorilla
Q2QLH0 6.22e-17 88 28 5 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Otolemur garnettii
Q2QLH0 1.01e-10 68 28 5 207 3 CFTR Cystic fibrosis transmembrane conductance regulator Otolemur garnettii
P44407 6.33e-17 87 29 5 205 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4KKK8 6.52e-17 85 33 6 218 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q132E8 6.58e-17 84 32 8 235 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q4QPI4 6.62e-17 87 29 5 205 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q9KLL9 6.67e-17 85 33 6 203 3 modC Molybdenum import ATP-binding protein ModC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8Y4E9 6.69e-17 84 28 7 228 3 pstB2 Phosphate import ATP-binding protein PstB 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q55196 6.73e-17 84 30 6 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5F8K2 6.93e-17 83 33 8 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P13569 7.15e-17 88 28 6 209 1 CFTR Cystic fibrosis transmembrane conductance regulator Homo sapiens
P13569 4.7e-09 63 25 5 208 1 CFTR Cystic fibrosis transmembrane conductance regulator Homo sapiens
Q98FA5 7.19e-17 84 33 8 238 3 thiQ Thiamine import ATP-binding protein ThiQ Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6F9X0 7.2e-17 87 24 11 387 3 msbA ATP-dependent lipid A-core flippase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q2QLC5 7.34e-17 88 29 7 234 3 CFTR Cystic fibrosis transmembrane conductance regulator Carollia perspicillata
Q2QLC5 4.02e-09 63 28 6 209 3 CFTR Cystic fibrosis transmembrane conductance regulator Carollia perspicillata
Q38UU0 7.43e-17 84 29 8 241 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Latilactobacillus sakei subsp. sakei (strain 23K)
P08183 7.57e-17 88 27 3 227 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 7.1e-16 85 28 4 219 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P11599 7.64e-17 87 26 5 303 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Proteus vulgaris
Q927Z7 8.01e-17 84 28 7 228 3 pstB2 Phosphate import ATP-binding protein PstB 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q3BTD3 8.05e-17 83 28 6 238 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q71WT2 8.08e-17 84 28 7 228 3 pstB2 Phosphate import ATP-binding protein PstB 2 Listeria monocytogenes serotype 4b (strain F2365)
Q97N51 8.13e-17 84 29 8 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q13X01 8.19e-17 83 35 7 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Paraburkholderia xenovorans (strain LB400)
Q07DZ6 8.3e-17 88 27 8 240 3 CFTR Cystic fibrosis transmembrane conductance regulator Ornithorhynchus anatinus
Q07DZ6 8.63e-11 68 24 7 246 3 CFTR Cystic fibrosis transmembrane conductance regulator Ornithorhynchus anatinus
Q3A6U0 8.36e-17 84 31 7 231 3 pstB Phosphate import ATP-binding protein PstB Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
P34713 8.9e-17 87 28 5 255 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P34713 1.1e-13 78 24 12 403 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
Q9CMG7 8.91e-17 87 28 5 215 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q30W28 8.95e-17 84 30 6 234 3 phnC Phosphonates import ATP-binding protein PhnC Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1BY14 9.02e-17 85 32 6 217 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 9.02e-17 85 32 6 217 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q7N3A6 9.05e-17 83 30 7 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8VNL9 9.44e-17 84 27 5 224 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q13W55 9.8e-17 84 28 7 263 3 pstB Phosphate import ATP-binding protein PstB Paraburkholderia xenovorans (strain LB400)
Q52815 1.01e-16 83 28 7 242 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9Y8G1 1.02e-16 87 31 3 206 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q9Y8G1 3.48e-16 86 27 4 237 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q81IN8 1.03e-16 85 29 6 218 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8X5N2 1.09e-16 83 30 7 235 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q042G7 1.14e-16 85 30 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q5D1Z7 1.15e-16 87 27 6 215 2 CFTR Cystic fibrosis transmembrane conductance regulator Trichosurus vulpecula
Q5D1Z7 3.36e-10 67 27 6 209 2 CFTR Cystic fibrosis transmembrane conductance regulator Trichosurus vulpecula
Q68W38 1.2e-16 82 29 8 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P47425 1.22e-16 83 29 4 214 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9I6L0 1.25e-16 84 31 6 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P21441 1.28e-16 87 33 5 210 3 PGPA Multidrug resistance protein Leishmania tarentolae
P21441 7.34e-10 65 30 8 216 3 PGPA Multidrug resistance protein Leishmania tarentolae
Q5BAY0 1.28e-16 87 31 3 206 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 4.06e-16 85 27 4 237 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P33527 1.29e-16 87 27 9 305 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
P33527 3.28e-11 70 29 3 197 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
Q7WNT8 1.3e-16 83 32 9 226 3 phnC Phosphonates import ATP-binding protein PhnC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14180
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 51151 - 52821 (strand: 1)
Length 1671 (nucleotides) / 556 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_123
Orthogroup size 11
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1132 Defense mechanisms (V) V ABC-type multidrug transport system, ATPase and permease component

Protein Sequence

MKANLLKTNPLINLIFSMKGTVLLMILSAVLDGICGLLLIPVILTWQHDPTPALWQLGIATVITLLVQYIALQRGFFAGSNLMHRLTKALVSHIPRRLSRDNHAQGLLSGAVMQAMGIPAHLLAPLVGTIVMPLTIIIGLLFYHPGLAALFAATAFILIAALRLSAVRLNRAETQLISARADAAQALGDFARHQALLRKSGQMSDAAQQLEQTLYAQQQSQVQVLRRSLPYHLLFSLLIQLLFIVVLVWGALQVSGGTVALNGWLAVMILIARFIEPLHQLSHIDQALRQAGTALNAINRELTGKTRHSPAQSRSPSTLIITADNLNLVSDEGKPLLHDVSFACPENRLTVITGSSGAGKTTLLHLLARTADPQSGVVSYGDMPVTMLSETVLASVRQLVTQSSHLLRGTLRWSLLQGATQPDDEAVIAQLHSLGLTVTAAQLDEDTGEQGDCFAGGQKQRLCLARALLAKPSVLLLDEPTASLDVLSRKRVIDTLAEWPGTRIIVTHSSELARRADHLIVMAEGQICAQGLPADVAAQSDWFARFCTGQTENSEN

Flanking regions ( +/- flanking 50bp)

GGCGCAATGCCCGTCTTACCGGCACTTTGCGCGGCAGCAGGAGGTTTCTCATGAAAGCTAATCTGCTTAAGACCAATCCGCTGATAAATCTTATTTTTTCCATGAAAGGCACTGTGCTGCTGATGATACTGAGTGCAGTACTGGACGGGATCTGCGGATTATTGCTGATCCCGGTGATCCTGACCTGGCAGCATGATCCGACACCGGCACTGTGGCAACTGGGGATTGCGACGGTGATCACTCTGCTGGTGCAATATATTGCCCTGCAACGCGGATTTTTTGCCGGAAGCAATCTGATGCACCGGCTGACGAAAGCGCTGGTCAGTCATATCCCCCGTCGTTTATCACGCGATAATCATGCACAAGGGCTGTTATCAGGCGCGGTTATGCAGGCGATGGGCATTCCTGCGCATCTGCTTGCGCCTCTGGTCGGTACTATCGTGATGCCGCTGACAATTATCATTGGCTTACTGTTTTACCATCCGGGTCTGGCGGCACTGTTTGCCGCAACGGCATTTATCCTCATAGCGGCATTGCGTTTGAGTGCAGTGCGCCTGAACCGGGCTGAAACGCAGCTTATCAGTGCGCGGGCAGATGCTGCGCAGGCACTGGGTGATTTTGCGCGCCATCAGGCGTTATTGCGCAAAAGCGGGCAGATGAGTGATGCCGCGCAGCAGCTTGAACAAACTCTGTATGCGCAACAACAATCACAGGTACAGGTTTTACGTCGCAGTCTGCCGTACCATCTGCTGTTCAGCCTGTTGATCCAACTGCTGTTTATTGTGGTTTTGGTGTGGGGGGCGTTACAGGTTTCCGGCGGTACGGTGGCACTGAATGGCTGGCTGGCGGTGATGATCTTAATTGCCCGGTTTATTGAGCCGCTGCATCAGCTTTCCCATATTGACCAGGCATTGCGCCAGGCGGGAACGGCCCTGAATGCGATCAACCGGGAACTCACCGGGAAAACCCGCCACTCCCCGGCACAGAGCCGGAGTCCCTCTACACTGATCATTACGGCAGATAATCTGAATCTGGTATCAGATGAAGGAAAGCCGCTGCTGCATGATGTCTCTTTTGCCTGTCCGGAAAACCGGCTGACGGTTATTACCGGATCATCGGGTGCCGGAAAAACTACACTACTGCATCTGCTGGCACGAACCGCTGATCCGCAAAGTGGTGTGGTGAGTTACGGCGATATGCCGGTGACCATGCTGTCTGAAACTGTGCTGGCATCGGTGCGCCAGTTAGTCACTCAATCGTCGCACCTGTTGCGCGGCACACTGCGCTGGTCCCTGCTTCAGGGCGCGACACAGCCGGATGATGAGGCGGTGATTGCGCAACTGCACTCACTCGGTCTGACTGTCACAGCCGCTCAGCTGGATGAGGATACCGGGGAGCAGGGAGATTGTTTCGCCGGCGGGCAGAAGCAGCGCCTGTGTCTGGCAAGAGCCTTACTGGCGAAGCCGTCCGTGCTGCTGCTGGATGAACCGACAGCAAGCCTGGATGTATTAAGCCGTAAACGTGTGATTGATACACTGGCGGAATGGCCGGGGACGCGGATTATTGTCACCCACAGTTCGGAGCTGGCGCGCCGTGCTGACCATCTCATTGTGATGGCTGAAGGGCAGATTTGTGCGCAGGGGTTACCGGCAGATGTGGCGGCACAATCTGACTGGTTTGCCCGTTTTTGTACCGGGCAGACAGAAAATAGTGAAAATTGATCGGCAACAGTCGCGCTTTCTCAGCCAAACGGTCCGGCGAAACCAAATAA