Homologs in group_123

Help

10 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04870 FBDBKF_04870 100.0 Morganella morganii S1 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
NLDBIP_06480 NLDBIP_06480 100.0 Morganella morganii S4 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
LHKJJB_03360 LHKJJB_03360 100.0 Morganella morganii S3 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
HKOGLL_06835 HKOGLL_06835 100.0 Morganella morganii S5 sunT ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
F4V73_RS08975 F4V73_RS08975 22.4 Morganella psychrotolerans - type I secretion system permease/ATPase
F4V73_RS09455 F4V73_RS09455 23.2 Morganella psychrotolerans - type I secretion system permease/ATPase
F4V73_RS09470 F4V73_RS09470 86.3 Morganella psychrotolerans - peptidase domain-containing ABC transporter
F4V73_RS13135 F4V73_RS13135 88.6 Morganella psychrotolerans - peptidase domain-containing ABC transporter
F4V73_RS14175 F4V73_RS14175 22.2 Morganella psychrotolerans - ABC transporter ATP-binding protein
F4V73_RS14180 F4V73_RS14180 21.8 Morganella psychrotolerans - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_123

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_123

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9EXN5 0.0 1014 70 0 694 3 mchF Probable microcin-H47 secretion/processing ATP-binding protein MchF Escherichia coli
P22520 0.0 989 69 0 694 3 cvaB Colicin V secretion/processing ATP-binding protein CvaB Escherichia coli
P26760 2.06e-84 284 28 10 678 1 apxIB Toxin RTX-I translocation ATP-binding protein Actinobacillus pleuropneumoniae
P23702 6.65e-84 283 29 8 676 1 ltxB Leukotoxin export ATP-binding protein LtxB Aggregatibacter actinomycetemcomitans
Q04473 3.18e-83 281 28 7 690 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q9RCG7 7.06e-83 280 28 7 681 3 paxB Exotoxin translocation ATP-binding protein PaxB Pasteurella aerogenes
Q933I3 5.53e-82 277 28 8 675 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
Q93FH0 6.52e-82 277 28 8 675 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P16532 1.13e-81 276 28 8 675 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH2 1.13e-81 276 28 8 675 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH6 1.24e-81 276 27 6 674 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P55122 3.24e-81 275 27 6 674 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
P0C086 3.27e-81 275 27 8 675 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C087 3.27e-81 275 27 8 675 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FG6 4.02e-81 275 27 7 677 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q933E0 4.51e-81 275 27 8 675 3 lktB Leukotoxin translocation ATP-binding protein LktB Bibersteinia trehalosi
P0DKX5 6.61e-81 275 28 8 688 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX6 8.38e-81 274 28 8 688 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
Q93FH3 9.19e-81 274 27 8 675 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q8FDZ8 8.62e-78 266 28 9 673 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P10089 2.02e-77 265 28 9 673 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
P08716 3.28e-77 265 28 9 673 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
P59852 7.41e-77 263 27 12 692 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
Q47258 2.02e-76 263 28 10 674 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q46717 6.61e-73 253 26 6 673 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O157:H7
P59653 7.5e-72 250 25 7 684 1 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q03727 1.5e-71 249 25 7 684 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q00564 2.15e-71 249 27 9 684 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
P11599 2.16e-71 249 27 7 677 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Proteus vulgaris
Q9CJB8 2.08e-68 241 26 9 684 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q10418 1.87e-67 238 25 10 693 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
P36497 6.04e-62 223 26 12 695 3 pedD Pediocin PA-1 transport/processing ATP-binding protein PedD Pediococcus acidilactici
P71082 1.74e-57 208 28 11 551 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
Q2G2M9 9.35e-57 206 27 9 508 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 9.35e-57 206 27 9 508 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 9.35e-57 206 27 9 508 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 9.35e-57 206 27 9 508 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 9.35e-57 206 27 9 508 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 9.35e-57 206 27 9 508 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 9.35e-57 206 27 9 508 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 9.35e-57 206 27 9 508 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
Q2YU20 3.41e-56 204 27 9 508 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
O31708 7.32e-54 198 27 11 560 3 yknV Uncharacterized ABC transporter ATP-binding protein YknV Bacillus subtilis (strain 168)
Q9WYC4 4.17e-52 193 27 10 551 1 TM_0288 Uncharacterized ABC transporter ATP-binding protein TM_0288 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P33311 5.56e-52 196 31 9 449 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q3SFZ6 1.06e-51 192 29 12 564 3 msbA ATP-dependent lipid A-core flippase Thiobacillus denitrificans (strain ATCC 25259)
P54719 8.65e-50 187 28 8 532 3 yfiC Uncharacterized ABC transporter ATP-binding protein YfiC Bacillus subtilis (strain 168)
A0A348AXX9 3.79e-49 190 28 15 551 2 kk1G ABC-type transporter kk1G Curvularia clavata
A0A348AXX9 2.44e-24 113 30 9 285 2 kk1G ABC-type transporter kk1G Curvularia clavata
Q1QX69 4.86e-49 184 29 8 456 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q7NZU6 7.06e-49 184 28 12 550 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9NP78 9.63e-49 186 27 12 564 1 ABCB9 ABC-type oligopeptide transporter ABCB9 Homo sapiens
G5EFD4 1.35e-48 186 27 13 527 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
B5X0E4 1.52e-48 188 32 10 412 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 2.12e-39 160 40 6 232 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
Q8RY46 1.74e-48 185 32 15 469 1 ABCB26 ABC transporter B family member 26, chloroplastic Arabidopsis thaliana
Q9GTN7 7.92e-48 186 28 9 517 1 tagA Serine protease/ABC transporter B family protein tagA Dictyostelium discoideum
O31707 8.14e-48 181 26 11 543 3 yknU Uncharacterized ABC transporter ATP-binding protein YknU Bacillus subtilis (strain 168)
O06967 1.96e-47 180 29 12 531 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q83LP0 3.05e-47 179 26 17 557 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
P45861 3.26e-47 179 27 13 524 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
P36372 3.48e-47 181 27 9 497 1 Tap2 Antigen peptide transporter 2 Rattus norvegicus
Q5RFQ9 3.84e-47 181 29 13 508 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
P63359 4.51e-47 179 26 16 557 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 4.51e-47 179 26 16 557 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 4.51e-47 179 26 16 557 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
P21449 4.66e-47 183 31 12 469 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21449 1.1e-37 155 29 15 469 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
Q3Z3K7 6.59e-47 178 26 17 557 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
Q9QYJ4 6.95e-47 181 27 15 543 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Rattus norvegicus
Q5PGH0 7.55e-47 178 26 16 557 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9JJ59 8.81e-47 181 27 13 535 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Mus musculus
Q32E34 9.83e-47 178 26 17 557 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 9.83e-47 178 26 17 557 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
P60752 9.83e-47 178 26 17 557 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
P60753 9.83e-47 178 26 17 557 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
Q2LVL0 1.01e-46 178 27 7 493 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q2M3G0 1.08e-46 182 29 14 518 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 1.03e-36 152 39 6 242 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q54BU4 1.42e-46 181 27 9 496 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q56A55 1.44e-46 179 30 9 459 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Danio rerio
Q1RDU4 1.89e-46 177 26 17 557 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
Q8FJB1 1.89e-46 177 26 17 557 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 1.89e-46 177 26 17 557 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P21448 2.53e-46 181 31 11 473 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 9.82e-37 152 29 15 467 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P9WQJ3 3.53e-46 177 29 3 441 1 Rv1272c Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ2 3.53e-46 177 29 3 441 3 MT1310 Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63398 3.53e-46 177 29 3 441 3 BQ2027_MB1303C Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9NUT2 4.34e-46 178 29 13 508 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
Q0A4U4 5.64e-46 176 29 11 522 3 msbA ATP-dependent lipid A-core flippase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1RJ91 7.98e-46 175 29 6 462 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
Q4WPP6 8.91e-46 178 28 15 539 2 mdr2 ABC multidrug transporter mdr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9NRK6 1.21e-45 177 28 14 564 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q06034 1.28e-45 179 27 19 606 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q06034 1.42e-27 123 31 4 279 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q21NS8 1.37e-45 175 27 10 504 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
P21447 2.32e-45 178 30 11 473 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P21447 1.48e-39 160 30 15 469 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P08183 2.67e-45 178 30 12 469 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 3.49e-36 150 41 4 206 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
F2T1C4 3.68e-45 177 29 18 517 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2T1C4 1.71e-36 151 41 5 221 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P36619 3.71e-45 177 42 3 218 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36619 1.8e-29 129 35 3 217 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6LPK6 3.74e-45 173 27 20 561 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
Q4FS42 4.79e-45 173 27 14 542 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
F2RP52 5.05e-45 177 29 17 516 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RP52 4.69e-36 150 41 5 221 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2PRR1 5.05e-45 177 29 17 516 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2PRR1 4.69e-36 150 41 5 221 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q0VQP5 5.53e-45 173 28 10 469 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P06795 5.6e-45 177 30 10 468 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 1.48e-37 154 29 16 474 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
Q9FNU2 8.12e-45 173 28 11 487 2 ABCB25 ABC transporter B family member 25 Oryza sativa subsp. japonica
Q6AJW3 9.15e-45 172 30 15 468 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P36371 9.18e-45 174 26 12 506 1 Tap2 Antigen peptide transporter 2 Mus musculus
A0A059JJ46 9.19e-45 176 29 18 516 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JJ46 4.44e-36 150 41 5 221 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
O07550 1.29e-44 172 27 16 507 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
Q54BT3 1.39e-44 176 27 11 509 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q54BT3 1.77e-33 142 37 4 235 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
P34712 2.35e-44 175 28 14 586 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 4.08e-38 156 42 4 207 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
Q66CI3 2.41e-44 171 28 16 501 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 2.41e-44 171 28 16 501 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 2.41e-44 171 28 16 501 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 2.41e-44 171 28 16 501 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
K3VYH8 2.73e-44 175 27 11 483 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
K3VYH8 1.95e-23 110 28 6 278 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
Q7N6C6 2.91e-44 171 26 15 565 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2SZW0 4.34e-44 171 41 5 233 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P21439 4.57e-44 174 34 11 403 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 1.65e-35 148 38 7 246 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
Q39E73 6e-44 170 42 4 228 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P43245 7.97e-44 174 31 12 469 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
P43245 9.36e-35 145 38 7 239 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
Q63VX7 8.03e-44 170 41 5 233 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 8.03e-44 170 41 5 233 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 8.03e-44 170 41 5 233 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
Q5RKI8 1.19e-43 171 29 12 466 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
Q46Y89 1.23e-43 169 27 11 538 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9LSJ2 1.25e-43 173 26 11 503 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9LSJ2 1.27e-38 157 41 2 207 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q4QPI4 1.25e-43 169 26 12 520 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q9JI39 1.4e-43 171 29 16 573 1 Abcb10 ATP-binding cassette sub-family B member 10, mitochondrial Mus musculus
Q4WTT9 1.59e-43 172 28 14 504 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 7.79e-36 149 26 13 481 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q1BUV6 1.78e-43 169 42 4 228 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
Q9CXJ4 1.89e-43 170 29 12 466 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
Q9C7F8 3.44e-43 172 40 4 233 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9C7F8 1.5e-41 167 37 1 229 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q03519 3.44e-43 169 26 12 508 1 TAP2 Antigen peptide transporter 2 Homo sapiens
Q6D437 4.91e-43 167 26 15 534 3 msbA ATP-dependent lipid A-core flippase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1QBW0 6.13e-43 167 27 11 539 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8XXB6 8.08e-43 167 27 14 561 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1LQD3 8.79e-43 167 40 4 232 3 msbA ATP-dependent lipid A-core flippase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q08201 9.16e-43 170 32 14 457 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 1.04e-35 149 40 4 206 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q9KQW9 9.71e-43 166 26 17 553 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P44407 1.02e-42 166 26 12 520 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2NUA5 1.3e-42 166 27 15 511 3 msbA ATP-dependent lipid A-core flippase Sodalis glossinidius (strain morsitans)
P21440 1.44e-42 170 32 14 457 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 4.47e-36 150 41 5 207 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q5ZUH9 1.59e-42 166 27 13 518 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q0WML0 1.63e-42 167 29 11 475 1 ABCB27 ABC transporter B family member 27 Arabidopsis thaliana
P23174 1.68e-42 169 32 14 457 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 9.72e-35 145 38 4 206 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
Q9LSJ5 1.89e-42 169 34 8 311 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9LSJ5 1.15e-38 157 43 2 207 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9HUG8 2e-42 166 27 10 460 3 msbA ATP-dependent lipid A-core flippase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1USS5 2.07e-42 166 35 7 307 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
P70864 2.09e-42 166 35 7 307 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis
P55469 2.12e-42 166 29 15 469 3 NGR_a03510 Uncharacterized ABC transporter ATP-binding protein y4gM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8DAV2 2.38e-42 165 27 13 499 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q9CHL8 2.74e-42 165 26 8 467 1 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. lactis (strain IL1403)
Q2SIN5 3.04e-42 165 25 13 559 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q54W24 3.68e-42 167 27 10 488 3 abcB4 ABC transporter B family member 4 Dictyostelium discoideum
Q7MJ07 4.43e-42 164 27 13 499 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q8D2U8 5.87e-42 164 28 15 483 3 msbA ATP-dependent lipid A-core flippase Wigglesworthia glossinidia brevipalpis
Q3KJ31 7.99e-42 164 28 11 465 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
Q3J7R8 8.23e-42 164 26 13 545 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q9Y8G1 8.46e-42 167 43 5 210 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q9Y8G1 7.47e-34 143 38 3 219 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q5F4X8 9.17e-42 164 27 9 500 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5BAY0 9.57e-42 167 43 5 210 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 8.51e-34 142 38 3 219 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9ZR72 9.87e-42 167 42 2 227 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q9ZR72 3.56e-38 156 41 2 210 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
P54718 1.17e-41 163 32 3 286 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
Q87R16 1.27e-41 163 27 17 548 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4PH16 1.27e-41 166 28 21 581 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q6YUU5 1.4e-41 167 39 3 233 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q6YUU5 1.94e-39 160 45 2 207 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q28433 1.93e-41 165 26 11 466 2 TAP1 Antigen peptide transporter 1 Gorilla gorilla gorilla
Q5QU36 2.64e-41 162 25 12 569 3 msbA ATP-dependent lipid A-core flippase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q4WA92 2.76e-41 166 30 9 426 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WA92 2.75e-28 125 33 7 229 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5E0F2 3.42e-41 162 26 17 554 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q02592 3.83e-41 164 30 14 460 2 hmt1 Heavy metal tolerance protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0C529 4.02e-41 162 33 2 298 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus biovar 1 (strain 9-941)
Q2YQ73 4.02e-41 162 33 2 298 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus (strain 2308)
Q142P6 4.2e-41 162 39 4 228 3 msbA ATP-dependent lipid A-core flippase Paraburkholderia xenovorans (strain LB400)
Q9FWX8 6.32e-41 165 40 3 210 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9FWX8 7.09e-35 146 38 2 207 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
F2SQT8 6.63e-41 164 32 10 357 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2SQT8 1.08e-35 149 27 10 465 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q8LPK2 6.67e-41 164 42 3 214 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q8LPK2 4.09e-35 147 37 3 223 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q4HVU7 6.77e-41 162 27 11 463 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q8G0T8 8.13e-41 161 33 2 298 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella suis biovar 1 (strain 1330)
Q9CMG7 8.45e-41 161 26 13 531 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q03518 9.52e-41 162 26 11 466 1 TAP1 Antigen peptide transporter 1 Homo sapiens
P97998 9.89e-41 162 30 14 480 3 MDL1 ATP-dependent permease MDL1 Candida albicans
Q9FWX7 1.04e-40 164 33 8 338 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 9.53e-36 149 39 2 207 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q8YH20 1.23e-40 160 32 2 298 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9LZB8 1.26e-40 161 29 12 501 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana
Q4KJB2 1.28e-40 160 29 12 472 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
H6TB12 1.42e-40 164 41 3 216 1 mdr Sophorolipid transporter Starmerella bombicola
H6TB12 1.39e-33 142 35 9 300 1 mdr Sophorolipid transporter Starmerella bombicola
Q1GZI0 1.42e-40 160 27 13 519 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9FHF1 1.46e-40 164 41 3 208 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FHF1 1.25e-37 154 40 2 207 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q2ULH4 1.64e-40 162 26 14 499 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9SYI3 2.24e-40 163 30 7 381 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 2.46e-36 150 39 2 207 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9JW59 2.77e-40 160 27 8 494 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9M0M2 2.77e-40 162 43 3 208 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9M0M2 1.96e-35 147 38 2 207 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9DC29 3.07e-40 162 27 7 453 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
S0EGU4 3.27e-40 162 32 8 318 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EGU4 2.15e-15 84 31 7 261 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q9LHD1 3.67e-40 162 40 4 237 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9LHD1 7.54e-38 155 40 4 235 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
A0A059JK44 3.94e-40 162 37 6 250 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 9.91e-27 120 24 21 575 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
Q9Y7M7 4.61e-40 160 29 17 526 3 mdl1 ATP-dependent permease MDL1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
F2Q5G0 5.25e-40 162 37 6 250 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 9.74e-27 120 24 21 575 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
P22638 5.6e-40 159 29 11 454 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
G5EG61 6.06e-40 162 38 4 253 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
G5EG61 1.22e-35 148 41 4 205 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
Q60AA3 6.15e-40 159 27 10 515 3 msbA ATP-dependent lipid A-core flippase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q7RX59 6.18e-40 160 27 14 473 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9LSJ6 6.82e-40 161 40 4 230 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 2.33e-39 160 40 4 235 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q8T9W2 7.37e-40 159 29 9 412 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
P0CU83 7.4e-40 161 38 8 254 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 2.81e-26 119 23 18 572 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q9C7F2 7.5e-40 161 40 3 233 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9C7F2 2.56e-38 157 39 1 209 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q6F9X0 7.78e-40 158 29 11 501 3 msbA ATP-dependent lipid A-core flippase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8T9W4 8.74e-40 161 28 7 454 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8T9W4 2.54e-28 125 39 2 207 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q9JXR3 8.83e-40 158 26 6 489 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5X498 9.23e-40 158 27 13 518 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Paris)
P16876 9.93e-40 161 45 2 189 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16876 2.97e-39 159 27 13 469 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
F2RPA4 1.05e-39 161 37 6 245 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 9.35e-27 120 24 19 574 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
Q4WD46 1.33e-39 160 40 6 225 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WD46 8.42e-29 127 40 3 203 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2HIE9 1.39e-39 157 26 11 465 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q2KYS6 1.89e-39 157 27 12 496 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
P16875 2.03e-39 160 36 5 247 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16875 6.65e-35 146 39 5 211 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P97046 2.2e-39 157 26 8 467 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
P68580 2.45e-39 158 23 23 698 3 sunT Sublancin-168-processing and transport ATP-binding protein sunT Bacillus phage SPbeta
P68579 2.45e-39 158 23 23 698 3 sunT SPbeta prophage-derived sublancin-168-processing and transport ATP-binding protein SunT Bacillus subtilis (strain 168)
O53645 2.68e-39 159 26 13 552 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 3.94e-31 134 25 10 460 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O80725 2.92e-39 159 30 7 371 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 1.09e-36 152 37 2 207 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
Q9SGY1 3.11e-39 159 41 2 207 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9SGY1 4.12e-37 153 40 2 209 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q83D84 3.14e-39 156 27 14 524 3 msbA ATP-dependent lipid A-core flippase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q2UPC0 3.73e-39 158 27 7 454 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9M1Q9 3.88e-39 159 39 3 208 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9M1Q9 1.09e-37 155 39 2 207 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q00449 4.26e-39 159 31 13 427 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q00449 2.16e-36 150 38 5 227 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q6FIK3 4.55e-39 157 26 16 523 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FZF2 6.32e-39 155 34 7 307 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella quintana (strain Toulouse)
Q9LSJ8 7.43e-39 158 42 2 210 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q9LSJ8 2.25e-35 147 26 15 501 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
A0A125QXJ1 8.63e-39 157 27 10 457 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q08D64 9.75e-39 157 26 13 535 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
Q6G2Z5 9.75e-39 155 34 7 305 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q8P8W4 1.14e-38 155 28 15 470 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 1.14e-38 155 28 15 470 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
A1KF14 1.35e-38 157 27 14 550 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 3.48e-31 134 25 10 460 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P9WQJ7 1.38e-38 154 38 4 210 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ6 1.38e-38 154 38 4 210 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63394 1.38e-38 154 38 4 210 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6Q876 1.55e-38 157 28 16 477 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 2.15e-31 135 35 7 259 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q9LJX0 1.63e-38 157 41 2 207 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q9LJX0 2.92e-38 156 33 10 340 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q6CX96 1.67e-38 155 25 8 485 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9ZCM8 1.76e-38 154 28 12 498 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
A0A095C325 1.89e-38 157 28 10 467 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
A0A095C325 2.43e-36 150 38 7 249 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
Q68W42 1.9e-38 154 28 12 504 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P37608 2.04e-38 155 22 18 700 3 lcnDR3 Lacticin-481/lactococcin-DR transport/processing ATP-binding protein lcnDR3 Lactococcus lactis subsp. lactis
Q65U21 2.32e-38 154 25 16 526 3 msbA ATP-dependent lipid A-core flippase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P36370 3.02e-38 155 33 7 298 1 Tap1 Antigen peptide transporter 1 Rattus norvegicus
Q4WSI1 3.31e-38 156 40 6 213 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 2.39e-28 125 35 4 209 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0R6H7 3.75e-38 153 38 1 196 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B2GUP8 3.92e-38 154 28 11 458 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
Q0P9C4 4.2e-38 152 39 3 209 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5WVN2 4.73e-38 153 27 13 516 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Lens)
Q3IGX5 6.25e-38 152 25 9 459 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas translucida (strain TAC 125)
E7F6F7 6.47e-38 154 29 13 470 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q483B6 7.09e-38 152 25 10 494 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
J9VF33 8.63e-38 155 28 10 467 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VF33 2.07e-36 151 37 6 255 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q54U44 9.38e-38 155 27 8 463 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q54U44 3.3e-13 77 29 7 208 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q5P2S7 1.33e-37 152 28 11 463 3 msbA ATP-dependent lipid A-core flippase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q87VF3 1.4e-37 152 29 8 460 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0I4C5 1.57e-37 151 26 17 534 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
Q88D92 1.72e-37 151 26 7 459 3 msbA ATP-dependent lipid A-core flippase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5B1Q2 1.83e-37 152 26 11 494 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P75094 2.02e-37 152 37 6 248 3 MPN_019 Putative ABC transporter ATP-binding protein MG015 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q7W9N7 2.42e-37 151 27 12 462 3 msbA ATP-dependent lipid A-core flippase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH20 2.42e-37 151 27 12 462 3 msbA ATP-dependent lipid A-core flippase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VWD8 2.44e-37 151 27 12 462 3 msbA ATP-dependent lipid A-core flippase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P16877 2.44e-37 154 43 2 189 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16877 2.31e-34 144 38 4 211 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q48P40 2.48e-37 151 29 10 463 3 msbA ATP-dependent lipid A-core flippase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P34713 3.17e-37 153 41 2 205 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P34713 1.95e-28 125 36 4 216 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P0CL92 3.94e-37 152 32 7 310 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CL93 4.13e-37 152 32 7 310 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0A2V1 6.85e-37 149 34 2 287 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium radiobacter
P0A2V0 6.85e-37 149 34 2 287 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium fabrum (strain C58 / ATCC 33970)
P47261 7.74e-37 149 35 6 247 3 MG015 Putative ABC transporter ATP-binding protein MG015 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P21958 8.04e-37 150 32 6 298 1 Tap1 Antigen peptide transporter 1 Mus musculus
P33310 8.19e-37 150 27 13 457 1 MDL1 ATP-dependent permease MDL1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7VL52 8.43e-37 149 25 10 517 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P77265 1.03e-36 149 27 10 463 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
Q31FG2 1.06e-36 149 40 1 209 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9NP58 1.08e-36 151 25 6 452 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
Q4UMZ3 1.27e-36 149 28 13 475 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92GP9 1.65e-36 148 28 12 479 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P18767 1.71e-36 148 32 3 310 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium meliloti (strain 1021)
J9VWU3 2.01e-36 149 32 7 310 2 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
G7CBF6 2.02e-36 148 35 2 210 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
Q5H0H0 2.03e-36 148 28 14 465 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 2.03e-36 148 28 14 465 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
O95342 2.88e-36 150 30 13 475 1 ABCB11 Bile salt export pump Homo sapiens
O95342 9.87e-34 142 41 4 199 1 ABCB11 Bile salt export pump Homo sapiens
P40416 2.94e-36 149 26 12 504 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8PKS5 2.97e-36 147 28 13 461 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
Q8ST87 3.14e-36 150 26 9 467 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q8ST87 2.26e-11 71 28 5 207 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q3BTC8 3.17e-36 147 28 13 461 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q71ED1 3.25e-36 147 32 3 312 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium vitis
Q47JR8 3.5e-36 147 28 10 468 3 msbA ATP-dependent lipid A-core flippase Dechloromonas aromatica (strain RCB)
P35598 3.7e-36 147 27 13 468 3 exp8 Putative ABC transporter ATP-binding protein exp8 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q4WLN7 3.71e-36 149 26 14 499 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q12C33 3.86e-36 147 28 8 426 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9LVM1 4.64e-36 148 28 15 488 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
Q4ZZ16 5.09e-36 147 27 10 466 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. syringae (strain B728a)
P0A4W5 7.71e-36 146 26 18 539 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 7.71e-36 146 26 18 539 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O70595 9.89e-36 148 26 8 453 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
P9WQJ0 1.05e-35 146 27 16 474 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q3SP57 1.15e-35 146 32 7 290 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q5F364 1.74e-35 148 26 11 465 2 ABCC1 Multidrug resistance-associated protein 1 Gallus gallus
Q5F364 4.04e-13 77 27 6 225 2 ABCC1 Multidrug resistance-associated protein 1 Gallus gallus
Q00748 1.75e-35 148 28 12 451 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q00748 1.7e-34 145 41 5 212 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q9ZNB0 1.96e-35 145 27 13 559 3 SCO0742 Uncharacterized ABC transporter ATP-binding protein SCO0742 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q54RU1 1.99e-35 146 29 18 482 3 abcB6 ABC transporter B family member 6 Dictyostelium discoideum
B2KWH4 2.47e-35 147 38 8 239 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 1.91e-33 141 25 12 551 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
Q9SYI2 3.25e-35 147 41 2 207 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9SYI2 4.27e-35 147 38 4 210 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q13BH6 3.51e-35 144 32 6 289 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB5)
Q61102 4.02e-35 145 27 13 470 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
P33527 4.27e-35 147 26 9 455 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
P33527 9.79e-16 85 26 10 335 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
Q704E8 4.73e-35 145 27 12 470 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
A0A0D1BUH6 4.85e-35 146 30 9 380 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 6.91e-30 130 34 7 243 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q983H5 5.26e-35 144 33 5 306 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P39109 5.4e-35 146 27 14 466 1 YCF1 Metal resistance protein YCF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39109 7.76e-10 66 30 3 155 1 YCF1 Metal resistance protein YCF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q15UY7 5.61e-35 144 37 3 210 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q751N2 6.61e-35 144 25 15 504 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q2J0F4 7.22e-35 144 31 11 346 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain HaA2)
O14286 8.86e-35 144 27 13 477 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6BXD7 9.87e-35 144 29 16 475 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
G7CBF5 1.08e-34 145 36 3 215 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
O35379 1.11e-34 145 26 9 455 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
O35379 2.15e-14 81 28 5 222 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
Q1QH37 1.49e-34 142 32 11 336 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q864R9 1.52e-34 145 26 9 455 1 ABCC1 Multidrug resistance-associated protein 1 Macaca fascicularis
Q864R9 2.17e-14 81 25 9 335 1 ABCC1 Multidrug resistance-associated protein 1 Macaca fascicularis
Q20Z38 1.87e-34 142 28 17 503 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q9LHK4 2.5e-34 144 37 2 209 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q9LHK4 6.68e-33 140 29 13 478 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q2K342 2.84e-34 142 32 2 289 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O07549 3.41e-34 142 24 11 500 1 yheH Probable multidrug resistance ABC transporter ATP-binding/permease protein YheH Bacillus subtilis (strain 168)
Q23868 4.18e-34 144 35 3 211 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
Q8CG09 5.17e-34 143 26 9 455 1 Abcc1 Multidrug resistance-associated protein 1 Rattus norvegicus
Q8CG09 4.45e-14 80 23 11 410 1 Abcc1 Multidrug resistance-associated protein 1 Rattus norvegicus
Q54JR2 9.42e-34 142 27 9 461 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q54JR2 1.31e-08 62 26 5 206 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q9FUT3 1.23e-33 140 27 10 477 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
Q42093 1.43e-33 142 25 17 517 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q42093 1.27e-17 91 30 7 242 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q9PEE7 1.5e-33 139 26 9 467 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
Q6UR05 1.62e-33 142 25 11 473 1 ABCC1 Multidrug resistance-associated protein 1 Canis lupus familiaris
Q6UR05 3.92e-14 80 28 6 246 1 ABCC1 Multidrug resistance-associated protein 1 Canis lupus familiaris
Q9M0G9 1.62e-33 140 27 5 422 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q0HTS8 1.87e-33 139 26 14 517 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-7)
Q0HHH4 1.87e-33 139 26 14 517 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-4)
Q89UT8 2.35e-33 139 36 5 226 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
H2LNR5 2.91e-33 140 27 13 468 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
Q7ANN4 2.93e-33 139 30 4 338 1 prsD Type I secretion system ATP-binding protein PrsD Rhizobium meliloti (strain 1021)
O75027 3.14e-33 140 27 14 463 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q9N0V3 3.44e-33 140 38 4 206 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q9N0V3 7.7e-28 124 27 12 473 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
B8K1W2 3.51e-33 140 27 15 516 1 Abcb11e Bile salt export pump Canis lupus familiaris
B8K1W2 6.23e-33 140 39 4 206 1 Abcb11e Bile salt export pump Canis lupus familiaris
Q87EF0 4e-33 138 26 9 467 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q0BKJ3 4.05e-33 138 35 3 209 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1U9 4.05e-33 138 35 3 209 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain LVS)
Q5NIG3 4.12e-33 138 35 3 209 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JW6 4.12e-33 138 35 3 209 1 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain FSC 198)
Q8HXQ5 5.25e-33 140 26 12 463 1 ABCC1 Multidrug resistance-associated protein 1 Bos taurus
Q8HXQ5 3.24e-14 80 27 5 240 1 ABCC1 Multidrug resistance-associated protein 1 Bos taurus
Q9U2G5 5.72e-33 140 27 18 482 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q9U2G5 3.41e-14 80 27 9 256 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q8EDF0 6.82e-33 137 25 11 516 3 msbA ATP-dependent lipid A-core flippase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q07QX6 9.75e-33 137 36 4 216 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
P9WQJ9 1.03e-32 139 35 6 235 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ8 1.03e-32 139 35 6 235 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63392 1.03e-32 139 35 6 235 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54LE6 1.06e-32 139 25 11 475 3 abcC5 ABC transporter C family member 5 Dictyostelium discoideum
Q54LE6 1.84e-08 62 32 3 143 3 abcC5 ABC transporter C family member 5 Dictyostelium discoideum
Q1MAB5 1.14e-32 137 33 2 289 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q47908 1.37e-32 137 36 4 211 3 msbA ATP-dependent lipid A-core flippase Francisella novicida
Q8K985 2.1e-32 136 25 9 473 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q6C6N0 2.89e-32 137 27 14 481 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q492S9 2.92e-32 135 27 13 493 3 msbA ATP-dependent lipid A-core flippase Blochmanniella pennsylvanica (strain BPEN)
Q9C8G9 2.94e-32 138 25 18 522 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q9C8G9 6.42e-17 89 29 8 241 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q89A97 3.09e-32 135 24 8 458 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O70127 3.19e-32 137 38 4 206 1 Abcb11 Bile salt export pump Rattus norvegicus
O70127 5.23e-32 137 28 13 475 1 Abcb11 Bile salt export pump Rattus norvegicus
Q12M46 3.72e-32 135 38 3 205 3 msbA ATP-dependent lipid A-core flippase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q10185 3.89e-32 137 26 14 473 1 abc2 ATP-binding cassette transporter abc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q10185 1.94e-10 68 29 7 189 1 abc2 ATP-binding cassette transporter abc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9QY30 3.91e-32 137 39 4 206 1 Abcb11 Bile salt export pump Mus musculus
Q9QY30 6.99e-32 137 29 13 481 1 Abcb11 Bile salt export pump Mus musculus
P91660 4.04e-32 137 24 12 495 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
P91660 1.61e-18 94 29 6 225 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
A0R6H8 4.07e-32 137 34 7 248 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9Y8G2 4.11e-32 137 36 5 225 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G2 7.77e-28 124 27 16 504 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9QYM0 4.29e-32 137 27 14 480 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9QYM0 8.95e-13 75 26 5 236 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
A0A1U8QG99 4.34e-32 137 36 5 225 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QG99 8.94e-28 124 27 16 504 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q28689 4.86e-32 137 24 12 484 1 ABCC2 ATP-binding cassette sub-family C member 2 Oryctolagus cuniculus
Q28689 2.44e-16 87 30 6 207 1 ABCC2 ATP-binding cassette sub-family C member 2 Oryctolagus cuniculus
Q92887 7.38e-32 137 25 12 468 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q92887 3.35e-17 90 29 7 231 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q080T2 8.61e-32 134 38 3 205 3 msbA ATP-dependent lipid A-core flippase Shewanella frigidimarina (strain NCIMB 400)
O15440 9.09e-32 136 27 18 484 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
O15440 3.37e-12 73 30 4 188 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
Q8LPQ6 1.01e-31 135 40 3 194 2 ABCB28 ABC transporter B family member 28 Arabidopsis thaliana
Q63120 1.18e-31 136 25 13 474 1 Abcc2 ATP-binding cassette sub-family C member 2 Rattus norvegicus
Q63120 3.33e-16 87 29 5 210 1 Abcc2 ATP-binding cassette sub-family C member 2 Rattus norvegicus
P54683 1.58e-31 135 34 4 213 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
Q6N1Y7 1.74e-31 133 36 4 208 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8T9W1 2e-31 135 34 4 212 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
Q57538 2.1e-31 132 26 14 469 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9R1X5 2.14e-31 135 27 19 485 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q9R1X5 1.71e-12 75 26 5 236 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
P13568 2.89e-31 135 26 21 578 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
P13568 1.38e-25 117 24 20 638 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
Q59R09 3.4e-31 134 36 4 209 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2G506 3.65e-31 132 36 3 223 1 atm1 ATM1-type heavy metal exporter Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
O88563 6.44e-31 134 26 14 472 1 Abcc3 ATP-binding cassette sub-family C member 3 Rattus norvegicus
O88563 1.12e-16 88 26 13 333 1 Abcc3 ATP-binding cassette sub-family C member 3 Rattus norvegicus
Q57180 9.51e-31 131 34 3 220 3 HI_1051 Uncharacterized ABC transporter ATP-binding protein HI_1051 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57551 1.22e-30 130 24 11 462 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q7VR44 1.43e-30 130 36 2 204 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
A0A1U8QTJ9 5.07e-30 131 25 13 471 1 cicA ABC-type transporter cicA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QTJ9 1.46e-12 75 27 6 282 1 cicA ABC-type transporter cicA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G4N2B5 5.41e-30 131 25 15 510 3 ABC7 ABC transporter 7 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4N2B5 1.46e-14 81 33 4 171 3 ABC7 ABC transporter 7 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A1U9YI12 5.63e-30 130 26 13 473 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 1.21e-29 129 37 9 241 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
Q21WN9 8.03e-30 128 40 2 191 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q9X2W0 1.03e-29 128 30 9 291 1 mcjD Microcin-J25 export ATP-binding/permease protein McjD Escherichia coli
O15439 1.1e-29 130 27 20 494 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
O15439 3.26e-17 90 30 5 208 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
E9Q236 1.13e-29 130 27 16 477 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
E9Q236 1.64e-16 87 25 9 314 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
Q480N3 1.34e-29 127 36 4 208 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
F1M3J4 1.36e-29 129 26 17 478 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
F1M3J4 4.1e-16 86 24 9 314 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
K0E4D9 1.67e-29 129 24 10 470 1 ecdL ABC transporter ecdL Aspergillus rugulosus
K0E4D9 1.73e-16 87 27 3 223 1 ecdL ABC transporter ecdL Aspergillus rugulosus
Q7DM58 1.94e-29 129 24 9 477 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q7DM58 2.65e-13 77 30 5 181 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
O15438 2.14e-29 129 24 13 483 1 ABCC3 ATP-binding cassette sub-family C member 3 Homo sapiens
O15438 1.16e-14 82 28 7 211 1 ABCC3 ATP-binding cassette sub-family C member 3 Homo sapiens
Q9C8H1 2.2e-29 129 26 14 474 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
Q9C8H1 3.21e-18 93 29 6 237 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
Q9P5N0 2.31e-29 129 25 14 534 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P5N0 3.05e-12 74 29 5 195 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P53049 4.18e-29 128 25 15 526 1 YOR1 Oligomycin resistance ATP-dependent permease YOR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53049 3.33e-17 90 30 5 211 1 YOR1 Oligomycin resistance ATP-dependent permease YOR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B2RX12 4.55e-29 128 25 15 491 1 Abcc3 ATP-binding cassette sub-family C member 3 Mus musculus
B2RX12 4.43e-17 89 26 13 334 1 Abcc3 ATP-binding cassette sub-family C member 3 Mus musculus
Q7FB56 5.39e-29 127 24 15 505 5 ABCC15 Putative ABC transporter C family member 15 Arabidopsis thaliana
Q7FB56 9.96e-14 79 33 6 199 5 ABCC15 Putative ABC transporter C family member 15 Arabidopsis thaliana
P32386 7.01e-29 127 25 12 485 1 YBT1 ATP-dependent bile acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32386 4.16e-21 102 29 10 288 1 YBT1 ATP-dependent bile acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54P13 9.94e-29 127 25 12 459 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q54P13 2.34e-17 90 32 4 200 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q54VC1 1.39e-28 126 26 14 472 3 abcC15 ABC transporter C family member 15 Dictyostelium discoideum
Q54VC1 3.38e-08 60 31 6 199 3 abcC15 ABC transporter C family member 15 Dictyostelium discoideum
J9VQH1 1.54e-28 126 24 9 485 3 YOR1 ATP-dependent permease YOR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VQH1 9.58e-14 79 32 5 200 3 YOR1 ATP-dependent permease YOR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q9M1C7 3.57e-28 125 24 15 505 2 ABCC9 ABC transporter C family member 9 Arabidopsis thaliana
Q9M1C7 5.8e-09 63 32 6 199 2 ABCC9 ABC transporter C family member 9 Arabidopsis thaliana
P23596 3.78e-28 123 38 2 193 3 prtD Proteases secretion ATP-binding protein PrtD Dickeya chrysanthemi
Q03024 5.84e-28 122 26 9 429 3 aprD Alkaline protease secretion ATP-binding protein AprD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89A96 7.95e-28 122 26 15 457 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q96J66 8.92e-28 124 24 16 494 1 ABCC11 ATP-binding cassette sub-family C member 11 Homo sapiens
Q96J66 2.46e-11 71 29 5 198 1 ABCC11 ATP-binding cassette sub-family C member 11 Homo sapiens
P82451 9.53e-28 124 23 12 509 2 ABCC9 ATP-binding cassette sub-family C member 9 Oryctolagus cuniculus
P82451 5.04e-16 86 28 5 224 2 ABCC9 ATP-binding cassette sub-family C member 9 Oryctolagus cuniculus
O60706 1.05e-27 124 23 12 509 1 ABCC9 ATP-binding cassette sub-family C member 9 Homo sapiens
O60706 7.73e-16 85 28 5 224 1 ABCC9 ATP-binding cassette sub-family C member 9 Homo sapiens
Q9LYS2 1.14e-27 123 24 14 528 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q9LYS2 1.66e-16 87 32 2 187 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q9LZJ5 1.59e-27 123 24 11 470 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q9LZJ5 9.81e-15 82 29 7 214 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q8LGU1 2.32e-27 122 23 12 467 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 2.16e-13 77 27 5 213 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q63563 2.46e-27 122 23 12 509 1 Abcc9 ATP-binding cassette sub-family C member 9 Rattus norvegicus
Q63563 1.16e-16 88 27 4 222 1 Abcc9 ATP-binding cassette sub-family C member 9 Rattus norvegicus
Q04EY5 2.74e-27 115 34 4 217 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
P78966 3.13e-27 122 26 6 407 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.32e-24 114 29 6 304 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P12866 3.24e-27 122 34 4 220 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12866 7.46e-24 111 34 4 231 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P70170 3.84e-27 122 23 12 509 1 Abcc9 ATP-binding cassette sub-family C member 9 Mus musculus
P70170 2.96e-16 87 28 5 232 1 Abcc9 ATP-binding cassette sub-family C member 9 Mus musculus
Q9C8H0 4.06e-27 122 26 17 478 2 ABCC12 ABC transporter C family member 12 Arabidopsis thaliana
Q9C8H0 5.65e-17 89 28 6 237 2 ABCC12 ABC transporter C family member 12 Arabidopsis thaliana
P38735 4.44e-27 122 24 12 490 2 VMR1 ABC transporter ATP-binding protein/permease VMR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38735 2.89e-09 64 24 8 272 2 VMR1 ABC transporter ATP-binding protein/permease VMR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8R4P9 4.84e-27 121 32 4 246 1 Abcc10 ATP-binding cassette sub-family C member 10 Mus musculus
Q8R4P9 1.61e-14 81 27 9 256 1 Abcc10 ATP-binding cassette sub-family C member 10 Mus musculus
Q6FWS5 5.7e-27 121 24 16 501 2 YBT1 Pleiotropic ABC efflux transporter of multiple drugs YBT1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FWS5 2.07e-16 87 28 8 263 2 YBT1 Pleiotropic ABC efflux transporter of multiple drugs YBT1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q54NL1 1.22e-26 120 33 3 211 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54NL1 1.64e-15 84 34 6 196 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54V86 1.61e-26 120 30 3 227 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q54V86 1.46e-13 78 33 5 195 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q8LPT1 5.29e-26 118 37 3 207 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q8LPT1 1.25e-24 114 29 10 323 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q96J65 5.81e-26 118 30 2 204 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q96J65 7.29e-16 85 27 4 245 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
P9WEL8 7.61e-26 117 23 14 511 3 avaQ ABC-type transporter avaQ Aspergillus versicolor
P9WEL8 2.67e-07 58 27 4 193 3 avaQ ABC-type transporter avaQ Aspergillus versicolor
P57552 7.82e-26 116 29 6 279 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P33116 7.82e-26 116 27 13 391 3 spaT Subtilin transport ATP-binding protein SpaT Bacillus subtilis
Q9M3B9 1.13e-25 117 36 3 207 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q9M3B9 5.48e-25 115 28 9 322 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
P14772 1.39e-25 117 25 11 487 1 BPT1 Bile pigment transporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P14772 3.22e-10 67 32 3 145 1 BPT1 Bile pigment transporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q09429 1.71e-25 116 24 9 519 1 Abcc8 ATP-binding cassette sub-family C member 8 Rattus norvegicus
Q09429 4.06e-15 83 27 5 220 1 Abcc8 ATP-binding cassette sub-family C member 8 Rattus norvegicus
A7KVC2 1.85e-25 116 26 15 460 2 MRP4 ABC transporter C family MRP4 Zea mays
A7KVC2 2.31e-10 68 26 17 365 2 MRP4 ABC transporter C family MRP4 Zea mays
Q09427 1.85e-25 116 25 12 498 1 ABCC8 ATP-binding cassette sub-family C member 8 Cricetus cricetus
Q09427 6.07e-15 82 27 4 225 1 ABCC8 ATP-binding cassette sub-family C member 8 Cricetus cricetus
Q8T6H8 2.28e-25 116 32 2 206 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q8T6H8 1.05e-13 79 34 5 192 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q09428 2.34e-25 116 25 14 530 1 ABCC8 ATP-binding cassette sub-family C member 8 Homo sapiens
Q09428 4.98e-16 86 27 4 219 1 ABCC8 ATP-binding cassette sub-family C member 8 Homo sapiens
Q54VJ0 2.44e-25 116 31 2 206 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q54VJ0 9.01e-13 75 33 4 197 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q80WJ6 2.56e-25 116 21 9 464 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q80WJ6 7.38e-15 82 28 6 246 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
P75095 2.88e-25 114 33 7 231 3 MPN_018 Putative ABC transporter ATP-binding protein MG014 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8T6H3 3.24e-25 115 26 20 513 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q8T6H3 5.55e-14 79 35 4 195 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q10RX7 3.69e-25 115 26 18 470 2 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. japonica
Q10RX7 3.85e-10 67 25 16 377 2 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. japonica
A2XCD4 3.69e-25 115 26 18 470 3 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. indica
A2XCD4 3.85e-10 67 25 16 377 3 ABCC13 ABC transporter C family member 13 Oryza sativa subsp. indica
A0A0D1CZ63 4.08e-25 115 25 11 471 2 fer6 Multidrug resistance protein fer6 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1CZ63 1.85e-11 71 29 7 213 2 fer6 Multidrug resistance protein fer6 Ustilago maydis (strain 521 / FGSC 9021)
Q54K24 4.38e-25 115 33 3 207 3 abcC14 ABC transporter C family member 14 Dictyostelium discoideum
Q54K24 1.7e-11 71 37 5 159 3 abcC14 ABC transporter C family member 14 Dictyostelium discoideum
Q92337 4.68e-25 115 25 16 477 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q92337 9.17e-13 75 33 4 172 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6Y306 4.87e-25 115 21 9 459 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q6Y306 2.45e-14 80 28 4 245 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q9LK64 6.34e-25 115 23 11 472 1 ABCC3 ABC transporter C family member 3 Arabidopsis thaliana
Q9LK64 4.34e-11 70 28 7 240 1 ABCC3 ABC transporter C family member 3 Arabidopsis thaliana
Q5A762 6.5e-25 115 23 13 498 1 MLT1 Multiple drug resistance-associated protein-like transporter 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A762 6.89e-13 76 31 5 176 1 MLT1 Multiple drug resistance-associated protein-like transporter 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
I1R9B3 6.9e-25 114 25 15 471 3 FGRAMPH1_01T00151 ABC-type transporter FGSG_00046 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1R9B3 0.000266 48 32 2 113 3 FGRAMPH1_01T00151 ABC-type transporter FGSG_00046 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P0AAG5 7.16e-25 113 23 12 463 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 7.16e-25 113 23 12 463 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 7.16e-25 113 23 12 463 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
Q5AV01 8.19e-25 114 24 11 498 2 atnG ABC transporter atnG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AV01 3.24e-12 73 23 12 449 2 atnG ABC transporter atnG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0CE70 1.08e-24 114 21 9 520 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae
P0CE70 3.32e-14 80 31 9 263 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae
C8ZCR2 1.15e-24 114 21 9 520 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
C8ZCR2 3.64e-14 80 31 9 263 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
S3D778 1.45e-24 113 25 17 495 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D778 3.98e-15 83 27 5 259 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q54EK2 1.54e-24 113 26 8 365 3 abcC7 ABC transporter C family member 7 Dictyostelium discoideum
Q54EK2 5.1e-15 83 30 8 243 3 abcC7 ABC transporter C family member 7 Dictyostelium discoideum
A7A063 3.45e-24 112 21 10 518 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain YJM789)
A7A063 4.63e-14 80 31 9 263 3 NFT1 ABC transporter NFT1 Saccharomyces cerevisiae (strain YJM789)
Q8VI47 3.66e-24 112 23 12 476 1 Abcc2 ATP-binding cassette sub-family C member 2 Mus musculus
Q8VI47 3.17e-15 84 29 4 207 1 Abcc2 ATP-binding cassette sub-family C member 2 Mus musculus
Q7GB25 3.99e-24 112 25 13 461 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
Q7GB25 8.37e-15 82 29 6 241 2 ABCC5 ABC transporter C family member 5 Arabidopsis thaliana
A0A0U1LQE1 6.06e-24 112 24 16 525 3 cctS ABC-type transporter cctS Talaromyces islandicus
A0A0U1LQE1 1.36e-15 85 29 8 278 3 cctS ABC-type transporter cctS Talaromyces islandicus
G5EE72 6.32e-24 111 30 10 288 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
G5EE72 3.58e-11 70 23 3 192 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
P23886 6.86e-24 110 24 11 465 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q9LK62 7.73e-24 111 22 18 551 1 ABCC7 ABC transporter C family member 7 Arabidopsis thaliana
Q9LK62 1.89e-09 65 28 7 225 1 ABCC7 ABC transporter C family member 7 Arabidopsis thaliana
Q73F67 1.42e-23 104 32 5 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63H62 1.78e-23 104 32 5 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q6HPN0 1.92e-23 104 32 5 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 1.92e-23 104 32 5 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 1.92e-23 104 32 5 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q8K984 2.01e-23 108 31 4 218 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q81J16 3.02e-23 103 32 5 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q32K28 3.18e-23 102 35 7 190 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q5T3U5 3.46e-23 109 33 4 242 1 ABCC10 ATP-binding cassette sub-family C member 10 Homo sapiens
Q5T3U5 4.86e-15 83 28 6 229 1 ABCC10 ATP-binding cassette sub-family C member 10 Homo sapiens
Q4WT65 5.9e-23 108 27 19 496 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT65 4.45e-19 96 28 3 215 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P94367 6.02e-23 107 32 5 215 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
Q2RFS8 9.05e-23 102 33 6 206 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q3Z5U5 9.85e-23 100 34 7 190 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q1RGD0 1.25e-22 100 34 7 190 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
O95255 1.27e-22 107 24 15 486 1 ABCC6 ATP-binding cassette sub-family C member 6 Homo sapiens
O95255 1.2e-20 101 33 4 206 1 ABCC6 ATP-binding cassette sub-family C member 6 Homo sapiens
Q0TLS2 1.38e-22 100 34 7 190 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FL82 1.43e-22 100 34 7 190 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q326G9 1.53e-22 100 34 7 190 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q0T8D1 1.8e-22 100 34 7 190 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q83MG3 1.89e-22 100 34 7 190 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q7AKE5 2.67e-22 105 29 2 217 2 ramB ABC transporter ATP-binding protein RamB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P45171 4.02e-22 102 35 8 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8VZZ4 4.4e-22 105 22 15 517 2 ABCC6 ABC transporter C family member 6 Arabidopsis thaliana
Q8VZZ4 6.06e-11 70 28 5 222 2 ABCC6 ABC transporter C family member 6 Arabidopsis thaliana
P31548 4.46e-22 99 34 7 190 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
A0A0H2ZLL3 5.16e-22 99 31 8 225 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4QK57 5.35e-22 102 34 8 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_06160
Feature type CDS
Gene sunT
Product ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain
Location 239318 - 241432 (strand: -1)
Length 2115 (nucleotides) / 704 (amino acids)

Contig

Accession ZDB_215
Length 284267 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_123
Orthogroup size 11
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter
PF00664 ABC transporter transmembrane region
PF03412 Peptidase C39 family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2274 Defense mechanisms (V) V ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K13409 ATP-binding cassette, subfamily B, bacterial CvaB/MchF/RaxB ABC transporters
Plant-pathogen interaction
-

Protein Sequence

MRCLSLKNLLEKLDLSLRQRIPVIHQTESSECGLASLAMISAHYGKSIDLISLRQQFNLSARGAALAGLTGMAAELGMTTRALSLDMDDLPNLRLPCILHWDFNHFLVLVKISGNKFILHDPAYGRRVVGIEEMSRNFTGVALEAWPGSTFTRQEVVKKLSLRKLIGNIHGLKKALLKIFAFSVVIEAIGLIMPVGTQLVMDHAIPAGDQGLLSLICVGLLFFILLKAVVSMCRAWASVIMETLINVQWQSGLFTHLLRLPLSYFERRKLGDIQSRFGSLDILRTTFTTSVVGAIMDGIMLIGVFIMMILYGGHLTWIVLGFTAVYIGLRLATYRYYRQLSEESLIKEARAGSYFMESLYGITTVKTQGMSDRRGNHWLNLKVDSINTGIRLTKMNLMFGGVNTFIMACDQIAILWIGAGLVIDNAMTLGMFVAFSAYREQFSDRAASIIEFLLQLRIMSLHNERISDIALNEQENKKPDVPYEPQMQAAGLETRNLAYSYDSQSVPIFRDINLSVAPGESVAITGPSGSGKTTLMKVLCGLFEPSDGKVFIDNIEIRQLGVNNYHKMIACVMQDDKLFSGSIRENICGFTENPDEQLMIACAQASYIHNVIISMPMGYETLIGELGEGLSGGQKQRIFIARALYRKPRILFMDEATSALDKESESYVNQAIRQLPITRIIIAHRESTIESADRIISLGGKNNK

Flanking regions ( +/- flanking 50bp)

AGCAGACACACCATGACAGAACGGACGCTGTTATCTGACCGGGAGGCTGTATGCGCTGTTTATCCCTGAAAAACCTGCTGGAAAAACTCGATCTCAGTCTGCGTCAGCGCATTCCGGTGATCCACCAGACCGAGTCCTCTGAGTGCGGCCTCGCCAGCCTGGCCATGATTTCCGCCCATTACGGCAAAAGTATCGATCTGATTTCCCTGCGCCAGCAGTTCAATCTCTCCGCGCGGGGCGCGGCCCTGGCCGGGCTGACCGGTATGGCCGCCGAGCTGGGCATGACCACCCGCGCGCTGTCACTGGATATGGACGACCTGCCGAACCTGCGCCTGCCGTGTATTTTACACTGGGATTTCAATCACTTTCTGGTACTGGTGAAAATCAGCGGCAACAAATTTATCCTGCATGACCCGGCCTATGGCCGCCGGGTGGTCGGTATTGAGGAAATGTCGCGCAATTTTACCGGCGTGGCGCTGGAAGCCTGGCCCGGCAGCACCTTCACCAGGCAGGAGGTGGTGAAAAAACTCAGCCTGCGTAAGCTTATCGGCAATATTCACGGGCTGAAAAAAGCGCTGCTGAAAATCTTCGCGTTCTCCGTGGTGATTGAGGCTATCGGCCTGATTATGCCGGTCGGCACACAGCTGGTGATGGATCACGCTATTCCTGCCGGAGATCAGGGGTTATTGTCCCTGATTTGTGTCGGGTTACTGTTCTTTATTCTGCTGAAAGCGGTGGTCAGTATGTGCCGCGCCTGGGCCAGCGTGATTATGGAAACACTGATCAACGTCCAGTGGCAGTCCGGATTATTTACTCATCTGCTGCGGCTGCCGCTCAGCTATTTTGAGCGGCGCAAACTCGGGGATATTCAGTCCCGTTTCGGCTCGCTGGATATCCTGCGCACCACCTTTACCACCAGCGTGGTCGGGGCGATCATGGACGGTATCATGCTGATCGGCGTGTTTATCATGATGATCCTCTACGGCGGCCATCTCACCTGGATTGTGCTCGGGTTTACCGCTGTATATATCGGGCTGCGGCTGGCGACCTACCGTTATTACCGCCAGCTGTCGGAGGAGTCGCTGATCAAAGAGGCGCGCGCCGGGTCGTACTTTATGGAATCCCTCTACGGCATCACCACGGTGAAAACCCAGGGCATGAGCGATCGCCGGGGGAATCACTGGCTGAATCTGAAAGTCGATTCCATCAATACCGGCATCCGCCTGACCAAGATGAACCTGATGTTCGGCGGGGTGAATACTTTTATTATGGCCTGTGACCAGATAGCCATCCTGTGGATCGGCGCAGGTCTGGTGATCGACAACGCCATGACCCTCGGGATGTTTGTTGCGTTCAGCGCCTACCGCGAGCAGTTTTCCGACCGCGCTGCCTCCATCATTGAGTTCCTGCTGCAGCTGCGCATCATGAGCCTGCACAACGAGCGTATTTCCGATATCGCGCTCAACGAGCAGGAAAATAAAAAGCCGGATGTACCGTACGAGCCGCAGATGCAGGCCGCCGGGCTGGAGACCCGCAACCTGGCGTACAGTTACGACAGCCAGTCCGTACCGATCTTCCGCGATATTAATCTGTCGGTTGCCCCCGGTGAAAGTGTGGCGATAACAGGGCCGTCCGGCTCGGGAAAAACCACGCTGATGAAAGTGCTGTGCGGCCTGTTTGAGCCATCGGATGGCAAGGTATTCATTGATAACATTGAGATCCGCCAGCTCGGCGTCAATAACTACCACAAAATGATCGCCTGTGTGATGCAGGACGACAAACTGTTTTCCGGCTCGATCCGCGAAAATATCTGCGGGTTCACCGAAAATCCCGACGAGCAGCTGATGATCGCCTGTGCACAGGCCAGTTATATTCACAACGTGATTATATCGATGCCGATGGGCTATGAAACGCTGATAGGAGAGCTGGGCGAAGGACTGTCCGGCGGGCAGAAACAGCGGATCTTTATTGCCCGCGCCCTGTACCGCAAGCCCCGCATTCTGTTTATGGACGAGGCCACCAGCGCACTGGATAAAGAGAGTGAATCTTACGTCAATCAGGCGATCCGCCAACTGCCGATCACGCGGATTATTATTGCGCACCGCGAGTCGACGATTGAGTCAGCGGACCGCATTATTTCTCTTGGCGGGAAAAACAATAAATAAAGCTACGAAAATATAACCGGAAATAATAACCTCAGGATATGTATTTTATA