Homologs in group_2726

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07460 FBDBKF_07460 81.2 Morganella morganii S1 cysG2 Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain)
EHELCC_17130 EHELCC_17130 81.2 Morganella morganii S2 cysG2 Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain)
NLDBIP_18510 NLDBIP_18510 81.2 Morganella morganii S4 cysG2 Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain)
LHKJJB_09115 LHKJJB_09115 81.2 Morganella morganii S3 cysG2 Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain)
HKOGLL_08665 HKOGLL_08665 81.2 Morganella morganii S5 cysG2 Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain)

Distribution of the homologs in the orthogroup group_2726

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2726

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4TY38 1.38e-44 157 38 2 217 3 cysG Siroheme synthase Salmonella schwarzengrund (strain CVM19633)
B7NDX8 3.3e-44 156 38 2 217 3 cysG Siroheme synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8Z201 4.07e-44 156 38 2 217 3 cysG Siroheme synthase Salmonella typhi
A7MKK9 4.53e-44 155 39 2 217 3 cysG2 Siroheme synthase 2 Cronobacter sakazakii (strain ATCC BAA-894)
A6TF07 4.92e-44 155 40 2 217 3 cysG2 Siroheme synthase 2 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C0Q0F3 5.03e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella paratyphi C (strain RKS4594)
A9MT45 5.03e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R2C7 5.03e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella enteritidis PT4 (strain P125109)
Q57IZ5 5.03e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella choleraesuis (strain SC-B67)
B5F8J0 5.15e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella agona (strain SL483)
P25924 5.52e-44 155 38 2 217 1 cysG Siroheme synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4SVI1 5.7e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella newport (strain SL254)
B5BH22 5.82e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella paratyphi A (strain AKU_12601)
Q5PLV8 5.82e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5FJQ1 6.14e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella dublin (strain CT_02021853)
B4TKQ4 7.18e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella heidelberg (strain SL476)
B5R7N6 9.43e-44 155 38 2 217 3 cysG Siroheme synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7LS75 2.45e-43 154 37 2 217 3 cysG Siroheme synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NMD7 2.5e-43 154 37 2 217 3 cysG Siroheme synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q1R5R3 2.53e-43 154 37 2 217 3 cysG Siroheme synthase Escherichia coli (strain UTI89 / UPEC)
Q0TC92 2.53e-43 154 37 2 217 3 cysG Siroheme synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGQ2 2.53e-43 154 37 2 217 3 cysG Siroheme synthase Escherichia coli O1:K1 / APEC
B7MCY5 2.53e-43 154 37 2 217 3 cysG Siroheme synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q3YWQ3 4.18e-43 153 37 2 217 3 cysG Siroheme synthase Shigella sonnei (strain Ss046)
Q83JB3 4.18e-43 153 37 2 217 3 cysG Siroheme synthase Shigella flexneri
Q0SZU8 4.18e-43 153 37 2 217 3 cysG Siroheme synthase Shigella flexneri serotype 5b (strain 8401)
B6I2S7 4.18e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli (strain SE11)
B7M1S1 4.18e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli O8 (strain IAI1)
A7ZSP4 4.18e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1LHG9 4.23e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli (strain SMS-3-5 / SECEC)
P0AEA8 4.23e-43 153 37 2 217 1 cysG Siroheme synthase Escherichia coli (strain K12)
B1IP96 4.23e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A5H5 4.23e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli O9:H4 (strain HS)
B1X716 4.23e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli (strain K12 / DH10B)
C4ZUM4 4.23e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli (strain K12 / MC4100 / BW2952)
B7N1F1 4.23e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli O81 (strain ED1a)
P0AEA9 4.23e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli O157:H7
B7L4P2 4.23e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli (strain 55989 / EAEC)
Q32AZ8 4.55e-43 153 37 2 217 3 cysG Siroheme synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q8FCW8 4.6e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UK79 4.6e-43 153 37 2 217 3 cysG Siroheme synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A9MME5 5.05e-43 153 38 2 217 3 cysG Siroheme synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4WFH1 5.49e-43 153 38 2 217 3 cysG Siroheme synthase Enterobacter sp. (strain 638)
Q31VS0 1.69e-42 152 37 2 217 3 cysG Siroheme synthase Shigella boydii serotype 4 (strain Sb227)
B2U3H4 1.69e-42 152 37 2 217 3 cysG Siroheme synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YTS6 4.41e-42 150 37 2 217 3 cysG Siroheme synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
A8AQS4 1.2e-41 149 37 2 217 3 cysG Siroheme synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6CZS0 5.78e-41 147 38 2 213 3 cysG2 Siroheme synthase 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JSB7 2.83e-37 138 41 2 194 3 cysG2 Siroheme synthase 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q664M6 4.56e-37 137 41 3 200 3 cysG2 Siroheme synthase 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FNS9 4.56e-37 137 41 3 200 3 cysG2 Siroheme synthase 2 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GKQ1 7.5e-37 137 38 2 213 3 cysG2 Siroheme synthase 2 Serratia proteamaculans (strain 568)
A4TGU8 4.11e-36 135 40 3 200 3 cysG1 Siroheme synthase 1 Yersinia pestis (strain Pestoides F)
Q74Y23 3.54e-35 132 40 4 200 3 cysG Siroheme synthase Yersinia pestis
Q1C2P9 3.54e-35 132 40 4 200 3 cysG Siroheme synthase Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CCP6 3.54e-35 132 40 4 200 3 cysG2 Siroheme synthase 2 Yersinia pestis bv. Antiqua (strain Nepal516)
A0KLD7 3.7e-35 132 37 3 215 3 cysG1 Siroheme synthase 1 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C5BGP8 2.28e-34 130 37 2 194 3 cysG Siroheme synthase Edwardsiella ictaluri (strain 93-146)
Q3JCS0 2.84e-34 130 35 2 217 3 cysG Siroheme synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A0KQJ4 9.79e-32 123 37 3 204 3 cysG3 Siroheme synthase 3 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SHL4 2.47e-31 122 37 4 216 3 cysG1 Siroheme synthase 1 Aeromonas salmonicida (strain A449)
Q2KWB0 1.23e-30 120 38 2 180 3 cysG Siroheme synthase Bordetella avium (strain 197N)
B0BTC2 9.33e-30 118 35 2 192 3 cysG Siroheme synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q7VZ77 1.84e-29 117 38 2 180 3 cysG Siroheme synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WB57 1.92e-29 117 38 2 180 3 cysG Siroheme synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMM4 1.92e-29 117 38 2 180 3 cysG Siroheme synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7NZV7 9.79e-29 115 38 2 178 3 cysG Siroheme synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B3GZA0 1.32e-28 115 35 2 192 3 cysG Siroheme synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
C1DKY7 1.77e-28 114 36 2 195 3 cysG Siroheme synthase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q1IBC9 2.69e-27 111 37 2 192 3 cysG Siroheme synthase Pseudomonas entomophila (strain L48)
A4VLU6 3.06e-27 110 35 4 212 3 cysG Siroheme synthase Stutzerimonas stutzeri (strain A1501)
A1SRP9 4.6e-27 110 31 2 189 3 cysG Siroheme synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A7MJ67 7.09e-27 110 35 2 180 3 cysG1 Siroheme synthase 1 Cronobacter sakazakii (strain ATCC BAA-894)
Q6LM67 1.05e-26 109 32 3 213 3 cysG Siroheme synthase Photobacterium profundum (strain SS9)
B7UW11 1.59e-26 108 34 3 211 3 cysG Siroheme synthase Pseudomonas aeruginosa (strain LESB58)
A1AVU5 1.74e-26 108 30 2 199 3 cysG Siroheme synthase Ruthia magnifica subsp. Calyptogena magnifica
Q9I0M7 1.88e-26 108 34 3 211 3 cysG Siroheme synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5CXE4 2.12e-26 108 30 2 199 3 cysG Siroheme synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A0KP37 2.88e-26 108 34 3 218 3 cysG2 Siroheme synthase 2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6V4H6 3.01e-26 108 34 3 211 3 cysG Siroheme synthase Pseudomonas aeruginosa (strain PA7)
Q820Q4 4.12e-26 107 32 5 215 3 cysG Siroheme synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q02NA3 4.96e-26 107 34 3 211 3 cysG Siroheme synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3ILQ9 7.1e-26 107 33 3 217 3 cysG Siroheme synthase Pseudoalteromonas translucida (strain TAC 125)
A4SRH0 1.22e-25 106 36 3 196 3 cysG2 Siroheme synthase 2 Aeromonas salmonicida (strain A449)
A9HZV6 1.31e-25 106 41 2 144 3 cysG Siroheme synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q65T49 1.61e-25 106 31 2 185 3 cysG Siroheme synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1H3L5 5.36e-25 104 34 2 198 3 cysG Siroheme synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9PF46 5.68e-25 104 33 2 193 3 cysG Siroheme synthase Xylella fastidiosa (strain 9a5c)
A6TD45 6.46e-25 104 33 2 181 3 cysG1 Siroheme synthase 1 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B8GUD3 1.49e-24 103 34 4 196 3 cysG Siroheme synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q5NRM4 2.15e-24 103 32 2 181 3 cysG Siroheme synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A8G9Y3 2.15e-24 103 33 2 180 3 cysG1 Siroheme synthase 1 Serratia proteamaculans (strain 568)
C4LAG5 2.4e-24 102 35 3 196 3 cysG Siroheme synthase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q87AI5 2.42e-24 103 32 2 193 3 cysG Siroheme synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I985 2.42e-24 103 32 2 193 3 cysG Siroheme synthase Xylella fastidiosa (strain M23)
Q21K21 2.66e-24 102 34 2 190 3 cysG Siroheme synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B0U4X0 2.81e-24 102 33 1 178 3 cysG Siroheme synthase Xylella fastidiosa (strain M12)
Q15YU1 5.64e-24 102 32 2 193 3 cysG Siroheme synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7N8L2 1.31e-23 100 33 2 181 3 cysG Siroheme synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P57500 1.48e-23 100 29 2 190 3 cysG Siroheme synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q2NVN0 3.14e-23 99 35 4 179 3 cysG Siroheme synthase Sodalis glossinidius (strain morsitans)
A9LZ77 3.45e-23 99 33 2 185 3 cysG Siroheme synthase Neisseria meningitidis serogroup C (strain 053442)
Q2Y6L7 3.48e-23 99 32 3 197 3 cysG Siroheme synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0AHC1 6.18e-23 99 31 4 205 3 cysG Siroheme synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
C3JY53 9.5e-23 98 34 2 195 3 cysG Siroheme synthase Pseudomonas fluorescens (strain SBW25)
Q7VQG9 1.31e-22 98 31 3 193 3 cysG Siroheme synthase Blochmanniella floridana
Q87ZT0 2.13e-22 97 32 3 211 3 cysG Siroheme synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3KA85 2.84e-22 97 34 2 196 3 cysG Siroheme synthase Pseudomonas fluorescens (strain Pf0-1)
Q606C9 4.29e-22 96 35 2 195 3 cysG Siroheme synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1QAX7 4.82e-22 96 30 2 202 3 cysG Siroheme synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FSU1 4.92e-22 96 30 2 202 3 cysG Siroheme synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A4XUX3 5.17e-22 96 33 3 190 3 cysG Siroheme synthase Pseudomonas mendocina (strain ymp)
Q0A812 7.14e-22 96 32 3 194 3 cysG Siroheme synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q4K9V8 7.52e-22 95 35 3 197 3 cysG Siroheme synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6D1A4 1.68e-21 95 33 2 181 3 cysG1 Siroheme synthase 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3SG32 3.89e-21 94 33 4 199 3 cysG Siroheme synthase Thiobacillus denitrificans (strain ATCC 25259)
Q4ZRL6 4.44e-21 94 32 3 211 3 cysG Siroheme synthase Pseudomonas syringae pv. syringae (strain B728a)
Q48H75 5.46e-21 93 33 4 212 3 cysG Siroheme synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A1KU10 7.01e-21 93 34 2 185 3 cysG Siroheme synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P95370 7.43e-21 93 34 2 185 3 cysG Siroheme synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P57001 7.96e-21 93 34 2 185 3 cysG Siroheme synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1WWP8 1.77e-20 92 29 3 210 3 cysG1 Siroheme synthase 1 Halorhodospira halophila (strain DSM 244 / SL1)
Q6F8G6 2.91e-20 91 27 2 214 3 cysG Siroheme synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0VQ05 5.16e-20 90 30 2 195 3 cysG Siroheme synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A5WEG6 5.42e-20 90 30 2 194 3 cysG Siroheme synthase Psychrobacter sp. (strain PRwf-1)
Q1LTP4 9.39e-20 90 29 4 182 3 cysG Siroheme synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
A4TPZ1 9.45e-20 90 32 2 181 3 cysG2 Siroheme synthase 2 Yersinia pestis (strain Pestoides F)
Q66EC9 9.45e-20 90 32 2 181 3 cysG1 Siroheme synthase 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CLS2 9.45e-20 90 32 2 181 3 cysG1 Siroheme synthase 1 Yersinia pestis bv. Antiqua (strain Nepal516)
A7FLY4 9.54e-20 90 32 2 181 3 cysG1 Siroheme synthase 1 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q31GG8 5.66e-19 87 30 2 183 3 cysG Siroheme synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A6VPZ6 6.99e-19 87 31 3 194 3 cysG Siroheme synthase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q2SJB7 1.14e-18 87 34 4 184 3 cysG Siroheme synthase Hahella chejuensis (strain KCTC 2396)
A1JJS8 1.89e-18 86 33 2 181 3 cysG1 Siroheme synthase 1 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1WYD5 2.47e-18 86 28 2 200 3 cysG2 Siroheme synthase 2 Halorhodospira halophila (strain DSM 244 / SL1)
A5W1H7 1.2e-16 81 35 2 192 3 cysG Siroheme synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88FT3 1.34e-16 80 35 2 192 3 cysG Siroheme synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B1JBD9 1.48e-16 80 35 2 192 3 cysG Siroheme synthase Pseudomonas putida (strain W619)
Q5FP95 3.27e-16 80 33 3 150 3 cysG Siroheme synthase Gluconobacter oxydans (strain 621H)
Q493N1 6e-16 79 27 3 189 3 cysG Siroheme synthase Blochmanniella pennsylvanica (strain BPEN)
Q59292 7.52e-12 67 32 1 117 3 hemA Probable multifunctional siroheme biosynthesis protein HemA Ruminiclostridium josui
A9H259 3.93e-11 65 32 6 193 3 cysG Siroheme synthase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
O14172 8.17e-10 60 23 3 201 3 met8 Siroheme biosynthesis protein met8 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q46CH4 4.62e-08 55 23 6 190 1 Mbar_A1461 Precorrin-2 dehydrogenase Methanosarcina barkeri (strain Fusaro / DSM 804)
O34813 5.56e-08 53 25 4 150 1 sirC Precorrin-2 dehydrogenase Bacillus subtilis (strain 168)
O74468 7.68e-05 46 30 4 108 2 SPCC1739.06c Probable uroporphyrinogen-III C-methyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS13655
Feature type CDS
Gene -
Product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase
Location 367351 - 368007 (strand: -1)
Length 657 (nucleotides) / 218 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2726
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF10414 Sirohaem synthase dimerisation region
PF13241 Putative NAD(P)-binding

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1648 Coenzyme transport and metabolism (H) H Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain)

Kegg Ortholog Annotation(s)

Protein Sequence

MLRYPLFCDLQGKTCLVVGGGEVALHKCQALLQAGANVIVVARYFHSDFAALAEHPQLTCTQAPFDSTLWPDDCWLAFAATDSPEVNQQVLALANTHRCFCNVTDSPETASFISPATIDVLPVQIALTCGGNPVYTQFLKHRVMQAIPFDAPVKLQLAARVREQVKATNASRDAKRLFWQKFFTDTALEQLLSLQDDDLLADYLSYLLAQFTEEQGTC

Flanking regions ( +/- flanking 50bp)

ATATGATGCGAAAAATACTTTCTGACCGAATAATCCGGAGAAAAAACATTATGCTGCGCTATCCGTTGTTTTGTGACTTACAGGGAAAAACGTGTCTGGTTGTGGGCGGGGGAGAAGTTGCCCTGCATAAATGTCAGGCTCTGTTACAGGCGGGCGCTAATGTCATTGTGGTTGCGCGCTATTTTCACAGTGACTTTGCTGCACTGGCGGAACATCCGCAGCTGACATGCACGCAAGCGCCGTTTGACAGCACATTGTGGCCGGATGACTGCTGGCTGGCATTTGCCGCCACTGATTCACCGGAGGTTAATCAGCAGGTACTGGCTCTGGCAAATACGCACCGCTGCTTTTGTAATGTGACTGACTCGCCGGAAACCGCCTCATTTATCTCTCCTGCGACAATTGATGTACTGCCGGTACAGATAGCGCTGACCTGCGGCGGTAATCCCGTATATACCCAATTCCTGAAACACCGGGTGATGCAGGCAATACCCTTCGACGCCCCGGTGAAACTACAGCTTGCCGCCCGTGTACGGGAGCAGGTGAAAGCCACAAATGCCTCCCGTGATGCCAAGCGGCTGTTCTGGCAAAAATTCTTCACAGATACCGCACTGGAGCAGCTTTTATCATTACAGGATGATGACCTGCTGGCAGATTACCTTTCCTATCTGCTGGCACAGTTTACCGAAGAGCAGGGTACGTGCTGAAACATACTTTAAGATTGTCGCCATGAGCATATACCCTTATTCATTCAAAC