Homologs in group_1022

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05725 FBDBKF_05725 79.3 Morganella morganii S1 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
EHELCC_11865 EHELCC_11865 79.3 Morganella morganii S2 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
NLDBIP_12205 NLDBIP_12205 79.3 Morganella morganii S4 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
LHKJJB_12065 LHKJJB_12065 79.3 Morganella morganii S3 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
HKOGLL_10680 HKOGLL_10680 79.3 Morganella morganii S5 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
PMI_RS14760 PMI_RS14760 75.0 Proteus mirabilis HI4320 - RluA family pseudouridine synthase

Distribution of the homologs in the orthogroup group_1022

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1022

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q87LD3 8.02e-51 168 42 3 210 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DCG0 2.1e-50 167 42 2 210 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio vulnificus (strain CMCP6)
Q9CK02 1.63e-48 161 42 3 214 3 rluA Dual-specificity RNA pseudouridine synthase RluA Pasteurella multocida (strain Pm70)
Q8ZIK1 4.73e-48 160 40 4 215 3 rluA Dual-specificity RNA pseudouridine synthase RluA Yersinia pestis
P44782 3.72e-47 158 39 3 223 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AA38 2.47e-45 153 38 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Shigella flexneri
P0AA37 2.47e-45 153 38 3 222 1 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli (strain K12)
Q8FL93 3.89e-45 153 38 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9KP71 3.93e-45 154 40 3 214 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8XA10 8.75e-45 152 38 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O157:H7
P59831 1.29e-44 152 40 3 215 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8Z9J5 4.23e-43 147 37 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhi
Q8ZRV9 6.04e-43 147 37 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XYX8 3.54e-36 133 37 8 241 3 rluD Ribosomal large subunit pseudouridine synthase D Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q82WZ5 1.74e-34 129 38 7 216 3 rluD Ribosomal large subunit pseudouridine synthase D Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P54604 6.52e-33 124 34 6 226 3 yhcT Uncharacterized RNA pseudouridine synthase YhcT Bacillus subtilis (strain 168)
Q9CKA6 2.11e-32 123 33 5 221 3 rluD Ribosomal large subunit pseudouridine synthase D Pasteurella multocida (strain Pm70)
P33640 6.76e-32 121 34 8 231 3 rluD Ribosomal large subunit pseudouridine synthase D Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8P682 3.13e-31 120 37 8 237 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9L7A7 2.14e-30 117 34 7 229 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9JVB6 2.78e-30 118 33 5 229 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9KQH0 3.22e-30 117 33 7 222 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P33643 4.12e-30 117 33 8 222 1 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli (strain K12)
P65835 5.36e-30 116 33 8 222 3 rluD Ribosomal large subunit pseudouridine synthase D Shigella flexneri
P65834 5.36e-30 116 33 8 222 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X9F0 6.14e-30 116 33 8 222 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O157:H7
P65836 7.49e-30 116 34 9 239 1 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65837 7.49e-30 116 34 9 239 3 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhi
Q8D8G1 1.4e-29 115 35 9 221 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q9K0B0 1.95e-29 116 32 5 229 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P50513 2.55e-29 114 32 9 249 3 rluD Ribosomal large subunit pseudouridine synthase D Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P44445 4.79e-29 114 33 6 221 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4UKQ3 9.5e-29 112 35 5 216 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9KU20 1.06e-28 113 34 7 224 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87AR7 1.57e-28 112 36 8 224 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87N15 1.58e-28 112 34 9 218 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8PHN2 2.1e-28 112 35 7 237 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas axonopodis pv. citri (strain 306)
Q47417 2.27e-28 113 37 7 221 3 truC tRNA pseudouridine synthase C Pectobacterium carotovorum subsp. carotovorum
Q45826 2.35e-28 112 36 10 234 3 Caur_0901 Uncharacterized RNA pseudouridine synthase Caur_0901 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q9PET9 3.19e-28 112 35 8 224 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain 9a5c)
Q87S65 3.73e-28 111 33 7 224 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q68XB2 1.7e-27 109 34 5 216 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8ZBV7 2.03e-27 109 32 8 230 3 rluD Ribosomal large subunit pseudouridine synthase D Yersinia pestis
P74346 3.09e-27 109 31 6 224 3 slr1629 Uncharacterized RNA pseudouridine synthase slr1629 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8FEF9 1.46e-26 106 36 7 218 3 truC tRNA pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O50310 1.47e-26 107 32 9 258 3 Cpar_0723 Uncharacterized RNA pseudouridine synthase Cpar_0723 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
P70870 1.58e-26 107 32 4 214 3 rluD Ribosomal large subunit pseudouridine synthase D Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q92IS6 1.87e-26 107 35 5 216 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9ZDR7 3.28e-26 106 34 5 216 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia prowazekii (strain Madrid E)
P44433 3.47e-26 106 34 6 216 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8X6T6 5.34e-26 104 35 7 219 3 truC tRNA pseudouridine synthase C Escherichia coli O157:H7
P0AA42 5.87e-26 104 35 7 219 3 truC tRNA pseudouridine synthase C Shigella flexneri
P0AA41 5.87e-26 104 35 7 219 1 truC tRNA pseudouridine synthase C Escherichia coli (strain K12)
Q8ZH72 8.4e-26 103 34 6 218 3 truC tRNA pseudouridine synthase C Yersinia pestis
Q8VCZ8 2.07e-25 104 31 7 240 2 Rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Mus musculus
Q8DEV0 2.71e-25 104 32 8 224 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio vulnificus (strain CMCP6)
Q9CM51 3.87e-25 103 32 8 236 3 rluC Ribosomal large subunit pseudouridine synthase C Pasteurella multocida (strain Pm70)
O67638 7.72e-25 102 33 7 230 3 aq_1758 Uncharacterized RNA pseudouridine synthase aq_1758 Aquifex aeolicus (strain VF5)
Q8ZQ16 1.07e-24 102 33 7 214 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P57430 1.75e-24 101 31 6 214 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9J8 2.61e-24 101 32 7 214 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9E9 2.82e-24 101 30 9 241 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8X8J3 3.16e-24 101 33 7 214 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O157:H7
Q17QT4 3.17e-24 100 38 6 184 2 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Bos taurus
P0AA40 3.26e-24 101 33 7 214 3 rluC Ribosomal large subunit pseudouridine synthase C Shigella flexneri
P0AA39 3.26e-24 101 33 7 214 1 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli (strain K12)
Q8Z7J7 3.97e-24 100 32 7 214 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhi
Q1RJX7 5.1e-24 100 33 6 216 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia bellii (strain RML369-C)
Q8FIP7 5.81e-24 100 33 7 214 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q45480 6.09e-24 100 33 10 233 3 ylyB Uncharacterized RNA pseudouridine synthase YlyB Bacillus subtilis (strain 168)
O31613 1.21e-23 99 31 7 224 3 yjbO Uncharacterized RNA pseudouridine synthase YjbO Bacillus subtilis (strain 168)
Q8ZMD5 2.77e-23 97 33 6 221 3 truC tRNA pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q87MD4 3.55e-23 97 31 9 223 3 truC tRNA pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8Z439 3.95e-23 97 33 6 221 3 truC tRNA pseudouridine synthase C Salmonella typhi
Q08C69 6.06e-23 97 31 10 241 2 rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Danio rerio
P59835 6.35e-23 97 31 7 233 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P59840 1.08e-22 95 33 8 222 3 truC tRNA pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O66114 1.57e-22 94 34 7 217 3 ZMO0505 Uncharacterized RNA pseudouridine synthase ZMO0505 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q5Z8P2 2.49e-22 97 38 7 198 2 Os06g0717400 RNA pseudouridine synthase 2, chloroplastic Oryza sativa subsp. japonica
Q9UJJ7 2.89e-22 95 30 8 241 1 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Homo sapiens
Q8ZFU1 2.96e-22 95 31 6 216 3 rluC Ribosomal large subunit pseudouridine synthase C Yersinia pestis
Q89AD9 8.22e-22 94 30 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P44197 1.37e-21 92 32 6 222 3 truC tRNA pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DBG5 1.49e-21 92 31 10 225 3 truC tRNA pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
P43930 1.78e-21 92 33 6 203 3 HI_0042 Uncharacterized RNA pseudouridine synthase HI_0042 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A5T3 2.25e-21 93 31 7 226 3 BQ2027_MB1567 Uncharacterized RNA pseudouridine synthase Mb1567 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ3 2.25e-21 93 31 7 226 1 Rv1540 Uncharacterized RNA pseudouridine synthase Rv1540 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ2 2.25e-21 93 31 7 226 3 MT1592 Uncharacterized RNA pseudouridine synthase MT1592 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q3ECD0 4.56e-21 94 36 6 185 2 At1g76050 RNA pseudouridine synthase 2, chloroplastic Arabidopsis thaliana
O25441 1.93e-20 91 32 9 224 3 HP_0745 Uncharacterized RNA pseudouridine synthase HP_0745 Helicobacter pylori (strain ATCC 700392 / 26695)
P57481 8.54e-20 89 29 8 233 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9CNF3 1.01e-19 87 32 8 233 3 truC tRNA pseudouridine synthase C Pasteurella multocida (strain Pm70)
Q9ZL98 1.13e-19 89 32 9 224 3 jhp_0682 Uncharacterized RNA pseudouridine synthase jhp_0682 Helicobacter pylori (strain J99 / ATCC 700824)
P59838 1.57e-19 88 28 5 227 3 rluD Ribosomal large subunit pseudouridine synthase D Blochmanniella floridana
Q9KTL4 1.85e-19 87 30 9 222 3 truC tRNA pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q89AH2 4.44e-19 87 30 8 219 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q2QNM3 3.73e-18 85 28 8 253 2 Os12g0560500 RNA pseudouridine synthase 1 Oryza sativa subsp. japonica
P47451 5.76e-18 84 28 9 226 3 MG209 Uncharacterized RNA pseudouridine synthase MG209 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9HZM9 1.4e-17 83 32 7 212 3 rluC Ribosomal large subunit pseudouridine synthase C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P75485 1.03e-16 80 28 6 209 3 MPN_292 Uncharacterized RNA pseudouridine synthase MG209 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q5M721 4.51e-16 79 30 5 213 2 At3g52260 RNA pseudouridine synthase 5 Arabidopsis thaliana
P72970 7.37e-16 78 29 7 224 3 slr1592 Uncharacterized RNA pseudouridine synthase slr1592 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0DST9 1.49e-15 78 31 8 219 2 Os03g0288500 RNA pseudouridine synthase 5 Oryza sativa subsp. japonica
Q9ZKP5 1.1e-14 73 30 8 198 3 jhp_0890 Uncharacterized RNA pseudouridine synthase jhp_0890 Helicobacter pylori (strain J99 / ATCC 700824)
O16686 2.45e-14 74 31 5 183 3 K07E8.7 Uncharacterized protein K07E8.7 Caenorhabditis elegans
Q12069 5.23e-14 73 29 7 184 1 PUS9 tRNA pseudouridine(32) synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q149F1 8.08e-14 73 29 9 192 1 Rpusd2 Pseudouridylate synthase RPUSD2 Mus musculus
O25610 1.44e-13 70 30 8 198 3 HP_0956 Uncharacterized RNA pseudouridine synthase HP_0956 Helicobacter pylori (strain ATCC 700392 / 26695)
Q7XA65 4.5e-13 70 27 6 250 2 At1g56345 RNA pseudouridine synthase 1 Arabidopsis thaliana
Q9LU60 7.8e-13 70 32 7 192 2 At5g51140 RNA pseudouridine synthase 7 Arabidopsis thaliana
Q28C59 8.26e-12 67 29 6 220 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Xenopus tropicalis
Q8IZ73 2.09e-11 66 27 9 195 1 RPUSD2 Pseudouridylate synthase RPUSD2 Homo sapiens
Q0J4D4 3.21e-11 65 27 12 256 2 Os08g0520100 RNA pseudouridine synthase 3, mitochondrial Oryza sativa subsp. japonica
Q9ZMA1 3.56e-11 65 34 8 166 3 jhp_0321 Uncharacterized RNA pseudouridine synthase jhp_0321 Helicobacter pylori (strain J99 / ATCC 700824)
Q9LT72 1.27e-10 63 28 9 231 2 At3g19440 RNA pseudouridine synthase 4, mitochondrial Arabidopsis thaliana
Q5XET6 2.12e-10 63 26 11 241 2 At1g78910 RNA pseudouridine synthase 3, mitochondrial Arabidopsis thaliana
O25114 4.22e-10 62 31 4 160 1 HP_0347 Uncharacterized RNA pseudouridine synthase HP_0347 Helicobacter pylori (strain ATCC 700392 / 26695)
P53294 7.19e-10 61 28 6 195 1 PUS6 tRNA pseudouridine(31) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12362 1.28e-09 61 27 5 179 1 RIB2 Bifunctional protein RIB2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q96CM3 1.94e-08 57 28 5 203 1 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Homo sapiens
Q09709 2.7e-08 57 29 9 191 3 SPAC18B11.02c Pseudouridylate synthase C18B11.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P47610 4e-08 56 25 10 218 3 MG370 Uncharacterized RNA pseudouridine synthase MG370 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5E9Z1 1.66e-07 54 29 6 203 2 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Bos taurus
Q0E0Y3 1.87e-07 54 29 7 184 2 Os02g0512300 RNA pseudouridine synthase 7 Oryza sativa subsp. japonica
Q69K07 3.82e-07 53 28 5 187 2 Os09g0103500 RNA pseudouridine synthase 4, mitochondrial Oryza sativa subsp. japonica
Q4QQT0 1.11e-06 52 27 6 204 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Rattus norvegicus
P75230 2.35e-06 50 23 5 216 3 MPN_548 Uncharacterized RNA pseudouridine synthase MG370 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9CWX4 3.48e-06 50 26 5 214 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Mus musculus
Q8I3Z1 0.000113 46 32 1 84 1 PFE0570w MATH and LRR domain-containing protein PFE0570w Plasmodium falciparum (isolate 3D7)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12565
Feature type CDS
Gene -
Product RluA family pseudouridine synthase
Location 106807 - 107505 (strand: 1)
Length 699 (nucleotides) / 232 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1022
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0564 Translation, ribosomal structure and biogenesis (J) J Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06177 tRNA pseudouridine32 synthase / 23S rRNA pseudouridine746 synthase [EC:5.4.99.28 5.4.99.29] - -

Protein Sequence

MSAIIDTFIAPPCHDEIEIILQDDHLVLINKPAGLLSLSGKNPQNLDSVHYRLVQLFPGCTLVHRLDFGTSGLMVIARNKGINAALCQQFSQRTVTKVYSALLCGHLSDNEGVIDAAIAKDPALFPRMSICAIRGKPARSHYRVIERVYHKSEDGTLLPVTRVQLTPETGRTHQLRIHCQLSGHPILGCDLYGGLLQPGTEKTPRLMLHASELNFVHPVSGEPINAQNASPF

Flanking regions ( +/- flanking 50bp)

CGGCTTAAAATTCGCTATCATTCACTCCCGCTCTTTATCCGGATAGCCCGATGTCTGCCATTATTGATACCTTTATTGCCCCGCCGTGTCATGACGAGATAGAGATAATCTTGCAAGACGATCATCTGGTGCTTATCAATAAACCCGCCGGGCTGCTCAGTCTCTCGGGAAAAAATCCGCAAAATCTGGATTCAGTACATTACCGGCTGGTGCAACTCTTTCCGGGCTGCACCCTGGTTCATCGTCTGGATTTCGGGACGTCCGGGCTGATGGTGATTGCCCGCAATAAAGGGATAAACGCCGCCCTCTGCCAACAGTTCAGCCAACGCACAGTAACCAAAGTATACAGCGCGCTGCTTTGCGGGCATCTGAGCGATAATGAAGGCGTGATAGATGCCGCAATAGCCAAAGACCCTGCGCTGTTTCCACGGATGTCCATCTGTGCTATCCGCGGCAAGCCCGCCCGCTCACACTACCGGGTCATTGAGCGCGTTTATCATAAGTCAGAAGACGGAACATTGCTGCCGGTAACGCGGGTACAGCTAACCCCGGAAACCGGGCGCACTCATCAACTGCGCATTCACTGTCAGTTGTCGGGACATCCGATTCTGGGCTGCGACCTTTATGGCGGGCTCCTGCAACCCGGAACAGAAAAAACACCCCGGTTGATGTTGCACGCCAGTGAGCTTAATTTTGTTCATCCCGTCAGCGGAGAGCCAATTAACGCCCAAAATGCCAGCCCGTTCTGACAGCAAACATACTTATACCAATACTTCTGAAAAAACGCTTATATATACGC