Homologs in group_1022

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05725 FBDBKF_05725 100.0 Morganella morganii S1 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
EHELCC_11865 EHELCC_11865 100.0 Morganella morganii S2 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
NLDBIP_12205 NLDBIP_12205 100.0 Morganella morganii S4 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
LHKJJB_12065 LHKJJB_12065 100.0 Morganella morganii S3 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
F4V73_RS12565 F4V73_RS12565 79.3 Morganella psychrotolerans - RluA family pseudouridine synthase
PMI_RS14760 PMI_RS14760 70.7 Proteus mirabilis HI4320 - RluA family pseudouridine synthase

Distribution of the homologs in the orthogroup group_1022

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1022

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9CK02 2.04e-51 170 43 2 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Pasteurella multocida (strain Pm70)
Q8ZIK1 2.74e-50 166 42 3 214 3 rluA Dual-specificity RNA pseudouridine synthase RluA Yersinia pestis
Q87LD3 1.67e-49 166 40 2 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0AA38 3.44e-49 164 40 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Shigella flexneri
P0AA37 3.44e-49 164 40 3 222 1 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli (strain K12)
Q8FL93 6.1e-49 163 40 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XA10 1.29e-48 162 40 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O157:H7
Q8DCG0 4.12e-48 162 39 3 223 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio vulnificus (strain CMCP6)
Q8Z9J5 2.54e-47 159 40 2 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhi
P44782 3.55e-47 159 42 4 223 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZRV9 4.18e-47 159 40 2 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KP71 3.69e-46 157 40 2 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P59831 1.18e-44 152 41 3 215 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q82WZ5 4.77e-38 139 39 7 225 3 rluD Ribosomal large subunit pseudouridine synthase D Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q87AR7 2.7e-37 136 38 9 246 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PET9 3.87e-37 136 39 8 230 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain 9a5c)
Q8P682 5.31e-37 135 39 9 239 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PHN2 8.61e-36 132 39 9 239 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas axonopodis pv. citri (strain 306)
P54604 9.06e-36 132 34 6 241 3 yhcT Uncharacterized RNA pseudouridine synthase YhcT Bacillus subtilis (strain 168)
Q8XYX8 8.25e-35 130 37 9 248 3 rluD Ribosomal large subunit pseudouridine synthase D Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
O31613 1.83e-34 128 35 7 237 3 yjbO Uncharacterized RNA pseudouridine synthase YjbO Bacillus subtilis (strain 168)
Q9KQH0 3.05e-34 128 34 6 223 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P33640 3.14e-34 128 35 7 231 3 rluD Ribosomal large subunit pseudouridine synthase D Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O50310 3.37e-34 128 36 10 264 3 Cpar_0723 Uncharacterized RNA pseudouridine synthase Cpar_0723 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q45480 7.28e-33 124 34 7 257 3 ylyB Uncharacterized RNA pseudouridine synthase YlyB Bacillus subtilis (strain 168)
Q9CKA6 7.67e-33 124 31 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Pasteurella multocida (strain Pm70)
Q87S65 5.93e-32 122 33 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9K0B0 7.5e-32 123 35 5 234 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVB6 1.06e-31 122 35 5 234 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8D8G1 1.4e-31 121 35 7 220 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
P33643 1.55e-31 121 33 7 230 1 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli (strain K12)
Q9CM51 1.6e-31 121 35 6 219 3 rluC Ribosomal large subunit pseudouridine synthase C Pasteurella multocida (strain Pm70)
Q9KU20 1.61e-31 121 33 5 230 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P65835 1.8e-31 121 33 7 230 3 rluD Ribosomal large subunit pseudouridine synthase D Shigella flexneri
P65834 1.8e-31 121 33 7 230 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8ZQ16 2e-31 120 35 7 222 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X9F0 2.08e-31 121 33 7 230 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O157:H7
Q45826 2.11e-31 120 36 9 255 3 Caur_0901 Uncharacterized RNA pseudouridine synthase Caur_0901 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q87N15 3.18e-31 120 34 7 220 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8Z7J7 5.81e-31 119 35 7 222 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhi
Q8X8J3 6.66e-31 119 35 7 222 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O157:H7
P0AA40 6.73e-31 119 35 7 222 3 rluC Ribosomal large subunit pseudouridine synthase C Shigella flexneri
P0AA39 6.73e-31 119 35 7 222 1 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli (strain K12)
P74346 7.06e-31 119 34 6 229 3 slr1629 Uncharacterized RNA pseudouridine synthase slr1629 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DEV0 1.09e-30 119 33 5 230 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio vulnificus (strain CMCP6)
Q8FIP7 1.52e-30 118 35 7 222 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P65836 1.67e-30 118 33 7 230 1 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65837 1.67e-30 118 33 7 230 3 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhi
Q9L7A7 2.81e-30 118 32 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8K9J8 3.19e-30 117 32 6 224 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P44433 5.47e-30 117 35 6 213 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57430 7.68e-30 116 30 6 243 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P44445 1.22e-29 116 32 7 232 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8VCZ8 3.37e-29 114 35 7 240 2 Rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Mus musculus
Q4UKQ3 5.81e-29 114 35 6 217 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8ZBV7 1.17e-28 114 32 8 236 3 rluD Ribosomal large subunit pseudouridine synthase D Yersinia pestis
Q47417 1.19e-28 114 35 8 231 3 truC tRNA pseudouridine synthase C Pectobacterium carotovorum subsp. carotovorum
Q17QT4 3.07e-28 112 36 8 240 2 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Bos taurus
P70870 3.83e-28 112 34 5 210 3 rluD Ribosomal large subunit pseudouridine synthase D Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P59835 4.7e-28 112 33 6 219 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q68XB2 7.29e-28 111 35 5 217 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q08C69 8.15e-28 110 34 9 241 2 rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Danio rerio
Q8K9E9 8.36e-28 111 29 8 246 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8ZFU1 9.63e-28 111 35 7 219 3 rluC Ribosomal large subunit pseudouridine synthase C Yersinia pestis
P50513 1.2e-27 110 32 7 230 3 rluD Ribosomal large subunit pseudouridine synthase D Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1RJX7 2.1e-27 110 35 5 216 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia bellii (strain RML369-C)
Q92IS6 2.74e-27 109 35 6 217 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9UJJ7 6.46e-27 108 35 8 241 1 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Homo sapiens
Q8ZH72 8.79e-27 107 33 7 233 3 truC tRNA pseudouridine synthase C Yersinia pestis
Q9ZDR7 1.84e-26 107 34 5 217 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia prowazekii (strain Madrid E)
O67638 2.53e-26 107 32 7 224 3 aq_1758 Uncharacterized RNA pseudouridine synthase aq_1758 Aquifex aeolicus (strain VF5)
O66114 3.74e-26 104 36 7 217 3 ZMO0505 Uncharacterized RNA pseudouridine synthase ZMO0505 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P0A5T3 6.02e-26 106 34 7 227 3 BQ2027_MB1567 Uncharacterized RNA pseudouridine synthase Mb1567 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ3 6.02e-26 106 34 7 227 1 Rv1540 Uncharacterized RNA pseudouridine synthase Rv1540 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ2 6.02e-26 106 34 7 227 3 MT1592 Uncharacterized RNA pseudouridine synthase MT1592 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59840 5.01e-25 102 34 7 226 3 truC tRNA pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q87MD4 8.92e-25 101 31 10 232 3 truC tRNA pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q89AH2 8.97e-25 103 30 8 227 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57481 9.38e-25 103 31 8 238 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8X6T6 2.06e-24 101 32 7 228 3 truC tRNA pseudouridine synthase C Escherichia coli O157:H7
P0AA42 2.24e-24 100 32 7 228 3 truC tRNA pseudouridine synthase C Shigella flexneri
P0AA41 2.24e-24 100 32 7 228 1 truC tRNA pseudouridine synthase C Escherichia coli (strain K12)
Q8FEF9 2.79e-24 100 33 7 227 3 truC tRNA pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59838 5.44e-24 101 28 8 241 3 rluD Ribosomal large subunit pseudouridine synthase D Blochmanniella floridana
Q89AD9 9.87e-24 100 30 7 231 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q5Z8P2 3.07e-23 100 32 8 290 2 Os06g0717400 RNA pseudouridine synthase 2, chloroplastic Oryza sativa subsp. japonica
O25441 3.95e-23 99 31 8 229 3 HP_0745 Uncharacterized RNA pseudouridine synthase HP_0745 Helicobacter pylori (strain ATCC 700392 / 26695)
P43930 4.38e-23 96 34 5 200 3 HI_0042 Uncharacterized RNA pseudouridine synthase HI_0042 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DBG5 5.75e-23 97 32 10 230 3 truC tRNA pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q9CNF3 8.37e-23 96 33 7 227 3 truC tRNA pseudouridine synthase C Pasteurella multocida (strain Pm70)
Q3ECD0 1.41e-21 95 30 8 277 2 At1g76050 RNA pseudouridine synthase 2, chloroplastic Arabidopsis thaliana
Q8Z439 2.05e-21 93 31 4 222 3 truC tRNA pseudouridine synthase C Salmonella typhi
P44197 3.19e-21 92 32 9 232 3 truC tRNA pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZMD5 4.22e-21 92 31 4 222 3 truC tRNA pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZL98 4.3e-21 93 31 8 224 3 jhp_0682 Uncharacterized RNA pseudouridine synthase jhp_0682 Helicobacter pylori (strain J99 / ATCC 700824)
Q9KTL4 5.1e-21 91 32 11 232 3 truC tRNA pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2QNM3 7.26e-21 93 28 7 251 2 Os12g0560500 RNA pseudouridine synthase 1 Oryza sativa subsp. japonica
P72970 1.4e-19 89 32 9 240 3 slr1592 Uncharacterized RNA pseudouridine synthase slr1592 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9HZM9 3.65e-19 88 33 6 202 3 rluC Ribosomal large subunit pseudouridine synthase C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5M721 1.37e-18 87 32 6 213 2 At3g52260 RNA pseudouridine synthase 5 Arabidopsis thaliana
P47451 2.46e-18 85 29 8 240 3 MG209 Uncharacterized RNA pseudouridine synthase MG209 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q0DST9 7.8e-18 85 31 7 220 2 Os03g0288500 RNA pseudouridine synthase 5 Oryza sativa subsp. japonica
Q7XA65 9.05e-18 84 30 8 251 2 At1g56345 RNA pseudouridine synthase 1 Arabidopsis thaliana
P75485 9.27e-18 84 31 5 209 3 MPN_292 Uncharacterized RNA pseudouridine synthase MG209 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9ZKP5 5.99e-17 80 30 8 219 3 jhp_0890 Uncharacterized RNA pseudouridine synthase jhp_0890 Helicobacter pylori (strain J99 / ATCC 700824)
O25610 1.17e-15 77 28 8 229 3 HP_0956 Uncharacterized RNA pseudouridine synthase HP_0956 Helicobacter pylori (strain ATCC 700392 / 26695)
Q149F1 1.54e-15 79 31 8 191 1 Rpusd2 Pseudouridylate synthase RPUSD2 Mus musculus
Q9LU60 6.58e-15 76 32 7 222 2 At5g51140 RNA pseudouridine synthase 7 Arabidopsis thaliana
Q12069 7.13e-15 77 27 8 212 1 PUS9 tRNA pseudouridine(32) synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8IZ73 1.35e-14 76 30 8 191 1 RPUSD2 Pseudouridylate synthase RPUSD2 Homo sapiens
Q9ZMA1 1.02e-12 69 32 7 185 3 jhp_0321 Uncharacterized RNA pseudouridine synthase jhp_0321 Helicobacter pylori (strain J99 / ATCC 700824)
Q9LT72 4.55e-12 68 30 7 196 2 At3g19440 RNA pseudouridine synthase 4, mitochondrial Arabidopsis thaliana
P53294 4.8e-12 68 32 9 195 1 PUS6 tRNA pseudouridine(31) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O25114 5.24e-12 67 32 4 176 1 HP_0347 Uncharacterized RNA pseudouridine synthase HP_0347 Helicobacter pylori (strain ATCC 700392 / 26695)
Q09709 9.57e-12 67 30 10 197 3 SPAC18B11.02c Pseudouridylate synthase C18B11.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12362 1.27e-11 67 27 4 192 1 RIB2 Bifunctional protein RIB2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O16686 3.19e-11 66 27 5 184 3 K07E8.7 Uncharacterized protein K07E8.7 Caenorhabditis elegans
Q5XET6 3.66e-11 65 28 9 234 2 At1g78910 RNA pseudouridine synthase 3, mitochondrial Arabidopsis thaliana
Q0J4D4 4.26e-10 62 28 10 239 2 Os08g0520100 RNA pseudouridine synthase 3, mitochondrial Oryza sativa subsp. japonica
Q28C59 1.76e-09 60 31 9 210 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Xenopus tropicalis
Q0E0Y3 3.07e-09 60 30 7 183 2 Os02g0512300 RNA pseudouridine synthase 7 Oryza sativa subsp. japonica
P47610 3.95e-08 56 26 11 220 3 MG370 Uncharacterized RNA pseudouridine synthase MG370 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q69K07 5.92e-08 56 28 7 206 2 Os09g0103500 RNA pseudouridine synthase 4, mitochondrial Oryza sativa subsp. japonica
Q96CM3 8e-08 55 29 9 223 1 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Homo sapiens
Q4QQT0 8.14e-08 55 28 9 224 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Rattus norvegicus
Q9CWX4 1.39e-07 55 29 10 224 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Mus musculus
P45614 1.12e-06 52 28 7 195 3 MCAP_0714 Uncharacterized RNA pseudouridine synthase MCAP_0714 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q5E9Z1 2.72e-06 51 28 7 201 2 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Bos taurus
P75230 6.93e-05 47 25 8 219 3 MPN_548 Uncharacterized RNA pseudouridine synthase MG370 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8I3Z1 0.000111 47 32 1 84 1 PFE0570w MATH and LRR domain-containing protein PFE0570w Plasmodium falciparum (isolate 3D7)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_10680
Feature type CDS
Gene rluA
Product Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
Location 31203 - 31964 (strand: -1)
Length 762 (nucleotides) / 253 (amino acids)

Contig

Accession ZDB_688
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1022
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0564 Translation, ribosomal structure and biogenesis (J) J Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06177 tRNA pseudouridine32 synthase / 23S rRNA pseudouridine746 synthase [EC:5.4.99.28 5.4.99.29] - -

Protein Sequence

MIRHCTENWLSSPSAFYPDNPMSDITDTFIAPPCPEQIDILYQDEHLLLINKPAGLLSLSGKNPQNLDSVHYRLVQLFPGCTLVHRLDFGTSGLLLVARNKAINAALCRQFSERTVEKGYSALLCGHLNENEGIIDAAITKDPALFPRMTICAVRGKPARSHYQVTERFYYETEDELSLPVTRVALTPETGRTHQLRIHCQYLGHPILGCDLYGGKLLPGTGNIPRLMLHAGELDFVHPVSGEPVNARSPCPF

Flanking regions ( +/- flanking 50bp)

GGTAAGCGTTGATCATTCCGCAAAATTACGCAATAGGATAACCGGACAACATGATTCGCCACTGTACTGAAAATTGGTTATCATCCCCTTCCGCTTTTTACCCGGATAACCCGATGTCTGACATTACCGATACCTTTATCGCCCCGCCGTGCCCGGAGCAGATTGACATTCTTTATCAGGATGAGCACCTGCTGCTGATTAACAAACCTGCAGGGCTGCTCAGTCTGTCGGGAAAGAATCCGCAGAATCTGGATTCCGTGCATTACCGGCTGGTACAGCTGTTTCCCGGCTGCACACTGGTACACCGGCTGGATTTCGGCACATCCGGGCTGCTGCTGGTAGCCCGTAACAAAGCCATTAATGCCGCGCTTTGCCGTCAGTTCAGTGAACGGACTGTGGAGAAAGGCTACAGTGCCCTGCTGTGCGGGCATCTGAATGAGAATGAAGGAATAATTGATGCGGCGATTACCAAAGATCCGGCGTTGTTTCCGCGCATGACGATATGTGCTGTCCGGGGGAAACCGGCCCGTTCACATTATCAGGTGACTGAGCGCTTTTATTATGAAACTGAGGACGAGCTCTCTCTGCCGGTCACCAGGGTGGCACTGACACCGGAAACCGGCCGCACGCATCAGCTCCGCATTCATTGTCAGTATCTGGGCCATCCGATTTTAGGGTGTGATCTCTATGGCGGGAAACTATTGCCGGGCACCGGAAATATTCCGCGGCTGATGCTGCACGCCGGGGAACTGGATTTTGTGCATCCGGTCAGCGGCGAACCGGTTAATGCCCGCAGTCCCTGTCCGTTCTGAACAGGGAAGCAGGCAGATGCGGATCACCACATCAAATCATCCGGGATTTT