Homologs in group_1090

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05725 FBDBKF_05725 70.7 Morganella morganii S1 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
EHELCC_11865 EHELCC_11865 70.7 Morganella morganii S2 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
NLDBIP_12205 NLDBIP_12205 70.7 Morganella morganii S4 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
LHKJJB_12065 LHKJJB_12065 70.7 Morganella morganii S3 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
HKOGLL_10680 HKOGLL_10680 70.7 Morganella morganii S5 rluA Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific
F4V73_RS12565 F4V73_RS12565 75.0 Morganella psychrotolerans - RluA family pseudouridine synthase

Distribution of the homologs in the orthogroup group_1090

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1090

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZIK1 2.61e-51 168 44 3 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Yersinia pestis
P44782 9.42e-50 164 41 3 222 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DCG0 1.69e-49 165 42 4 216 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio vulnificus (strain CMCP6)
Q9CK02 1.77e-48 161 40 2 216 3 rluA Dual-specificity RNA pseudouridine synthase RluA Pasteurella multocida (strain Pm70)
Q87LD3 3.87e-47 159 41 3 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0AA38 7.77e-46 154 41 3 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Shigella flexneri
P0AA37 7.77e-46 154 41 3 213 1 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli (strain K12)
Q8FL93 8.56e-46 154 41 3 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XA10 3.24e-45 153 40 3 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Escherichia coli O157:H7
Q8Z9J5 3.27e-45 153 41 3 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhi
Q9KP71 3.42e-45 154 39 2 216 3 rluA Dual-specificity RNA pseudouridine synthase RluA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8ZRV9 4.57e-45 152 41 3 213 3 rluA Dual-specificity RNA pseudouridine synthase RluA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P59831 5.73e-44 150 41 4 217 3 rluA Dual-specificity RNA pseudouridine synthase RluA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8D8G1 7.64e-38 137 38 7 216 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
Q9KQH0 1.84e-35 130 35 7 219 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87AR7 3.04e-34 128 38 8 230 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PET9 5.48e-34 127 37 8 230 3 rluD Ribosomal large subunit pseudouridine synthase D Xylella fastidiosa (strain 9a5c)
P54604 1.58e-33 125 32 4 221 3 yhcT Uncharacterized RNA pseudouridine synthase YhcT Bacillus subtilis (strain 168)
Q82WZ5 1.73e-33 126 35 5 225 3 rluD Ribosomal large subunit pseudouridine synthase D Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8P682 3.02e-33 125 37 8 230 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q87N15 3.27e-33 125 33 6 216 3 rluC Ribosomal large subunit pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CKA6 8.46e-33 124 33 5 227 3 rluD Ribosomal large subunit pseudouridine synthase D Pasteurella multocida (strain Pm70)
Q8PHN2 2.32e-32 123 36 7 230 3 rluD Ribosomal large subunit pseudouridine synthase D Xanthomonas axonopodis pv. citri (strain 306)
Q8ZQ16 3.07e-32 122 37 8 221 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33640 6.83e-32 121 33 6 231 3 rluD Ribosomal large subunit pseudouridine synthase D Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8Z7J7 6.84e-32 121 37 8 221 3 rluC Ribosomal large subunit pseudouridine synthase C Salmonella typhi
Q8X8J3 7.84e-32 121 37 8 221 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O157:H7
P0AA40 8.01e-32 121 37 8 221 3 rluC Ribosomal large subunit pseudouridine synthase C Shigella flexneri
P0AA39 8.01e-32 121 37 8 221 1 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli (strain K12)
Q8FIP7 1.49e-31 120 37 8 221 3 rluC Ribosomal large subunit pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9KU20 6.35e-31 119 33 6 227 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8XYX8 6.77e-31 119 35 7 223 3 rluD Ribosomal large subunit pseudouridine synthase D Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P57430 4.24e-30 116 33 6 220 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P70870 5.36e-30 116 35 5 210 3 rluD Ribosomal large subunit pseudouridine synthase D Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P65835 5.65e-30 116 32 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Shigella flexneri
P65834 5.65e-30 116 32 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X9F0 6.27e-30 116 32 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli O157:H7
P59835 6.7e-30 116 35 6 217 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P33643 8.23e-30 116 32 6 230 1 rluD Ribosomal large subunit pseudouridine synthase D Escherichia coli (strain K12)
Q9CM51 8.23e-30 116 34 7 233 3 rluC Ribosomal large subunit pseudouridine synthase C Pasteurella multocida (strain Pm70)
P65836 9.42e-30 116 33 6 230 1 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65837 9.42e-30 116 33 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Salmonella typhi
P44445 2.19e-29 115 31 6 227 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P59838 3.39e-29 114 32 8 233 3 rluD Ribosomal large subunit pseudouridine synthase D Blochmanniella floridana
Q8ZFU1 3.54e-29 114 36 7 218 3 rluC Ribosomal large subunit pseudouridine synthase C Yersinia pestis
Q9L7A7 4.68e-29 114 31 7 227 3 rluD Ribosomal large subunit pseudouridine synthase D Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8FEF9 5.36e-29 112 35 7 221 3 truC tRNA pseudouridine synthase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8K9J8 7.32e-29 113 34 5 217 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8DEV0 9.61e-29 113 30 5 230 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio vulnificus (strain CMCP6)
Q87S65 2.1e-28 112 30 6 230 3 rluD Ribosomal large subunit pseudouridine synthase D Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O31613 2.15e-28 111 33 6 222 3 yjbO Uncharacterized RNA pseudouridine synthase YjbO Bacillus subtilis (strain 168)
P0AA42 2.28e-28 110 35 7 221 3 truC tRNA pseudouridine synthase C Shigella flexneri
P0AA41 2.28e-28 110 35 7 221 1 truC tRNA pseudouridine synthase C Escherichia coli (strain K12)
Q8X6T6 2.56e-28 110 35 7 221 3 truC tRNA pseudouridine synthase C Escherichia coli O157:H7
P44433 7.81e-28 110 35 6 208 3 rluC Ribosomal large subunit pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K9E9 8.86e-28 110 32 7 222 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O67638 1.05e-27 110 33 5 228 3 aq_1758 Uncharacterized RNA pseudouridine synthase aq_1758 Aquifex aeolicus (strain VF5)
Q47417 1.18e-27 111 36 7 220 3 truC tRNA pseudouridine synthase C Pectobacterium carotovorum subsp. carotovorum
Q45480 2.89e-27 108 31 6 230 3 ylyB Uncharacterized RNA pseudouridine synthase YlyB Bacillus subtilis (strain 168)
P59840 1.44e-26 105 35 10 232 3 truC tRNA pseudouridine synthase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q45826 1.58e-26 107 34 8 223 3 Caur_0901 Uncharacterized RNA pseudouridine synthase Caur_0901 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q8ZBV7 1.66e-26 107 31 8 235 3 rluD Ribosomal large subunit pseudouridine synthase D Yersinia pestis
O25441 1.9e-26 107 34 7 224 3 HP_0745 Uncharacterized RNA pseudouridine synthase HP_0745 Helicobacter pylori (strain ATCC 700392 / 26695)
O50310 8.26e-26 105 32 8 249 3 Cpar_0723 Uncharacterized RNA pseudouridine synthase Cpar_0723 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
P0A5T3 1.26e-25 104 33 7 226 3 BQ2027_MB1567 Uncharacterized RNA pseudouridine synthase Mb1567 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WHQ3 1.26e-25 104 33 7 226 1 Rv1540 Uncharacterized RNA pseudouridine synthase Rv1540 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ2 1.26e-25 104 33 7 226 3 MT1592 Uncharacterized RNA pseudouridine synthase MT1592 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8ZH72 1.59e-25 103 33 7 220 3 truC tRNA pseudouridine synthase C Yersinia pestis
Q9ZL98 1.89e-25 104 34 8 224 3 jhp_0682 Uncharacterized RNA pseudouridine synthase jhp_0682 Helicobacter pylori (strain J99 / ATCC 700824)
Q8ZMD5 2.6e-25 102 34 7 220 3 truC tRNA pseudouridine synthase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9UJJ7 4.54e-25 103 33 9 240 1 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Homo sapiens
Q9ZDR7 5.11e-25 103 31 4 215 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia prowazekii (strain Madrid E)
Q68XB2 5.97e-25 102 31 4 215 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8Z439 6.9e-25 101 34 7 220 3 truC tRNA pseudouridine synthase C Salmonella typhi
P50513 7.3e-25 102 33 10 234 3 rluD Ribosomal large subunit pseudouridine synthase D Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q9KTL4 1.05e-24 100 30 8 227 3 truC tRNA pseudouridine synthase C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CNF3 1.09e-24 100 34 10 237 3 truC tRNA pseudouridine synthase C Pasteurella multocida (strain Pm70)
Q17QT4 1.62e-24 101 35 9 240 2 RPUSD1 RNA pseudouridylate synthase domain-containing protein 1 Bos taurus
Q1RJX7 1.68e-24 101 33 6 220 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia bellii (strain RML369-C)
Q9JVB6 1.79e-24 102 30 5 228 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q92IS6 2.6e-24 101 32 4 215 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q08C69 2.68e-24 100 34 10 240 2 rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Danio rerio
Q4UKQ3 2.72e-24 101 31 4 215 3 rluC Ribosomal large subunit pseudouridine synthase C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q89AH2 4.73e-24 100 30 5 217 3 rluC Ribosomal large subunit pseudouridine synthase C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P47451 4.89e-24 100 33 7 224 3 MG209 Uncharacterized RNA pseudouridine synthase MG209 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8VCZ8 5.47e-24 100 33 8 239 2 Rpusd1 RNA pseudouridylate synthase domain-containing protein 1 Mus musculus
Q9K0B0 1.04e-23 100 30 5 228 3 rluD Ribosomal large subunit pseudouridine synthase D Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8DBG5 2.04e-23 97 29 6 226 3 truC tRNA pseudouridine synthase C Vibrio vulnificus (strain CMCP6)
P75485 2.11e-23 99 32 5 213 3 MPN_292 Uncharacterized RNA pseudouridine synthase MG209 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q5Z8P2 2.6e-23 100 29 8 283 2 Os06g0717400 RNA pseudouridine synthase 2, chloroplastic Oryza sativa subsp. japonica
P74346 3.09e-23 98 30 6 227 3 slr1629 Uncharacterized RNA pseudouridine synthase slr1629 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P44197 3.76e-23 96 32 7 224 3 truC tRNA pseudouridine synthase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q89AD9 6.67e-23 97 30 6 224 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O66114 1.72e-22 94 32 9 217 3 ZMO0505 Uncharacterized RNA pseudouridine synthase ZMO0505 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q9HZM9 1.79e-22 96 33 6 207 3 rluC Ribosomal large subunit pseudouridine synthase C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87MD4 2.21e-22 94 28 8 226 3 truC tRNA pseudouridine synthase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P57481 6.63e-22 94 29 6 232 3 rluD Ribosomal large subunit pseudouridine synthase D Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q3ECD0 1.08e-19 90 32 4 194 2 At1g76050 RNA pseudouridine synthase 2, chloroplastic Arabidopsis thaliana
P43930 1.47e-18 84 27 6 236 3 HI_0042 Uncharacterized RNA pseudouridine synthase HI_0042 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9ZKP5 5.23e-16 77 29 7 201 3 jhp_0890 Uncharacterized RNA pseudouridine synthase jhp_0890 Helicobacter pylori (strain J99 / ATCC 700824)
Q2QNM3 5.85e-16 79 28 10 251 2 Os12g0560500 RNA pseudouridine synthase 1 Oryza sativa subsp. japonica
P72970 5.97e-16 78 28 7 234 3 slr1592 Uncharacterized RNA pseudouridine synthase slr1592 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5M721 8.19e-16 78 30 5 212 2 At3g52260 RNA pseudouridine synthase 5 Arabidopsis thaliana
O25610 1.17e-14 73 29 6 199 3 HP_0956 Uncharacterized RNA pseudouridine synthase HP_0956 Helicobacter pylori (strain ATCC 700392 / 26695)
Q7XA65 1.25e-14 75 27 7 248 2 At1g56345 RNA pseudouridine synthase 1 Arabidopsis thaliana
Q0DST9 2.99e-13 71 28 5 213 2 Os03g0288500 RNA pseudouridine synthase 5 Oryza sativa subsp. japonica
Q9ZMA1 1.03e-12 69 32 5 162 3 jhp_0321 Uncharacterized RNA pseudouridine synthase jhp_0321 Helicobacter pylori (strain J99 / ATCC 700824)
O16686 1.34e-12 69 33 5 145 3 K07E8.7 Uncharacterized protein K07E8.7 Caenorhabditis elegans
Q12069 1.48e-12 69 27 5 193 1 PUS9 tRNA pseudouridine(32) synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5E9Z1 2.76e-12 68 31 9 231 2 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Bos taurus
O25114 6.79e-12 67 32 5 162 1 HP_0347 Uncharacterized RNA pseudouridine synthase HP_0347 Helicobacter pylori (strain ATCC 700392 / 26695)
Q96CM3 3.03e-11 65 33 8 196 1 RPUSD4 Pseudouridylate synthase RPUSD4, mitochondrial Homo sapiens
Q8IZ73 4.18e-11 65 27 5 190 1 RPUSD2 Pseudouridylate synthase RPUSD2 Homo sapiens
Q149F1 5.73e-11 65 28 6 188 1 Rpusd2 Pseudouridylate synthase RPUSD2 Mus musculus
Q9LT72 2.31e-10 63 29 8 196 2 At3g19440 RNA pseudouridine synthase 4, mitochondrial Arabidopsis thaliana
Q9LU60 2.61e-10 62 27 6 216 2 At5g51140 RNA pseudouridine synthase 7 Arabidopsis thaliana
Q4QQT0 3.96e-10 62 33 9 198 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Rattus norvegicus
Q0E0Y3 9.62e-10 61 33 6 146 2 Os02g0512300 RNA pseudouridine synthase 7 Oryza sativa subsp. japonica
Q9CWX4 1.52e-09 60 30 7 198 2 Rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Mus musculus
Q12362 1.53e-09 60 27 6 202 1 RIB2 Bifunctional protein RIB2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q69K07 1.58e-09 60 29 6 187 2 Os09g0103500 RNA pseudouridine synthase 4, mitochondrial Oryza sativa subsp. japonica
Q28C59 3.18e-09 59 27 8 201 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Xenopus tropicalis
Q0J4D4 4.23e-09 59 26 9 224 2 Os08g0520100 RNA pseudouridine synthase 3, mitochondrial Oryza sativa subsp. japonica
Q5XET6 1.04e-08 58 29 11 220 2 At1g78910 RNA pseudouridine synthase 3, mitochondrial Arabidopsis thaliana
Q09709 2.18e-08 57 28 10 197 3 SPAC18B11.02c Pseudouridylate synthase C18B11.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P47610 2.91e-08 56 25 11 220 3 MG370 Uncharacterized RNA pseudouridine synthase MG370 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P53294 3.42e-08 56 30 12 197 1 PUS6 tRNA pseudouridine(31) synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8I3Z1 5.08e-05 47 33 1 84 1 PFE0570w MATH and LRR domain-containing protein PFE0570w Plasmodium falciparum (isolate 3D7)
Q6DBR0 7.3e-05 46 26 7 200 2 rpusd4 Pseudouridylate synthase RPUSD4, mitochondrial Danio rerio
Q5A0Y2 0.000137 45 24 6 202 3 PUS5 21S rRNA pseudouridine(2819) synthase Candida albicans (strain SC5314 / ATCC MYA-2876)
P75230 0.000455 44 23 7 221 3 MPN_548 Uncharacterized RNA pseudouridine synthase MG370 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14760
Feature type CDS
Gene -
Product RluA family pseudouridine synthase
Location 3274566 - 3275264 (strand: 1)
Length 699 (nucleotides) / 232 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1090
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00849 RNA pseudouridylate synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0564 Translation, ribosomal structure and biogenesis (J) J Pseudouridine synthase RluA, 23S rRNA- or tRNA-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06177 tRNA pseudouridine32 synthase / 23S rRNA pseudouridine746 synthase [EC:5.4.99.28 5.4.99.29] - -

Protein Sequence

MSTIIDTFIAPTCHDKIEYLYQDEHLLVINKPSGLLSLSGKNPQNIDSVHYRLVPLFPECTLVHRLDFGTSGVMVIALNKAINRALCQQFSQRTVTKAYDALLCGHLQNDSGVIEAPIAKDPQHFPRMSISTTQGKAARSYYQVIERFYQTLADGTRLPLTRVRLTPETGRTHQLRIHCQYIGHPILGCDLYGGLLLSGTEHTPRLMLHACELHFIHPVSEQPMDIYLPSPF

Flanking regions ( +/- flanking 50bp)

CGGCTGAAATTTAGCTATGATCAGTGCACTTTTGTGATCAGGATAATTTGATGTCGACGATTATTGATACCTTTATTGCCCCCACTTGCCATGACAAGATTGAGTATCTTTATCAAGATGAACATCTACTGGTAATAAACAAACCTTCAGGTTTACTAAGCCTTTCAGGTAAAAACCCGCAAAATATCGATTCTGTTCATTATCGCTTAGTACCATTGTTTCCCGAGTGCACATTAGTTCATCGTTTAGACTTTGGCACATCGGGGGTGATGGTTATTGCCCTGAATAAAGCGATTAACCGTGCACTTTGTCAACAATTTAGCCAGCGAACCGTCACTAAAGCTTATGACGCCCTATTATGTGGCCATTTGCAAAATGATAGTGGTGTTATAGAAGCGCCTATCGCGAAAGATCCACAACACTTTCCACGTATGTCGATTAGCACCACACAAGGCAAAGCTGCGCGCTCTTACTATCAAGTTATCGAACGGTTTTATCAGACTCTTGCTGATGGCACTCGCTTACCTTTAACGCGCGTACGACTCACGCCGGAAACAGGCAGAACACATCAATTGCGTATCCATTGCCAATATATAGGGCACCCTATTTTAGGGTGTGATTTGTATGGTGGCCTATTATTATCAGGAACAGAGCATACCCCACGGCTAATGTTGCATGCCTGTGAGTTACATTTTATTCACCCTGTTAGTGAGCAACCGATGGATATTTATCTACCTTCGCCGTTTTAATATCAAGCCACCCTTAAAATCACCACATTAAATCGTCTGGCACTTTAAAA