Homologs in group_2023

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15180 FBDBKF_15180 88.0 Morganella morganii S1 dinB DNA polymerase IV
EHELCC_11065 EHELCC_11065 88.0 Morganella morganii S2 dinB DNA polymerase IV
NLDBIP_11410 NLDBIP_11410 88.0 Morganella morganii S4 dinB DNA polymerase IV
LHKJJB_11270 LHKJJB_11270 88.0 Morganella morganii S3 dinB DNA polymerase IV
HKOGLL_09880 HKOGLL_09880 88.0 Morganella morganii S5 dinB DNA polymerase IV
PMI_RS01735 PMI_RS01735 70.1 Proteus mirabilis HI4320 dinB DNA polymerase IV

Distribution of the homologs in the orthogroup group_2023

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2023

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6D1H8 0.0 532 71 2 352 3 dinB DNA polymerase IV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MEN4 0.0 521 71 2 352 3 dinB DNA polymerase IV Cronobacter sakazakii (strain ATCC BAA-894)
Q7N7B6 0.0 517 71 2 352 3 dinB DNA polymerase IV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JNY3 0.0 513 70 0 351 3 dinB DNA polymerase IV Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1RFU0 0.0 508 69 2 352 3 dinB DNA polymerase IV Escherichia coli (strain UTI89 / UPEC)
Q0TL85 0.0 508 69 2 352 3 dinB DNA polymerase IV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7U2 0.0 508 69 2 352 3 dinB DNA polymerase IV Escherichia coli O1:K1 / APEC
A7ZHZ2 0.0 508 69 2 352 3 dinB DNA polymerase IV Escherichia coli O139:H28 (strain E24377A / ETEC)
A7ZWJ6 0.0 508 69 2 352 3 dinB DNA polymerase IV Escherichia coli O9:H4 (strain HS)
Q8X7Q1 0.0 507 69 2 352 3 dinB DNA polymerase IV Escherichia coli O157:H7
Q83M86 1.06e-180 507 69 2 352 3 dinB DNA polymerase IV Shigella flexneri
Q3Z5A4 1.23e-180 507 69 2 352 3 dinB DNA polymerase IV Shigella sonnei (strain Ss046)
Q47155 1.23e-180 507 69 2 352 1 dinB DNA polymerase IV Escherichia coli (strain K12)
B1J100 1.23e-180 507 69 2 352 3 dinB DNA polymerase IV Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8AKQ2 1.24e-180 507 69 0 351 3 dinB DNA polymerase IV Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P59477 1.74e-180 506 69 2 352 3 dinB DNA polymerase IV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A4W6W8 2.53e-180 506 69 3 353 3 dinB DNA polymerase IV Enterobacter sp. (strain 638)
Q32J17 2.91e-180 506 69 2 352 3 dinB DNA polymerase IV Shigella dysenteriae serotype 1 (strain Sd197)
B2U3S3 3.68e-179 503 69 2 350 3 dinB DNA polymerase IV Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q57SU1 4.59e-179 503 69 2 352 3 dinB DNA polymerase IV Salmonella choleraesuis (strain SC-B67)
Q5PF76 1.08e-178 502 69 2 352 3 dinB DNA polymerase IV Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P63989 5.05e-178 500 69 2 352 3 dinB DNA polymerase IV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63990 5.05e-178 500 69 2 352 3 dinB DNA polymerase IV Salmonella typhi
A9MY13 5.05e-178 500 69 2 352 3 dinB DNA polymerase IV Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A8GAC8 6.1e-177 497 70 1 352 3 dinB DNA polymerase IV Serratia proteamaculans (strain 568)
A9MNS1 5.16e-175 493 68 2 352 3 dinB DNA polymerase IV Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q66DZ7 1.13e-170 481 68 0 351 3 dinB DNA polymerase IV Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FLI9 1.13e-170 481 68 0 351 3 dinB DNA polymerase IV Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPK8 7.76e-170 479 68 0 351 3 dinB DNA polymerase IV Yersinia pestis (strain Pestoides F)
Q1CLD4 7.76e-170 479 68 0 351 3 dinB DNA polymerase IV Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZBZ9 7.76e-170 479 68 0 351 3 dinB DNA polymerase IV Yersinia pestis
Q1C4D9 7.76e-170 479 68 0 351 3 dinB DNA polymerase IV Yersinia pestis bv. Antiqua (strain Antiqua)
P58963 1.01e-165 468 68 2 332 3 dinB DNA polymerase IV (Fragment) Escherichia fergusonii
Q7MID6 2.66e-146 420 58 3 357 3 dinB DNA polymerase IV Vibrio vulnificus (strain YJ016)
Q8DBI7 2.66e-146 420 58 3 357 3 dinB DNA polymerase IV Vibrio vulnificus (strain CMCP6)
Q15YP8 1.12e-145 418 60 1 351 3 dinB DNA polymerase IV Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q87MB4 3.22e-145 417 58 3 351 3 dinB DNA polymerase IV Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LQ59 2.47e-142 410 57 2 350 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain M66-2)
Q9KPS5 2.47e-142 410 57 2 350 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8EHU9 8.26e-142 409 60 2 343 3 dinB DNA polymerase IV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A5F5Y1 8.96e-142 409 57 2 350 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q086K1 1.36e-141 408 59 1 340 3 dinB DNA polymerase IV Shewanella frigidimarina (strain NCIMB 400)
B0TQD1 1.15e-140 405 59 3 339 3 dinB DNA polymerase IV Shewanella halifaxensis (strain HAW-EB4)
A6WRW5 2.5e-140 405 59 2 343 3 dinB DNA polymerase IV Shewanella baltica (strain OS185)
A3D147 2.85e-140 405 59 2 343 3 dinB DNA polymerase IV Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9L0T3 3.43e-140 404 59 2 343 3 dinB DNA polymerase IV Shewanella baltica (strain OS195)
Q0HLP0 5.26e-140 404 60 2 345 3 dinB DNA polymerase IV Shewanella sp. (strain MR-4)
A0KTR5 1.25e-139 403 60 2 345 3 dinB DNA polymerase IV Shewanella sp. (strain ANA-3)
A3QGY9 8.9e-139 401 58 2 346 3 dinB DNA polymerase IV Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0HY21 1.05e-138 400 59 2 345 3 dinB DNA polymerase IV Shewanella sp. (strain MR-7)
B1KD33 2.22e-138 400 56 4 363 3 dinB DNA polymerase IV Shewanella woodyi (strain ATCC 51908 / MS32)
A8H771 3.68e-138 399 57 5 360 3 dinB DNA polymerase IV Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q12Q05 1.77e-137 397 59 3 347 3 dinB DNA polymerase IV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A8FYV3 2.9e-137 397 58 2 341 3 dinB DNA polymerase IV Shewanella sediminis (strain HAW-EB3)
A1RMZ5 8.17e-137 396 58 2 343 3 dinB DNA polymerase IV Shewanella sp. (strain W3-18-1)
A1S8M3 2.43e-135 392 58 2 341 3 dinB DNA polymerase IV Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q65TG8 3.4e-135 392 55 2 352 3 dinB DNA polymerase IV Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CNG4 3.97e-133 386 57 4 343 3 dinB DNA polymerase IV Pasteurella multocida (strain Pm70)
B8F542 9.83e-127 370 52 2 351 3 dinB DNA polymerase IV Glaesserella parasuis serovar 5 (strain SH0165)
B0BPX9 6.08e-126 368 53 2 351 3 dinB DNA polymerase IV Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N148 8.41e-124 363 53 2 351 3 dinB DNA polymerase IV Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A0KHD5 1.11e-119 352 55 2 351 3 dinB DNA polymerase IV Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q487H6 2.33e-117 346 52 5 353 3 dinB DNA polymerase IV Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4XT24 4.31e-113 335 51 1 339 3 dinB DNA polymerase IV Pseudomonas mendocina (strain ymp)
Q3KH18 2.55e-112 333 51 2 341 3 dinB DNA polymerase IV Pseudomonas fluorescens (strain Pf0-1)
Q9I534 2.2e-111 331 53 1 342 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02I83 2.2e-111 331 53 1 342 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain UCBPP-PA14)
A6VA50 2.53e-111 331 53 1 342 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain PA7)
Q88NK4 1.22e-110 329 50 1 340 3 dinB DNA polymerase IV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87Y22 1.3e-110 329 51 1 339 3 dinB DNA polymerase IV Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A5IH02 2.26e-110 328 51 2 340 3 dinB DNA polymerase IV Legionella pneumophila (strain Corby)
Q4ZWM4 2.58e-110 328 51 2 341 3 dinB DNA polymerase IV Pseudomonas syringae pv. syringae (strain B728a)
B0KTK6 5.11e-110 328 50 1 340 3 dinB DNA polymerase IV Pseudomonas putida (strain GB-1)
Q48FB2 7.17e-110 327 51 2 341 3 dinB DNA polymerase IV Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5X7J1 2.02e-109 326 51 2 340 3 dinB DNA polymerase IV Legionella pneumophila (strain Paris)
Q1I6D5 2.13e-109 326 50 1 340 3 dinB DNA polymerase IV Pseudomonas entomophila (strain L48)
Q5ZY20 3.18e-109 326 51 2 340 3 dinB DNA polymerase IV Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5VZT3 7.36e-109 325 50 1 340 3 dinB DNA polymerase IV Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q5WYY8 1.32e-108 324 51 2 340 3 dinB DNA polymerase IV Legionella pneumophila (strain Lens)
Q8XZ19 4.1e-106 318 50 1 340 3 dinB DNA polymerase IV Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A6W1V6 6.13e-106 317 48 3 351 3 dinB DNA polymerase IV Marinomonas sp. (strain MWYL1)
Q3II35 7.62e-106 317 49 5 350 3 dinB DNA polymerase IV Pseudoalteromonas translucida (strain TAC 125)
B0TZS5 4.7e-100 302 45 5 352 3 dinB DNA polymerase IV Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q2A3L2 1.79e-98 298 45 4 340 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain LVS)
A7NC07 1.79e-98 298 45 4 340 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q0BM23 2.86e-98 297 45 4 340 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain OSU18)
A0Q6K9 7.28e-98 296 44 4 351 3 dinB DNA polymerase IV Francisella tularensis subsp. novicida (strain U112)
B2SH34 1.15e-97 296 45 4 340 3 dinB DNA polymerase IV Francisella tularensis subsp. mediasiatica (strain FSC147)
Q6MA55 3.83e-94 287 50 0 304 3 dinB DNA polymerase IV Protochlamydia amoebophila (strain UWE25)
A1KUQ3 1.97e-90 278 43 5 349 3 dinB DNA polymerase IV Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A1U339 8.24e-90 276 48 1 339 3 dinB DNA polymerase IV Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9JRG1 1.53e-89 275 43 5 349 3 dinB DNA polymerase IV Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JYS8 1.09e-88 272 46 3 303 3 dinB DNA polymerase IV Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A0AK80 1.62e-88 273 43 3 343 3 dinB DNA polymerase IV Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q71Y46 8.3e-88 271 43 3 343 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4b (strain F2365)
C1KWR9 1.01e-87 271 43 3 343 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4b (strain CLIP80459)
Q5F8N2 1.07e-87 271 42 5 350 3 dinB DNA polymerase IV Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8Y5T0 1.38e-87 270 43 3 343 3 dinB DNA polymerase IV Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92A40 1.38e-87 270 43 3 343 3 dinB DNA polymerase IV Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DBV7 3.66e-87 269 43 3 343 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4a (strain HCC23)
Q92XH8 1.39e-86 268 42 6 361 3 dinB2 DNA polymerase IV 2 Rhizobium meliloti (strain 1021)
Q5FSM8 2.03e-86 268 44 5 340 3 dinB DNA polymerase IV Gluconobacter oxydans (strain 621H)
Q18A91 5.06e-86 267 43 5 343 3 dinB DNA polymerase IV Clostridioides difficile (strain 630)
Q0TQ38 6.09e-86 266 43 6 346 3 dinB DNA polymerase IV Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q6AL48 9.37e-85 264 47 2 301 3 dinB DNA polymerase IV Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q64X95 2.52e-84 262 45 8 350 3 dinB DNA polymerase IV Bacteroides fragilis (strain YCH46)
Q6FFG4 4.31e-84 261 46 4 300 3 dinB DNA polymerase IV Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A8AUV7 8.22e-83 258 42 4 342 3 dinB DNA polymerase IV Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B2UKN1 9.16e-83 258 43 7 357 3 dinB DNA polymerase IV Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q8DVR7 1.76e-82 258 40 6 359 3 dinB DNA polymerase IV Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A3CKU4 9.07e-82 255 42 4 342 3 dinB DNA polymerase IV Streptococcus sanguinis (strain SK36)
B4SIF5 1.97e-81 254 49 1 263 3 dinB DNA polymerase IV Stenotrophomonas maltophilia (strain R551-3)
Q8PCW8 3.47e-81 254 43 8 356 3 dinB DNA polymerase IV Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQI2 3.47e-81 254 43 8 356 3 dinB DNA polymerase IV Xanthomonas campestris pv. campestris (strain 8004)
B2FLR2 3.65e-81 254 49 1 263 3 dinB DNA polymerase IV Stenotrophomonas maltophilia (strain K279a)
Q5LYC2 5.96e-81 254 40 6 362 3 dinB DNA polymerase IV Streptococcus thermophilus (strain CNRZ 1066)
A4VZ21 1.32e-80 253 42 4 343 3 dinB DNA polymerase IV Streptococcus suis (strain 98HAH33)
Q5M2Y5 2.51e-80 252 40 6 362 3 dinB DNA polymerase IV Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q0SSQ2 3.47e-80 251 42 4 341 3 dinB DNA polymerase IV Clostridium perfringens (strain SM101 / Type A)
Q8DXW9 3.98e-80 251 38 5 350 3 dinB DNA polymerase IV Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E3I8 3.98e-80 251 38 5 350 3 dinB DNA polymerase IV Streptococcus agalactiae serotype III (strain NEM316)
Q3JZG9 3.98e-80 251 38 5 350 3 dinB DNA polymerase IV Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q03J54 6.42e-80 251 39 6 362 3 dinB DNA polymerase IV Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A1WY69 3.13e-79 249 42 5 353 3 dinB DNA polymerase IV Halorhodospira halophila (strain DSM 244 / SL1)
Q8PGJ4 5.16e-79 249 45 4 308 3 dinB DNA polymerase IV Xanthomonas axonopodis pv. citri (strain 306)
P0DA79 5.6e-79 249 40 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DA78 5.6e-79 249 40 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q99Y66 5.99e-79 249 40 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M1
Q3BP42 6.99e-79 248 45 4 308 3 dinB DNA polymerase IV Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B9DMT3 8.11e-79 248 39 4 354 3 dinB DNA polymerase IV Staphylococcus carnosus (strain TM300)
Q98NW7 1.06e-78 248 45 7 355 3 dinB3 DNA polymerase IV 3 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8UJK7 1.21e-78 248 44 6 344 3 dinB2 DNA polymerase IV 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0A4X2 1.38e-78 247 43 5 357 3 dinB DNA polymerase IV Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A2RCQ1 1.53e-78 248 40 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8NZI1 1.69e-78 248 40 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q8F8Q2 1.81e-78 247 38 4 355 3 dinB DNA polymerase IV Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72MY7 2.11e-78 247 38 4 355 3 dinB DNA polymerase IV Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q49YT9 5.14e-78 246 40 3 339 3 dinB DNA polymerase IV Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1JF59 5.19e-78 246 40 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M2 (strain MGAS10270)
P58964 9.11e-78 245 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain MW2)
Q6G838 9.11e-78 245 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain MSSA476)
A6QIC3 9.11e-78 245 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain Newman)
Q5HEM7 9.11e-78 245 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain COL)
A5IU61 9.51e-78 245 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain JH9)
A6U2Z9 9.51e-78 245 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain JH1)
Q8XK37 1.04e-77 245 50 0 248 3 dinB DNA polymerase IV Clostridium perfringens (strain 13 / Type A)
Q48RJ4 1.65e-77 245 40 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q5XA48 1.98e-77 244 40 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P63992 2.12e-77 244 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain N315)
P63991 2.12e-77 244 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X420 2.12e-77 244 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q97SC7 2.33e-77 244 41 5 341 3 dinB DNA polymerase IV Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q6GFG2 2.77e-77 244 38 3 351 3 dinB DNA polymerase IV Staphylococcus aureus (strain MRSA252)
Q02WA3 5.52e-77 243 41 5 343 3 dinB DNA polymerase IV Lactococcus lactis subsp. cremoris (strain SK11)
Q2P7M9 1.01e-76 243 45 3 301 3 dinB DNA polymerase IV Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A2RNH9 2.02e-76 242 41 5 343 3 dinB DNA polymerase IV Lactococcus lactis subsp. cremoris (strain MG1363)
Q8DQZ7 5.87e-76 241 40 4 340 3 dinB DNA polymerase IV Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04M21 5.87e-76 241 40 4 340 3 dinB DNA polymerase IV Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1JK63 6.68e-76 241 39 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JA16 6.68e-76 241 39 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q88V07 1.04e-75 241 46 1 263 3 dinB DNA polymerase IV Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q2YU32 1.08e-75 239 40 2 322 3 dinB DNA polymerase IV Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q1J509 2.05e-75 239 39 5 340 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q8CNP3 2.47e-75 239 38 3 339 3 dinB DNA polymerase IV Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN39 7.04e-75 238 38 3 339 3 dinB DNA polymerase IV Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L7K8 1.24e-74 237 40 2 315 3 dinB DNA polymerase IV Staphylococcus haemolyticus (strain JCSC1435)
B1YK83 1.11e-73 235 39 6 356 3 dinB DNA polymerase IV Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q9CE21 3.6e-73 234 44 5 307 3 dinB DNA polymerase IV Lactococcus lactis subsp. lactis (strain IL1403)
Q7USY7 6.22e-73 234 39 6 353 3 dinB DNA polymerase IV Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B8FBE8 7.21e-72 231 41 2 297 3 dinB DNA polymerase IV Desulfatibacillum aliphaticivorans
Q67QM6 1.71e-71 229 42 8 353 3 dinB DNA polymerase IV Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q3ABL2 4.54e-71 229 46 0 256 3 dinB DNA polymerase IV Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P58965 5.7e-67 218 38 6 352 1 dinB DNA polymerase IV Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7Z6F3 1.88e-63 210 35 5 338 3 dinB DNA polymerase IV Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q9A5I1 8.67e-61 203 37 5 334 3 dinB DNA polymerase IV Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3ZWB2 6.58e-60 200 35 5 341 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain CBDB1)
A5FSS1 1.16e-59 199 35 5 341 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
P54545 1.19e-59 200 35 5 338 3 dinB1 DNA polymerase IV 1 Bacillus subtilis (strain 168)
Q3ZAI3 2.81e-59 199 35 6 343 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A3CSG3 8.8e-59 196 36 5 353 3 dbh DNA polymerase IV Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q635E0 2.14e-57 194 32 6 341 3 dinB DNA polymerase IV Bacillus cereus (strain ZK / E33L)
Q81M86 3.65e-57 194 32 6 341 3 dinB DNA polymerase IV Bacillus anthracis
Q818U9 4.37e-57 194 32 6 341 3 dinB DNA polymerase IV Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q98LV1 1.67e-55 190 40 4 302 3 dinB1 DNA polymerase IV 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9KCU7 3.37e-55 189 33 6 340 3 dinB1 DNA polymerase IV 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q92QM8 2.37e-53 184 36 6 346 3 dinB1 DNA polymerase IV 1 Rhizobium meliloti (strain 1021)
Q8UFV3 4.1e-53 183 36 6 343 3 dinB1 DNA polymerase IV 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
A5N2U5 5.17e-53 182 33 7 355 3 dinB DNA polymerase IV Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q8YC76 9e-53 183 35 5 343 3 dinB DNA polymerase IV Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FW50 1.23e-52 183 35 5 343 3 dinB DNA polymerase IV Brucella suis biovar 1 (strain 1330)
Q8EQ56 1.48e-52 182 31 7 351 3 dinB DNA polymerase IV Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q73P36 7.16e-50 174 34 5 334 3 dinB DNA polymerase IV Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A3DH61 7.42e-49 172 31 4 343 3 dinB DNA polymerase IV Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
O74944 7.41e-48 172 34 11 336 1 mug40 DNA polymerase kappa Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8PT42 9.31e-48 168 30 4 353 3 dbh2 DNA polymerase IV 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9AK82 9.76e-48 171 35 6 344 3 dinB DNA polymerase IV Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A8MGJ5 1.12e-47 169 34 4 297 3 dinB DNA polymerase IV Alkaliphilus oremlandii (strain OhILAs)
A3EWL3 4.46e-47 174 38 3 246 2 REV1 DNA repair protein REV1 Arabidopsis thaliana
Q8TIW3 2.06e-46 164 32 9 357 3 dbh DNA polymerase IV Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8PYH6 2.41e-46 164 32 9 356 3 dbh1 DNA polymerase IV 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9HQT4 3.44e-46 165 32 5 350 3 dbh DNA polymerase IV Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4P0 3.44e-46 165 32 5 350 3 dbh DNA polymerase IV Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q6JDV7 1.35e-45 168 37 9 299 1 POLK DNA polymerase kappa Arabidopsis thaliana
B5ZBT4 1.46e-45 162 27 6 354 3 dinB DNA polymerase IV Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q9PQ53 2.32e-45 161 26 6 354 3 dinB DNA polymerase IV Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ79 2.32e-45 161 26 6 354 3 dinB DNA polymerase IV Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A9A3A9 2.47e-45 161 32 9 365 3 dbh DNA polymerase IV Nitrosopumilus maritimus (strain SCM1)
A5D243 2.98e-45 162 32 5 340 3 dinB DNA polymerase IV Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B1ZN03 3.27e-44 159 34 7 305 3 dinB DNA polymerase IV Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q2RJ46 6.14e-44 159 32 6 351 3 dinB DNA polymerase IV Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q98JM5 2.05e-43 157 34 5 303 3 dinB2 DNA polymerase IV 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6A763 8.66e-43 157 36 6 303 3 dinB DNA polymerase IV Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q5R4N7 2.48e-42 160 30 4 324 2 REV1 DNA repair protein REV1 Pongo abelii
Q6NGD8 3.58e-42 155 34 11 357 3 dinB DNA polymerase IV Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9UBZ9 6.31e-42 159 30 4 325 1 REV1 DNA repair protein REV1 Homo sapiens
Q9W0P2 1.53e-41 158 28 8 370 1 Rev1 DNA repair protein Rev1 Drosophila melanogaster
Q6R3M4 3.13e-40 153 31 8 318 1 Poli DNA polymerase iota Mus musculus
Q8REB0 2.08e-39 145 31 5 301 3 dinB DNA polymerase IV Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q4JB80 2.52e-39 145 34 3 215 1 dbh DNA polymerase IV Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P96022 2.52e-39 145 34 3 215 1 dbh DNA polymerase IV Saccharolobus solfataricus
Q920Q2 2.97e-39 151 29 4 325 1 Rev1 DNA repair protein REV1 Mus musculus
Q974T8 7.77e-39 144 33 1 203 3 dbh DNA polymerase IV Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q97W02 3.8e-38 142 29 7 301 1 dbh DNA polymerase IV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q4KWZ7 5.66e-38 147 36 2 236 2 REV1 DNA repair protein REV1 Gallus gallus
Q97MB3 3.87e-37 140 27 7 344 3 dinB DNA polymerase IV Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q6KZW2 1.25e-36 138 30 6 276 3 dbh DNA polymerase IV Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q9K9A8 1.43e-36 139 31 3 276 3 dinB2 DNA polymerase IV 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P54560 1.98e-36 139 29 7 348 3 dinB2 DNA polymerase IV 2 Bacillus subtilis (strain 168)
Q9UNA4 2.29e-35 140 29 7 312 1 POLI DNA polymerase iota Homo sapiens
A4YEC1 3.47e-35 134 33 1 203 3 dbh DNA polymerase IV Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
A4QFK8 1.03e-33 132 32 13 367 3 dinB DNA polymerase IV Corynebacterium glutamicum (strain R)
Q8NNP4 1.08e-33 132 32 13 367 3 dinB DNA polymerase IV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P34409 1.31e-33 134 29 16 409 3 polk-1 DNA polymerase kappa Caenorhabditis elegans
P9WNT3 4.24e-32 128 32 8 327 1 dinB1 DNA polymerase IV 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNT2 4.24e-32 128 32 8 327 3 dinB1 DNA polymerase IV 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63986 4.24e-32 128 32 8 327 3 dinB1 DNA polymerase IV 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O94623 1.1e-30 126 30 4 248 3 rev1 DNA repair protein rev1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9VHV1 2.17e-29 122 29 12 362 1 PolI DNA polymerase iota Drosophila melanogaster
P9WNT1 6.1e-28 115 28 6 309 3 dinB2 DNA polymerase IV 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNT0 6.1e-28 115 28 6 309 3 dinB2 DNA polymerase IV 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63988 6.1e-28 115 28 6 309 3 dinB2 DNA polymerase IV 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9QUG2 6.96e-26 112 47 1 110 1 Polk DNA polymerase kappa Mus musculus
Q9QUG2 2.12e-23 105 36 6 202 1 Polk DNA polymerase kappa Mus musculus
Q9UBT6 8.8e-26 112 43 3 132 1 POLK DNA polymerase kappa Homo sapiens
Q9UBT6 1.4e-22 102 33 11 261 1 POLK DNA polymerase kappa Homo sapiens
Q8H2D5 4.74e-24 106 27 12 350 1 POLH DNA polymerase eta Arabidopsis thaliana
P75241 2.33e-23 103 28 8 271 3 MPN_537 Uncharacterized protein MG360 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q49426 6.47e-22 99 27 6 277 3 MG360 Uncharacterized protein MG360 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9JJN0 2.05e-21 99 27 8 318 1 Polh DNA polymerase eta Mus musculus
O31990 2.11e-19 92 24 10 364 3 uvrX Putative UV-damage repair protein UvrX Bacillus subtilis (strain 168)
Q9Y253 7.87e-15 79 33 4 172 1 POLH DNA polymerase eta Homo sapiens
Q9Y253 1.83e-12 72 35 3 120 1 POLH DNA polymerase eta Homo sapiens
Q9VNX1 2.22e-13 74 33 3 122 1 PolH DNA polymerase eta Drosophila melanogaster
Q9VNX1 4.15e-12 70 31 3 159 1 PolH DNA polymerase eta Drosophila melanogaster
P12689 6.38e-13 73 29 8 206 1 REV1 DNA repair protein REV1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P18642 2.06e-12 71 24 5 217 3 impB Protein ImpB Salmonella typhimurium
O42917 7.1e-11 67 28 2 135 1 eso1 N-acetyltransferase eso1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P04152 6.43e-10 63 24 4 217 1 umuC Protein UmuC Escherichia coli (strain K12)
P14303 2.05e-09 62 23 9 262 3 mucB Protein MucB Salmonella typhimurium
P23832 2.13e-09 62 21 11 332 3 samB Protein SamB Salmonella typhimurium
P07375 2.22e-09 62 23 9 262 3 mucB Protein MucB Escherichia coli
P22494 1.02e-08 60 24 5 217 3 umuC Protein UmuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0SPA8 6.41e-08 56 27 3 158 5 yobH DNA repair protein homolog YobH Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12265
Feature type CDS
Gene dinB
Product DNA polymerase IV
Location 37187 - 38242 (strand: -1)
Length 1056 (nucleotides) / 351 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2023
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00817 impB/mucB/samB family
PF11799 impB/mucB/samB family C-terminal domain
PF21999 DNA polymerase-iota, thumb domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0389 Replication, recombination and repair (L) L Nucleotidyltransferase/DNA polymerase DinP involved in DNA repair

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02346 DNA polymerase IV [EC:2.7.7.7] - -

Protein Sequence

MRKIIHIDMDCFYAAIEMRDNPALRDVPLAIGGSSDRRGVIATANYPARRFGVHSAMSTAKALMLCPQLNVIPGRMSLYKTTSGQLHDIFSRYTSLIEPLSLDEAYLDVSDSLLHCGSATRMAEDIRRTIFSELGLTASAGVAPMKFLAKIASDLNKPDGQYIIPPEQVAGFVLSLPLRKIPGVGKVTAKRLADLGLETCRDVQRYDQISLIKQFGKFGQILWQRCHGIDERPVCPDRERKSVGVERTLAQDIASWDECRAIVDELFPELERRLTKVSPDLRIARQGVKLKFSDFQQTTQEHVYPVLDKQDLLKTAELAWGSRREGRGVRLVGLHVALRDPQVERQLVLGF

Flanking regions ( +/- flanking 50bp)

TAATATTACTGTATATTTAAACAGTGTCATTATTATTCAGGAGAGAGCGGGTGCGTAAAATCATTCATATTGATATGGATTGCTTTTATGCGGCAATTGAAATGCGCGATAACCCCGCGCTGCGTGACGTCCCGCTGGCTATCGGTGGCAGCTCTGACCGGCGCGGCGTGATTGCTACCGCCAACTATCCGGCGCGGCGCTTCGGGGTACACAGCGCTATGTCAACGGCGAAAGCCCTGATGTTATGTCCGCAGCTGAATGTTATCCCGGGGCGTATGTCTTTGTATAAAACGACCTCGGGGCAACTGCACGATATTTTTTCCCGTTATACTTCTCTGATTGAACCCCTTTCACTCGATGAGGCCTATCTTGATGTCTCTGACAGCCTGCTGCATTGCGGCTCGGCAACACGTATGGCTGAAGATATCCGCCGGACGATTTTCAGTGAACTGGGTCTGACCGCGTCCGCGGGTGTCGCGCCCATGAAATTTTTGGCGAAAATCGCGTCTGACCTGAATAAACCGGACGGGCAGTATATTATTCCCCCGGAGCAGGTCGCCGGTTTTGTATTGTCATTGCCGCTGCGTAAAATTCCCGGCGTGGGGAAAGTGACGGCAAAACGCCTTGCTGATCTGGGTCTGGAGACCTGCCGGGATGTTCAGCGTTATGATCAGATAAGCCTGATTAAGCAGTTCGGTAAATTCGGGCAGATCCTCTGGCAGCGCTGCCACGGCATTGATGAACGACCGGTCTGTCCGGACCGGGAGCGTAAATCTGTTGGTGTGGAGCGGACGCTGGCGCAGGATATTGCCTCGTGGGATGAGTGCAGGGCTATTGTAGATGAGCTGTTTCCTGAACTGGAGCGACGTCTGACCAAGGTTTCACCTGACCTGCGCATTGCCCGTCAGGGTGTCAAACTCAAGTTTTCTGATTTTCAGCAGACGACGCAGGAGCATGTTTATCCGGTGCTGGATAAACAGGATTTACTGAAAACAGCAGAACTCGCATGGGGAAGCCGCCGGGAAGGGCGCGGTGTTCGTCTGGTGGGGTTGCATGTGGCGCTGCGGGATCCACAGGTTGAGCGTCAGCTGGTTTTGGGATTCTGAGCGCAATAAAAAACCGGCGGGATTTGCATCACCGCCGGTTAACTGAATAG