Homologs in group_2023

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15180 FBDBKF_15180 100.0 Morganella morganii S1 dinB DNA polymerase IV
EHELCC_11065 EHELCC_11065 100.0 Morganella morganii S2 dinB DNA polymerase IV
NLDBIP_11410 NLDBIP_11410 100.0 Morganella morganii S4 dinB DNA polymerase IV
HKOGLL_09880 HKOGLL_09880 100.0 Morganella morganii S5 dinB DNA polymerase IV
F4V73_RS12265 F4V73_RS12265 88.0 Morganella psychrotolerans dinB DNA polymerase IV
PMI_RS01735 PMI_RS01735 71.8 Proteus mirabilis HI4320 dinB DNA polymerase IV

Distribution of the homologs in the orthogroup group_2023

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2023

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6D1H8 0.0 538 71 0 351 3 dinB DNA polymerase IV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JNY3 0.0 535 73 0 351 3 dinB DNA polymerase IV Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7MEN4 0.0 528 71 0 351 3 dinB DNA polymerase IV Cronobacter sakazakii (strain ATCC BAA-894)
Q7N7B6 0.0 525 72 0 351 3 dinB DNA polymerase IV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8AKQ2 0.0 521 71 0 351 3 dinB DNA polymerase IV Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P63989 0.0 518 71 0 351 3 dinB DNA polymerase IV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63990 0.0 518 71 0 351 3 dinB DNA polymerase IV Salmonella typhi
A9MY13 0.0 518 71 0 351 3 dinB DNA polymerase IV Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q1RFU0 0.0 517 70 0 351 3 dinB DNA polymerase IV Escherichia coli (strain UTI89 / UPEC)
Q0TL85 0.0 517 70 0 351 3 dinB DNA polymerase IV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7U2 0.0 517 70 0 351 3 dinB DNA polymerase IV Escherichia coli O1:K1 / APEC
A7ZHZ2 0.0 517 70 0 351 3 dinB DNA polymerase IV Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83M86 0.0 517 70 0 351 3 dinB DNA polymerase IV Shigella flexneri
A7ZWJ6 0.0 517 70 0 351 3 dinB DNA polymerase IV Escherichia coli O9:H4 (strain HS)
Q8X7Q1 0.0 517 70 0 351 3 dinB DNA polymerase IV Escherichia coli O157:H7
Q3Z5A4 0.0 516 70 0 351 3 dinB DNA polymerase IV Shigella sonnei (strain Ss046)
Q47155 0.0 516 70 0 351 1 dinB DNA polymerase IV Escherichia coli (strain K12)
B1J100 0.0 516 70 0 351 3 dinB DNA polymerase IV Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P59477 0.0 516 70 0 351 3 dinB DNA polymerase IV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32J17 0.0 516 70 0 351 3 dinB DNA polymerase IV Shigella dysenteriae serotype 1 (strain Sd197)
Q5PF76 0.0 514 70 0 351 3 dinB DNA polymerase IV Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8GAC8 0.0 513 73 1 352 3 dinB DNA polymerase IV Serratia proteamaculans (strain 568)
B2U3S3 0.0 513 70 0 349 3 dinB DNA polymerase IV Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q57SU1 0.0 513 70 0 351 3 dinB DNA polymerase IV Salmonella choleraesuis (strain SC-B67)
A4W6W8 0.0 512 70 1 352 3 dinB DNA polymerase IV Enterobacter sp. (strain 638)
A9MNS1 0.0 509 70 0 351 3 dinB DNA polymerase IV Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q66DZ7 3.99e-176 495 70 0 351 3 dinB DNA polymerase IV Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FLI9 3.99e-176 495 70 0 351 3 dinB DNA polymerase IV Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPK8 4.54e-175 493 70 0 351 3 dinB DNA polymerase IV Yersinia pestis (strain Pestoides F)
Q1CLD4 4.54e-175 493 70 0 351 3 dinB DNA polymerase IV Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZBZ9 4.54e-175 493 70 0 351 3 dinB DNA polymerase IV Yersinia pestis
Q1C4D9 4.54e-175 493 70 0 351 3 dinB DNA polymerase IV Yersinia pestis bv. Antiqua (strain Antiqua)
P58963 3.32e-170 479 69 0 331 3 dinB DNA polymerase IV (Fragment) Escherichia fergusonii
Q7MID6 1.74e-152 436 60 2 350 3 dinB DNA polymerase IV Vibrio vulnificus (strain YJ016)
Q8DBI7 1.74e-152 436 60 2 350 3 dinB DNA polymerase IV Vibrio vulnificus (strain CMCP6)
Q87MB4 7.08e-151 431 60 3 351 3 dinB DNA polymerase IV Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q15YP8 2.2e-145 417 60 1 351 3 dinB DNA polymerase IV Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0TQD1 6.82e-145 416 59 1 338 3 dinB DNA polymerase IV Shewanella halifaxensis (strain HAW-EB4)
A8H771 3.05e-144 415 59 1 338 3 dinB DNA polymerase IV Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A9L0T3 2.15e-143 412 59 2 345 3 dinB DNA polymerase IV Shewanella baltica (strain OS195)
A6WRW5 7.32e-143 411 58 2 345 3 dinB DNA polymerase IV Shewanella baltica (strain OS185)
A3D147 8.44e-143 411 58 2 345 3 dinB DNA polymerase IV Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q086K1 3.78e-141 407 58 1 343 3 dinB DNA polymerase IV Shewanella frigidimarina (strain NCIMB 400)
Q12Q05 4.96e-141 407 58 1 346 3 dinB DNA polymerase IV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1RMZ5 6.17e-141 406 58 2 346 3 dinB DNA polymerase IV Shewanella sp. (strain W3-18-1)
B1KD33 6.31e-141 407 55 4 363 3 dinB DNA polymerase IV Shewanella woodyi (strain ATCC 51908 / MS32)
C3LQ59 6.01e-140 404 56 3 352 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain M66-2)
Q9KPS5 6.01e-140 404 56 3 352 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5Y1 1.59e-139 403 56 3 352 3 dinB DNA polymerase IV Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A8FYV3 2.2e-139 402 57 1 338 3 dinB DNA polymerase IV Shewanella sediminis (strain HAW-EB3)
Q0HLP0 4.88e-139 402 57 2 342 3 dinB DNA polymerase IV Shewanella sp. (strain MR-4)
Q8EHU9 6.05e-139 401 57 2 345 3 dinB DNA polymerase IV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KTR5 2.23e-138 400 57 2 344 3 dinB DNA polymerase IV Shewanella sp. (strain ANA-3)
Q0HY21 1.24e-137 398 57 2 344 3 dinB DNA polymerase IV Shewanella sp. (strain MR-7)
A3QGY9 1.29e-137 398 58 2 341 3 dinB DNA polymerase IV Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q65TG8 1.23e-136 395 56 2 352 3 dinB DNA polymerase IV Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CNG4 1.9e-136 395 58 4 343 3 dinB DNA polymerase IV Pasteurella multocida (strain Pm70)
A1S8M3 1.89e-133 387 57 2 341 3 dinB DNA polymerase IV Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0BPX9 1.54e-127 372 53 2 351 3 dinB DNA polymerase IV Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A0KHD5 5.02e-127 371 57 2 340 3 dinB DNA polymerase IV Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A3N148 2.59e-125 367 53 2 351 3 dinB DNA polymerase IV Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q487H6 3.99e-124 363 54 4 349 3 dinB DNA polymerase IV Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8F542 8.77e-123 360 51 2 351 3 dinB DNA polymerase IV Glaesserella parasuis serovar 5 (strain SH0165)
A4XT24 7.83e-115 340 51 1 339 3 dinB DNA polymerase IV Pseudomonas mendocina (strain ymp)
A5IH02 1.06e-113 337 51 2 340 3 dinB DNA polymerase IV Legionella pneumophila (strain Corby)
Q5X7J1 7.12e-113 335 50 2 340 3 dinB DNA polymerase IV Legionella pneumophila (strain Paris)
Q5ZY20 1.05e-112 335 51 2 340 3 dinB DNA polymerase IV Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q3II35 3.64e-112 333 49 5 350 3 dinB DNA polymerase IV Pseudoalteromonas translucida (strain TAC 125)
Q5WYY8 6.09e-112 332 50 2 340 3 dinB DNA polymerase IV Legionella pneumophila (strain Lens)
Q3KH18 6.82e-111 330 49 1 339 3 dinB DNA polymerase IV Pseudomonas fluorescens (strain Pf0-1)
Q87Y22 7.44e-111 330 50 2 341 3 dinB DNA polymerase IV Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1I6D5 9.67e-111 329 50 1 340 3 dinB DNA polymerase IV Pseudomonas entomophila (strain L48)
Q48FB2 2.75e-110 328 50 1 339 3 dinB DNA polymerase IV Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A6VA50 1.03e-109 327 52 1 342 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain PA7)
Q9I534 1.3e-109 327 52 2 343 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02I83 1.3e-109 327 52 2 343 3 dinB DNA polymerase IV Pseudomonas aeruginosa (strain UCBPP-PA14)
Q4ZWM4 2.43e-109 326 49 1 339 3 dinB DNA polymerase IV Pseudomonas syringae pv. syringae (strain B728a)
Q88NK4 3.25e-109 325 50 2 341 3 dinB DNA polymerase IV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A6W1V6 2.16e-108 323 48 2 350 3 dinB DNA polymerase IV Marinomonas sp. (strain MWYL1)
B0KTK6 3.49e-108 323 50 2 341 3 dinB DNA polymerase IV Pseudomonas putida (strain GB-1)
A5VZT3 1.52e-107 321 49 2 341 3 dinB DNA polymerase IV Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8XZ19 1.39e-105 317 49 1 340 3 dinB DNA polymerase IV Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B0TZS5 4.55e-99 300 45 5 352 3 dinB DNA polymerase IV Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q2A3L2 2.83e-98 298 45 4 340 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain LVS)
A7NC07 2.83e-98 298 45 4 340 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q0BM23 3.79e-98 297 45 4 340 3 dinB DNA polymerase IV Francisella tularensis subsp. holarctica (strain OSU18)
A0Q6K9 7.68e-98 296 45 5 352 3 dinB DNA polymerase IV Francisella tularensis subsp. novicida (strain U112)
B2SH34 2.43e-97 295 45 4 340 3 dinB DNA polymerase IV Francisella tularensis subsp. mediasiatica (strain FSC147)
Q6MA55 2.09e-96 293 49 1 325 3 dinB DNA polymerase IV Protochlamydia amoebophila (strain UWE25)
A1U339 3.74e-96 292 48 1 339 3 dinB DNA polymerase IV Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q0TQ38 6.68e-91 279 43 5 344 3 dinB DNA polymerase IV Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
C1KWR9 2.75e-88 272 43 4 346 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4b (strain CLIP80459)
Q71Y46 3.17e-88 272 43 4 346 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4b (strain F2365)
Q92XH8 3.62e-88 272 44 5 347 3 dinB2 DNA polymerase IV 2 Rhizobium meliloti (strain 1021)
Q8Y5T0 6.33e-88 271 43 3 343 3 dinB DNA polymerase IV Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92A40 1.77e-87 270 43 3 343 3 dinB DNA polymerase IV Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A1KUQ3 3.94e-87 269 43 5 349 3 dinB DNA polymerase IV Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A0AK80 7.99e-87 268 42 3 343 3 dinB DNA polymerase IV Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q18A91 2.04e-86 268 42 4 340 3 dinB DNA polymerase IV Clostridioides difficile (strain 630)
Q6AL48 5.27e-86 267 47 2 301 3 dinB DNA polymerase IV Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9JRG1 7.1e-86 266 42 5 349 3 dinB DNA polymerase IV Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q64X95 7.49e-86 266 46 6 342 3 dinB DNA polymerase IV Bacteroides fragilis (strain YCH46)
B8DBV7 9.24e-86 266 42 3 343 3 dinB DNA polymerase IV Listeria monocytogenes serotype 4a (strain HCC23)
Q0SSQ2 1.39e-85 265 43 3 339 3 dinB DNA polymerase IV Clostridium perfringens (strain SM101 / Type A)
Q5FSM8 2.4e-85 265 46 3 303 3 dinB DNA polymerase IV Gluconobacter oxydans (strain 621H)
Q9JYS8 3.7e-85 263 46 3 299 3 dinB DNA polymerase IV Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F8N2 9.14e-85 263 42 5 350 3 dinB DNA polymerase IV Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B2UKN1 2.81e-84 262 45 6 348 3 dinB DNA polymerase IV Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q8XK37 4.89e-83 259 50 0 248 3 dinB DNA polymerase IV Clostridium perfringens (strain 13 / Type A)
Q8PCW8 4.35e-81 254 43 7 358 3 dinB DNA polymerase IV Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQI2 4.35e-81 254 43 7 358 3 dinB DNA polymerase IV Xanthomonas campestris pv. campestris (strain 8004)
A1WY69 4.48e-81 254 42 4 354 3 dinB DNA polymerase IV Halorhodospira halophila (strain DSM 244 / SL1)
Q6FFG4 6.26e-81 253 45 3 296 3 dinB DNA polymerase IV Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0A4X2 6.77e-81 253 43 4 357 3 dinB DNA polymerase IV Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B4SIF5 4.72e-79 249 48 1 263 3 dinB DNA polymerase IV Stenotrophomonas maltophilia (strain R551-3)
A8AUV7 7.55e-79 248 41 4 342 3 dinB DNA polymerase IV Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B2FLR2 1.8e-78 247 48 1 263 3 dinB DNA polymerase IV Stenotrophomonas maltophilia (strain K279a)
Q3BP42 6.26e-78 246 43 6 350 3 dinB DNA polymerase IV Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8F8Q2 6.92e-78 246 39 5 355 3 dinB DNA polymerase IV Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8PGJ4 7.2e-78 246 43 6 350 3 dinB DNA polymerase IV Xanthomonas axonopodis pv. citri (strain 306)
Q72MY7 9.06e-78 245 39 5 355 3 dinB DNA polymerase IV Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A3CKU4 9.88e-78 245 41 4 342 3 dinB DNA polymerase IV Streptococcus sanguinis (strain SK36)
Q5LYC2 1.96e-77 245 39 5 360 3 dinB DNA polymerase IV Streptococcus thermophilus (strain CNRZ 1066)
Q97SC7 2.71e-77 244 40 4 342 3 dinB DNA polymerase IV Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A4VZ21 2.78e-77 244 40 5 343 3 dinB DNA polymerase IV Streptococcus suis (strain 98HAH33)
B9DMT3 4.46e-77 243 39 3 338 3 dinB DNA polymerase IV Staphylococcus carnosus (strain TM300)
Q49YT9 5.71e-77 243 39 3 338 3 dinB DNA polymerase IV Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8UJK7 8.59e-77 243 43 6 347 3 dinB2 DNA polymerase IV 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8DXW9 1.7e-76 242 38 8 355 3 dinB DNA polymerase IV Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E3I8 1.7e-76 242 38 8 355 3 dinB DNA polymerase IV Streptococcus agalactiae serotype III (strain NEM316)
Q3JZG9 1.7e-76 242 38 8 355 3 dinB DNA polymerase IV Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5M2Y5 2.45e-76 242 38 5 360 3 dinB DNA polymerase IV Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q2P7M9 4.04e-76 241 49 1 254 3 dinB DNA polymerase IV Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8DQZ7 6.9e-76 240 39 4 342 3 dinB DNA polymerase IV Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04M21 6.9e-76 240 39 4 342 3 dinB DNA polymerase IV Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q03J54 7.69e-76 241 38 5 360 3 dinB DNA polymerase IV Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
P58964 4.67e-75 238 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain MW2)
Q6G838 4.67e-75 238 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain MSSA476)
A6QIC3 4.67e-75 238 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain Newman)
Q5HEM7 4.67e-75 238 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain COL)
P63992 1.12e-74 237 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain N315)
P63991 1.12e-74 237 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X420 1.12e-74 237 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain Mu3 / ATCC 700698)
A5IU61 1.18e-74 237 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain JH9)
A6U2Z9 1.18e-74 237 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain JH1)
Q6GFG2 1.82e-74 237 38 3 338 3 dinB DNA polymerase IV Staphylococcus aureus (strain MRSA252)
Q98NW7 2.37e-74 237 44 7 352 3 dinB3 DNA polymerase IV 3 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q02WA3 7.27e-74 236 41 6 348 3 dinB DNA polymerase IV Lactococcus lactis subsp. cremoris (strain SK11)
Q3ABL2 1.57e-73 236 47 0 256 3 dinB DNA polymerase IV Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8DVR7 2.3e-73 234 38 6 359 3 dinB DNA polymerase IV Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A2RNH9 2.59e-73 234 41 6 348 3 dinB DNA polymerase IV Lactococcus lactis subsp. cremoris (strain MG1363)
Q2YU32 3.39e-73 233 40 1 300 3 dinB DNA polymerase IV Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q99Y66 3.43e-73 234 38 5 347 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M1
Q88V07 5.55e-73 234 40 6 349 3 dinB DNA polymerase IV Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P0DA79 6.46e-73 233 39 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DA78 6.46e-73 233 39 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A2RCQ1 7.06e-73 233 39 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8NZI1 7.7e-73 233 39 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q4L7K8 9.54e-73 233 40 1 298 3 dinB DNA polymerase IV Staphylococcus haemolyticus (strain JCSC1435)
Q1JF59 2.49e-72 231 39 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8CNP3 6.98e-72 230 42 0 276 3 dinB DNA polymerase IV Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q48RJ4 7.39e-72 230 38 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q5XA48 7.89e-72 230 38 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5HN39 2.09e-71 229 42 0 276 3 dinB DNA polymerase IV Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B1YK83 2.37e-71 229 39 6 355 3 dinB DNA polymerase IV Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q9CE21 4.34e-71 228 41 8 350 3 dinB DNA polymerase IV Lactococcus lactis subsp. lactis (strain IL1403)
Q67QM6 8.99e-71 228 41 7 353 3 dinB DNA polymerase IV Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q1JK63 1.14e-70 227 38 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JA16 1.14e-70 227 38 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q7USY7 1.18e-70 228 38 7 358 3 dinB DNA polymerase IV Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B8FBE8 2.55e-70 228 41 2 297 3 dinB DNA polymerase IV Desulfatibacillum aliphaticivorans
Q1J509 4.61e-70 226 38 5 344 3 dinB DNA polymerase IV Streptococcus pyogenes serotype M4 (strain MGAS10750)
P58965 8.76e-67 218 38 5 351 1 dinB DNA polymerase IV Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7Z6F3 3.53e-63 209 35 5 341 3 dinB DNA polymerase IV Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q9A5I1 2.74e-61 204 37 5 338 3 dinB DNA polymerase IV Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P54545 3.47e-61 204 36 5 341 3 dinB1 DNA polymerase IV 1 Bacillus subtilis (strain 168)
Q98LV1 3.77e-57 194 40 4 301 3 dinB1 DNA polymerase IV 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8YC76 4.25e-57 194 36 6 343 3 dinB DNA polymerase IV Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q3ZWB2 1.17e-56 192 34 2 306 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain CBDB1)
Q818U9 1.43e-56 192 32 6 344 3 dinB DNA polymerase IV Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q635E0 2.71e-56 191 32 6 344 3 dinB DNA polymerase IV Bacillus cereus (strain ZK / E33L)
Q81M86 4.87e-56 191 32 6 344 3 dinB DNA polymerase IV Bacillus anthracis
Q8FW50 5.05e-56 192 35 6 343 3 dinB DNA polymerase IV Brucella suis biovar 1 (strain 1330)
A5FSS1 5.75e-56 190 34 2 306 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A3CSG3 6.31e-55 186 33 5 353 3 dbh DNA polymerase IV Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q92QM8 6.52e-55 188 36 8 353 3 dinB1 DNA polymerase IV 1 Rhizobium meliloti (strain 1021)
Q3ZAI3 2.55e-54 186 33 5 343 3 dinB DNA polymerase IV Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q9KCU7 2.99e-54 186 33 6 340 3 dinB1 DNA polymerase IV 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A5N2U5 5.57e-53 182 33 4 341 3 dinB DNA polymerase IV Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q8UFV3 7.74e-53 182 35 8 349 3 dinB1 DNA polymerase IV 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q73P36 1.17e-52 181 34 5 334 3 dinB DNA polymerase IV Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8EQ56 5.21e-52 181 31 7 351 3 dinB DNA polymerase IV Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8PT42 1.6e-50 175 31 4 353 3 dbh2 DNA polymerase IV 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A3DH61 2.41e-50 176 31 4 343 3 dinB DNA polymerase IV Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9AK82 2.79e-48 172 35 5 339 3 dinB DNA polymerase IV Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6JDV7 1.21e-47 174 37 11 349 1 POLK DNA polymerase kappa Arabidopsis thaliana
B5ZBT4 1.3e-47 167 29 8 357 3 dinB DNA polymerase IV Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
A8MGJ5 1.51e-47 168 32 7 342 3 dinB DNA polymerase IV Alkaliphilus oremlandii (strain OhILAs)
Q9PQ53 2.01e-47 167 27 7 356 3 dinB DNA polymerase IV Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ79 2.01e-47 167 27 7 356 3 dinB DNA polymerase IV Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
O74944 9.63e-47 169 33 9 348 1 mug40 DNA polymerase kappa Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A3EWL3 9.41e-46 170 36 3 246 2 REV1 DNA repair protein REV1 Arabidopsis thaliana
Q8TIW3 1.81e-45 162 32 9 356 3 dbh DNA polymerase IV Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9HQT4 2.09e-45 163 32 6 365 3 dbh DNA polymerase IV Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4P0 2.09e-45 163 32 6 365 3 dbh DNA polymerase IV Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q2RJ46 1.25e-44 160 31 6 351 3 dinB DNA polymerase IV Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q6A763 2e-44 161 37 6 303 3 dinB DNA polymerase IV Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q9UBT6 1.98e-43 163 34 12 378 1 POLK DNA polymerase kappa Homo sapiens
Q8PYH6 2.42e-43 156 31 9 355 3 dbh1 DNA polymerase IV 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q6NGD8 1.02e-42 157 35 8 303 3 dinB DNA polymerase IV Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
P34409 5.19e-42 157 30 13 409 3 polk-1 DNA polymerase kappa Caenorhabditis elegans
A5D243 1.33e-41 152 33 2 274 3 dinB DNA polymerase IV Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q5R4N7 1.38e-41 158 30 4 324 2 REV1 DNA repair protein REV1 Pongo abelii
A9A3A9 1.46e-41 152 37 4 241 3 dbh DNA polymerase IV Nitrosopumilus maritimus (strain SCM1)
Q98JM5 1.48e-41 153 33 5 303 3 dinB2 DNA polymerase IV 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9W0P2 2.47e-41 157 28 7 369 1 Rev1 DNA repair protein Rev1 Drosophila melanogaster
Q9UBZ9 1.85e-40 155 30 4 325 1 REV1 DNA repair protein REV1 Homo sapiens
B1ZN03 2.32e-40 149 33 7 304 3 dinB DNA polymerase IV Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q6R3M4 1.13e-39 152 32 8 318 1 Poli DNA polymerase iota Mus musculus
Q4JB80 1.43e-39 146 35 3 212 1 dbh DNA polymerase IV Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P96022 1.43e-39 146 35 3 212 1 dbh DNA polymerase IV Saccharolobus solfataricus
Q974T8 2.01e-38 143 30 6 286 3 dbh DNA polymerase IV Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q6KZW2 2.29e-38 142 31 7 276 3 dbh DNA polymerase IV Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q920Q2 2.99e-38 149 29 4 325 1 Rev1 DNA repair protein REV1 Mus musculus
Q4KWZ7 3.09e-37 145 36 2 236 2 REV1 DNA repair protein REV1 Gallus gallus
A4YEC1 3.21e-37 140 29 6 319 3 dbh DNA polymerase IV Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q9K9A8 6.01e-37 140 31 3 276 3 dinB2 DNA polymerase IV 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P54560 1.08e-36 140 31 4 277 3 dinB2 DNA polymerase IV 2 Bacillus subtilis (strain 168)
Q97W02 1.11e-36 138 30 6 299 1 dbh DNA polymerase IV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8REB0 1.39e-36 138 32 6 303 3 dinB DNA polymerase IV Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q97MB3 2.4e-36 138 28 6 297 3 dinB DNA polymerase IV Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9UNA4 6.36e-36 141 30 7 312 1 POLI DNA polymerase iota Homo sapiens
A4QFK8 6.96e-34 133 33 13 370 3 dinB DNA polymerase IV Corynebacterium glutamicum (strain R)
Q8NNP4 8.01e-34 133 33 12 367 3 dinB DNA polymerase IV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
O94623 2.84e-31 128 29 4 278 3 rev1 DNA repair protein rev1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P9WNT1 2.07e-30 121 29 6 308 3 dinB2 DNA polymerase IV 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNT0 2.07e-30 121 29 6 308 3 dinB2 DNA polymerase IV 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63988 2.07e-30 121 29 6 308 3 dinB2 DNA polymerase IV 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WNT3 1.23e-29 121 32 7 306 1 dinB1 DNA polymerase IV 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNT2 1.23e-29 121 32 7 306 3 dinB1 DNA polymerase IV 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63986 1.23e-29 121 32 7 306 3 dinB1 DNA polymerase IV 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9VHV1 4.15e-27 115 27 8 362 1 PolI DNA polymerase iota Drosophila melanogaster
Q8H2D5 2.68e-26 113 27 10 349 1 POLH DNA polymerase eta Arabidopsis thaliana
Q9QUG2 6.28e-26 112 46 1 113 1 Polk DNA polymerase kappa Mus musculus
Q9QUG2 3.51e-24 107 40 6 189 1 Polk DNA polymerase kappa Mus musculus
Q49426 2.52e-23 103 27 4 273 3 MG360 Uncharacterized protein MG360 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75241 1.55e-22 100 29 9 272 3 MPN_537 Uncharacterized protein MG360 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O31990 2.39e-16 83 25 9 286 3 uvrX Putative UV-damage repair protein UvrX Bacillus subtilis (strain 168)
P12689 1.3e-14 78 30 8 211 1 REV1 DNA repair protein REV1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9Y253 4.44e-14 77 31 5 191 1 POLH DNA polymerase eta Homo sapiens
Q9Y253 7.64e-12 70 36 4 123 1 POLH DNA polymerase eta Homo sapiens
Q9VNX1 1.88e-12 72 32 4 143 1 PolH DNA polymerase eta Drosophila melanogaster
Q9VNX1 1.05e-11 69 28 6 211 1 PolH DNA polymerase eta Drosophila melanogaster
P04152 5.69e-12 70 26 4 217 1 umuC Protein UmuC Escherichia coli (strain K12)
P18642 5.82e-12 70 24 5 217 3 impB Protein ImpB Salmonella typhimurium
Q9JJN0 8.72e-12 69 31 3 151 1 Polh DNA polymerase eta Mus musculus
Q9JJN0 5.73e-11 67 36 4 123 1 Polh DNA polymerase eta Mus musculus
O42917 1.04e-10 66 30 7 188 1 eso1 N-acetyltransferase eso1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P22494 2.72e-10 64 26 5 217 3 umuC Protein UmuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14303 4.83e-09 60 24 6 222 3 mucB Protein MucB Salmonella typhimurium
P07375 5.78e-09 60 24 6 222 3 mucB Protein MucB Escherichia coli
P23832 2.64e-08 58 23 5 218 3 samB Protein SamB Salmonella typhimurium
C0SPA8 1.17e-06 52 25 2 158 5 yobH DNA repair protein homolog YobH Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_11270
Feature type CDS
Gene dinB
Product DNA polymerase IV
Location 37696 - 38751 (strand: -1)
Length 1056 (nucleotides) / 351 (amino acids)

Contig

Accession ZDB_368
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2023
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00817 impB/mucB/samB family
PF11799 impB/mucB/samB family C-terminal domain
PF21999 DNA polymerase-iota, thumb domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0389 Replication, recombination and repair (L) L Nucleotidyltransferase/DNA polymerase DinP involved in DNA repair

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02346 DNA polymerase IV [EC:2.7.7.7] - -

Protein Sequence

MRKIIHIDMDCFYAAIEMRDDPRLRDIPLAIGGSSDRRGVIATANYPARRFGVHSAMSTAKALLLCPHLKVIPGRMELYKTTSRHLHAIFARYTSLIEPLSLDEAYLDVTDSPQCRGSATLMAEEIRKTIFTELGLTASAGVAPVKFLAKIASDLNKPDGQYIITPEQVTDFVLSLPLRKIPGVGKVTAKRLADLGLETCRDVQNYDQISLLKQFGKFGQIIWQRSHGSDERPVCPDRERKSVGVERTLAEDIASWDECQTIIDELFPELERRLTKVSPDLRIARQGIKLKFADFQQTTQEHVHQVLDKADLLKTAELAWESRREGRGVRLVGLHVTLRDPQLERQLLLGF

Flanking regions ( +/- flanking 50bp)

TGATTTTAACTGTATATTTAAACAGTATTGTTGGTGAGCAGGAGAGGCGGATGCGTAAAATAATTCATATTGATATGGATTGCTTTTATGCGGCGATTGAAATGCGTGACGATCCCCGTCTGCGCGATATCCCGCTGGCTATCGGCGGCAGTTCCGACCGGCGCGGTGTGATTGCGACCGCCAATTATCCGGCGCGGCGCTTCGGGGTGCACAGCGCGATGTCAACGGCAAAAGCACTGCTGCTATGTCCGCATCTGAAAGTGATCCCTGGGCGGATGGAGCTGTATAAAACCACCTCCCGCCACCTGCATGCGATTTTCGCCCGTTATACTTCACTGATTGAGCCGCTGTCACTGGATGAAGCTTATCTTGATGTGACGGACAGCCCGCAGTGCCGGGGCTCAGCCACACTGATGGCGGAAGAGATCCGCAAAACCATTTTTACCGAACTGGGACTGACTGCCTCTGCCGGGGTGGCTCCGGTAAAATTCCTTGCCAAAATCGCGTCTGATCTGAATAAACCCGACGGGCAGTACATTATCACGCCGGAGCAGGTGACGGATTTTGTGCTGTCACTGCCGCTGCGTAAAATTCCCGGTGTGGGAAAGGTGACAGCAAAGCGACTGGCTGATCTCGGTCTGGAGACCTGCCGGGATGTGCAGAATTATGATCAGATATCGCTGCTGAAACAGTTCGGAAAGTTCGGGCAGATCATCTGGCAGCGCAGTCACGGTAGCGATGAGCGGCCGGTTTGTCCGGACAGGGAACGGAAATCTGTCGGTGTCGAGCGGACACTGGCGGAAGATATTGCCTCGTGGGATGAGTGTCAGACGATTATTGATGAGCTGTTTCCGGAGCTGGAGCGTCGTCTGACAAAGGTGTCACCGGATCTGCGGATCGCTCGTCAGGGCATTAAACTGAAGTTTGCGGACTTTCAGCAGACCACACAGGAACATGTCCATCAGGTGCTGGATAAAGCGGATTTGCTGAAAACGGCGGAACTGGCCTGGGAGAGCCGCCGGGAAGGGCGCGGCGTACGGCTGGTGGGGCTGCATGTAACACTGCGGGATCCGCAGCTTGAGCGGCAGTTGCTGCTCGGGTTCTGAATCACATATAAAAACGGCGGGATAATTATCCCGCCGCTGAGCTGAATAAG