Homologs in group_2031

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15220 FBDBKF_15220 89.4 Morganella morganii S1 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
EHELCC_11025 EHELCC_11025 89.4 Morganella morganii S2 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
NLDBIP_11370 NLDBIP_11370 89.4 Morganella morganii S4 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
LHKJJB_11230 LHKJJB_11230 89.4 Morganella morganii S3 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
HKOGLL_09840 HKOGLL_09840 89.4 Morganella morganii S5 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
PMI_RS01780 PMI_RS01780 63.6 Proteus mirabilis HI4320 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase

Distribution of the homologs in the orthogroup group_2031

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2031

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JPF0 0.0 1019 66 1 717 3 aas Bifunctional protein Aas Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JQC1 0.0 1017 66 1 717 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667F1 0.0 1017 66 1 717 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZ75 0.0 1017 66 1 717 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FFD1 0.0 1017 66 1 717 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TLD3 0.0 1016 66 1 717 3 aas Bifunctional protein Aas Yersinia pestis (strain Pestoides F)
A9R2S1 0.0 1016 66 1 717 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Angola)
Q74RZ6 0.0 1014 66 1 717 3 aas Bifunctional protein Aas Yersinia pestis
Q1CAS8 0.0 1014 66 1 717 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Antiqua)
Q6D107 0.0 1003 67 1 716 3 aas Bifunctional protein Aas Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DE43 0.0 999 67 1 715 3 aas Bifunctional protein Aas Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B2VFS7 0.0 988 65 1 716 3 aas Bifunctional protein Aas Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B7LNJ2 0.0 980 64 1 716 3 aas Bifunctional protein Aas Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5BFH6 0.0 979 65 0 708 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain AKU_12601)
Q5PEN7 0.0 979 65 0 708 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0PXJ8 0.0 979 64 0 708 3 aas Bifunctional protein Aas Salmonella paratyphi C (strain RKS4594)
Q57KA7 0.0 979 64 0 708 3 aas Bifunctional protein Aas Salmonella choleraesuis (strain SC-B67)
B5RDY6 0.0 978 64 0 708 3 aas Bifunctional protein Aas Salmonella gallinarum (strain 287/91 / NCTC 13346)
B4TGR5 0.0 977 64 0 708 3 aas Bifunctional protein Aas Salmonella heidelberg (strain SL476)
B5QWU2 0.0 977 64 0 708 3 aas Bifunctional protein Aas Salmonella enteritidis PT4 (strain P125109)
B4TUM9 0.0 977 64 0 708 3 aas Bifunctional protein Aas Salmonella schwarzengrund (strain CVM19633)
B4T503 0.0 977 64 0 708 3 aas Bifunctional protein Aas Salmonella newport (strain SL254)
A4WE11 0.0 977 64 0 714 3 aas Bifunctional protein Aas Enterobacter sp. (strain 638)
Q8ZMA4 0.0 976 64 0 708 3 aas Bifunctional protein Aas Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N3H8 0.0 976 64 0 708 3 aas Bifunctional protein Aas Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A8AP56 0.0 976 63 1 716 3 aas Bifunctional protein Aas Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5F4V4 0.0 975 64 0 708 3 aas Bifunctional protein Aas Salmonella agona (strain SL483)
Q8Z406 0.0 974 64 0 708 3 aas Bifunctional protein Aas Salmonella typhi
B1IU08 0.0 974 64 0 708 3 aas Bifunctional protein Aas Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3X0 0.0 974 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O9:H4 (strain HS)
A7ZQU2 0.0 974 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YY21 0.0 973 64 0 708 3 aas Bifunctional protein Aas Shigella sonnei (strain Ss046)
B5FUB9 0.0 973 64 0 708 3 aas Bifunctional protein Aas Salmonella dublin (strain CT_02021853)
B6I6W1 0.0 973 64 0 708 3 aas Bifunctional protein Aas Escherichia coli (strain SE11)
B7LF13 0.0 973 64 0 708 3 aas Bifunctional protein Aas Escherichia coli (strain 55989 / EAEC)
Q8FEA6 0.0 973 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHQ4 0.0 973 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P31119 0.0 972 64 0 708 1 aas Bifunctional protein Aas Escherichia coli (strain K12)
B1XDP2 0.0 972 64 0 708 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / DH10B)
C4ZZY9 0.0 972 64 0 708 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / MC4100 / BW2952)
Q83JV7 0.0 972 64 0 708 3 aas Bifunctional protein Aas Shigella flexneri
Q0T128 0.0 972 64 0 708 3 aas Bifunctional protein Aas Shigella flexneri serotype 5b (strain 8401)
B5Z4F4 0.0 972 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6J8 0.0 972 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O157:H7
B7N768 0.0 972 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2TYQ5 0.0 971 64 0 708 3 aas Bifunctional protein Aas Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7NVY2 0.0 970 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LR34 0.0 969 64 0 708 3 aas Bifunctional protein Aas Escherichia coli (strain SMS-3-5 / SECEC)
Q1R7H5 0.0 968 64 0 708 3 aas Bifunctional protein Aas Escherichia coli (strain UTI89 / UPEC)
Q0TDZ6 0.0 968 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AF47 0.0 968 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O1:K1 / APEC
B7MLI2 0.0 968 64 0 708 3 aas Bifunctional protein Aas Escherichia coli O45:K1 (strain S88 / ExPEC)
B5XUP2 0.0 965 63 0 710 3 aas Bifunctional protein Aas Klebsiella pneumoniae (strain 342)
A6TDH2 0.0 961 62 0 710 3 aas Bifunctional protein Aas Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MR36 0.0 956 62 0 714 3 aas Bifunctional protein Aas Cronobacter sakazakii (strain ATCC BAA-894)
Q7N7A9 0.0 826 62 1 623 3 aas Bifunctional protein Aas Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O07610 2.17e-40 159 28 14 470 2 lcfB Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
Q8ZES9 5.15e-35 144 30 13 354 3 fadD Long-chain-fatty-acid--CoA ligase Yersinia pestis
Q9AJS8 4.06e-33 137 26 11 482 1 hcl 3-hydroxybenzoate--CoA/4-hydroxybenzoate--CoA ligase Thauera aromatica
P63521 1.04e-32 137 27 19 510 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63522 1.04e-32 137 27 19 510 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhi
Q8XDR6 3.13e-31 132 30 12 356 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O157:H7
P69451 6.57e-31 131 29 12 356 1 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli (strain K12)
P69452 6.57e-31 131 29 12 356 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P38135 2.27e-30 130 30 10 352 1 fadK Medium-chain fatty-acid--CoA ligase Escherichia coli (strain K12)
S5M744 3.36e-30 128 27 17 471 1 fcs Feruloyl-CoA synthase Streptomyces sp.
Q9EY88 3.36e-30 128 27 17 471 1 fcs Feruloyl-CoA synthase Amycolatopsis sp.
Q9S777 3.59e-30 129 28 11 428 1 4CL3 4-coumarate--CoA ligase 3 Arabidopsis thaliana
M4IS90 7.79e-30 129 30 12 349 2 CCL8 Probable CoA ligase CCL8 Humulus lupulus
M4IQQ7 1.23e-29 127 30 12 363 2 CCL9 Probable CoA ligase CCL9 Humulus lupulus
P41636 1.54e-29 127 26 13 467 2 4CL 4-coumarate--CoA ligase Pinus taeda
Q0S7V5 3.27e-28 122 30 12 353 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Rhodococcus jostii (strain RHA1)
Q10S72 7.31e-28 122 28 11 358 2 4CLL4 4-coumarate--CoA ligase-like 4 Oryza sativa subsp. japonica
Q84P21 1.53e-27 121 29 13 354 1 4CLL5 Peroxisomal OPC-8:0-CoA ligase 1 Arabidopsis thaliana
B2KWI3 2.29e-27 121 27 12 430 2 SID4 Acyl-CoA ligase SID4 Ajellomyces capsulatus
Q8VCW8 2.61e-27 121 28 10 371 1 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Mus musculus
Q499N5 3.15e-27 120 25 13 509 2 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Rattus norvegicus
Q0DV32 3.66e-27 120 27 10 360 2 4CLL1 4-coumarate--CoA ligase-like 1 Oryza sativa subsp. japonica
I3PB37 3.83e-27 120 28 13 424 1 4CL1 4-coumarate:CoA ligase 1 Petunia hybrida
P46450 5.25e-27 119 27 10 355 3 fadD Long-chain-fatty-acid--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O24145 7.59e-27 119 27 12 422 2 4CL1 4-coumarate--CoA ligase 1 Nicotiana tabacum
Q84P25 1.44e-26 118 26 12 364 2 4CLL2 4-coumarate--CoA ligase-like 2 Arabidopsis thaliana
M4IQR7 2.69e-26 117 29 12 355 2 CCL5 Probable CoA ligase CCL5 Humulus lupulus
A0A2H5AIX5 2.78e-26 117 26 12 430 2 4CL1 4-coumarate-CoA ligase 1 Narcissus pseudonarcissus
O31826 3.15e-26 117 28 13 361 3 yngI Putative acyl-CoA synthetase YngI Bacillus subtilis (strain 168)
P94547 3.43e-26 117 28 15 369 3 lcfA Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
O74976 4.8e-26 116 25 13 469 1 pcs60 Oxalate--CoA ligase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54P79 1.75e-25 115 28 11 368 3 4cl3 Probable 4-coumarate--CoA ligase 3 Dictyostelium discoideum
Q54P77 1.88e-25 114 24 14 533 3 4cl1 Probable 4-coumarate--CoA ligase 1 Dictyostelium discoideum
Q84P26 3.35e-25 114 28 10 353 2 4CLL8 4-coumarate--CoA ligase-like 8 Arabidopsis thaliana
A0A6B9HER0 3.42e-25 114 26 11 357 1 None Piperic acid--CoA ligase Piper nigrum
Q9S725 5.26e-25 113 26 12 431 1 4CL2 4-coumarate--CoA ligase 2 Arabidopsis thaliana
Q8H151 5.65e-25 114 28 10 319 1 AAE13 Malonate--CoA ligase Arabidopsis thaliana
P39062 9.15e-25 112 25 13 492 1 acsA Acetyl-coenzyme A synthetase Bacillus subtilis (strain 168)
Q54P78 9.63e-25 112 27 11 355 3 4cl2 Probable 4-coumarate--CoA ligase 2 Dictyostelium discoideum
Q838K1 2.11e-24 110 27 12 356 3 menE 2-succinylbenzoate--CoA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
P96843 3.22e-24 110 29 12 361 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7WSH3 5.16e-24 110 24 18 535 3 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Comamonas testosteroni
P0C5B6 5.25e-24 110 27 12 358 2 4CLL4 OPC-6:CoA ligase Arabidopsis thaliana
Q9I4X3 5.31e-24 110 29 12 372 1 pqsA Anthranilate--CoA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
M4IQS1 5.91e-24 110 25 12 415 2 CCL10 Probable CoA ligase CCL10 Humulus lupulus
Q42982 7.33e-24 110 27 16 405 1 4CL2 4-coumarate--CoA ligase 2 Oryza sativa subsp. japonica
Q9SMT7 8e-24 109 28 13 395 1 AAE3 Oxalate--CoA ligase Arabidopsis thaliana
P38137 1.1e-23 109 25 9 354 1 PCS60 Oxalate--CoA ligase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P9WQ61 1.38e-23 109 30 5 271 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ60 1.38e-23 109 30 5 271 3 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXK7 1.38e-23 109 30 5 271 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9FFE9 1.43e-23 108 28 14 380 2 AAE6 Probable acyl-activating enzyme 6 Arabidopsis thaliana
M4ISH0 2.64e-23 108 28 11 322 1 CCL1 4-coumarate--CoA ligase CCL1 Humulus lupulus
Q9FFE6 3.38e-23 107 28 16 381 1 AAE5 Probable acyl-activating enzyme 5, peroxisomal Arabidopsis thaliana
Q8GQN9 5.1e-23 107 28 13 370 1 bclA Benzoate--CoA ligase Thauera aromatica
Q0K844 5.39e-23 107 27 9 346 2 sauT Sulfoacetate--CoA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q6ETN3 7.1e-23 107 28 9 313 1 4CL3 4-coumarate--CoA ligase 3 Oryza sativa subsp. japonica
P9WQ37 9.6e-23 105 24 17 461 1 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ36 9.6e-23 105 24 17 461 3 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q53005 1e-22 106 29 8 364 1 hbaA 4-hydroxybenzoate--CoA/benzoate--CoA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P14912 1.02e-22 106 28 15 430 2 4CL1 4-coumarate--CoA ligase 1 Petroselinum crispum
Q4R4Z9 1.11e-22 106 27 12 365 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Macaca fascicularis
Q4WR83 1.74e-22 105 27 13 389 2 sidI Acyl-CoA ligase sidI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P31685 1.92e-22 105 27 11 420 3 4CL2 4-coumarate--CoA ligase 2 Solanum tuberosum
P14913 2.05e-22 105 28 15 430 2 4CL2 4-coumarate--CoA ligase 2 Petroselinum crispum
Q3E6Y4 2.87e-22 105 26 12 357 2 4CLL3 4-coumarate--CoA ligase-like 3 Arabidopsis thaliana
M4IRL6 4.57e-22 104 24 14 464 2 CCL7 Probable CoA ligase CCL7 Humulus lupulus
Q9M0X9 4.99e-22 104 24 11 432 1 4CLL7 4-coumarate--CoA ligase-like 7 Arabidopsis thaliana
Q9LU36 6.28e-22 103 29 10 318 1 4CL4 4-coumarate--CoA ligase 4 Arabidopsis thaliana
P31687 8.77e-22 103 27 11 433 2 None 4-coumarate--CoA ligase 2 Glycine max
O80658 1.01e-21 103 26 17 397 2 AEE4 Probable acyl-activating enzyme 4 Arabidopsis thaliana
Q96CM8 1.75e-21 102 28 12 365 1 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Homo sapiens
A0A0H2ZF83 1.84e-21 102 29 11 359 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain UCBPP-PA14)
P0DX84 2.78e-21 102 27 12 361 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria lacuscaerulensis (strain DSM 11314 / KCTC 2953 / ITI-1157)
Q17QJ1 3.52e-21 102 27 11 372 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Bos taurus
Q9CMW1 4.9e-21 101 25 20 509 3 acsA Acetyl-coenzyme A synthetase Pasteurella multocida (strain Pm70)
Q5LRT0 5.42e-21 100 27 15 367 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P31684 6.22e-21 100 27 11 420 3 4CL1 4-coumarate--CoA ligase 1 Solanum tuberosum
Q58DN7 6.35e-21 100 26 15 397 2 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Bos taurus
W3X8X8 7.99e-21 102 29 16 358 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
Q9HWG3 1.03e-20 100 29 11 359 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O24540 1.42e-20 99 27 16 451 2 4CL 4-coumarate--CoA ligase Vanilla planifolia
P40871 1.43e-20 99 27 12 356 1 dhbE 2,3-dihydroxybenzoate-AMP ligase Bacillus subtilis (strain 168)
Q84P23 1.55e-20 99 28 11 350 1 4CLL9 4-coumarate--CoA ligase-like 9 Arabidopsis thaliana
B2HIL6 1.71e-20 100 27 4 271 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q5R9G9 1.77e-20 99 27 12 365 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Pongo abelii
Q42524 1.99e-20 99 26 12 427 1 4CL1 4-coumarate--CoA ligase 1 Arabidopsis thaliana
A0A2H5AIY4 2.53e-20 99 30 10 320 2 4CL2 4-coumarate-CoA ligase 2 Narcissus pseudonarcissus
Q4G176 2.74e-20 99 25 19 533 1 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Homo sapiens
Q8LKS5 2.8e-20 99 30 9 322 1 LACS7 Long chain acyl-CoA synthetase 7, peroxisomal Arabidopsis thaliana
Q8KBY0 3.92e-20 99 27 12 362 3 acsA Acetyl-coenzyme A synthetase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P08659 4.33e-20 98 22 14 447 1 None Luciferin 4-monooxygenase Photinus pyralis
O24146 4.56e-20 98 27 13 425 1 4CL2 4-coumarate--CoA ligase 2 Nicotiana tabacum
Q5P603 5.6e-20 97 26 12 355 1 iaaB Indoleacetate--CoA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q9LQS1 7.35e-20 97 27 16 381 2 AAE8 Probable acyl-activating enzyme 8 Arabidopsis thaliana
Q00594 8.86e-20 97 24 12 370 1 alkK Medium-chain-fatty-acid--CoA ligase Pseudomonas oleovorans
Q67W82 1.16e-19 97 24 15 484 1 4CL4 4-coumarate--CoA ligase 4 Oryza sativa subsp. japonica
O07899 1.4e-19 96 25 11 362 3 vibE Vibriobactin-specific 2,3-dihydroxybenzoate-AMP ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q27757 2.33e-19 95 24 12 364 2 None Luciferin 4-monooxygenase Photuris pensylvanica
Q6ZAC1 2.38e-19 95 25 14 409 1 4CL5 4-coumarate--CoA ligase 5 Oryza sativa subsp. japonica
Q0P4F7 2.74e-19 95 26 11 355 2 acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Danio rerio
A0A0A2J5U8 3.1e-19 95 27 8 302 3 cnsG Acyl-CoA ligase cnsG Penicillium expansum
Q3URE1 3.17e-19 95 23 18 527 1 Acsf3 Malonate--CoA ligase ACSF3, mitochondrial Mus musculus
P17814 4.21e-19 95 27 14 365 1 4CL1 4-coumarate--CoA ligase 1 Oryza sativa subsp. japonica
Q6GLK6 7.05e-19 94 27 15 381 2 acsf3 Malonate--CoA ligase ACSF3, mitochondrial Xenopus laevis
A8FGK6 9.85e-19 93 28 14 343 3 menE 2-succinylbenzoate--CoA ligase Bacillus pumilus (strain SAFR-032)
P33121 1.05e-18 94 26 15 387 1 ACSL1 Long-chain-fatty-acid--CoA ligase 1 Homo sapiens
Q26304 1.12e-18 94 23 12 371 1 None Luciferin 4-monooxygenase Luciola mingrelica
O13440 1.48e-18 94 24 18 525 2 ACS-1 Acetyl-coenzyme A synthetase Coprinopsis cinerea
A0A098D1P1 2.46e-18 94 29 12 330 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 9.79e-12 72 22 8 292 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 1.5e-10 68 24 13 390 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 1.7e-09 65 27 13 299 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 5.75e-09 63 25 14 295 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 9.63e-07 56 22 12 385 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 2.47e-06 55 25 10 280 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A8PDE3 2.71e-18 93 24 18 525 3 ACS-1 Acetyl-coenzyme A synthetase Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
Q84HC5 2.96e-18 92 27 13 367 1 ncsB2 2-hydroxy-7-methoxy-5-methyl-1-naphthoate--CoA ligase Streptomyces carzinostaticus
O05598 3.44e-18 92 27 18 398 1 pks16 Putative ligase Rv1013 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P13129 3.78e-18 92 23 11 370 1 None Luciferin 4-monooxygenase Nipponoluciola cruciata
O30409 4.46e-18 93 27 9 354 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 2.11e-17 91 29 19 373 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.31e-16 88 28 13 379 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 2.93e-11 71 25 10 367 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 5.59e-11 70 23 12 361 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.86e-09 65 27 19 370 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
A7GU88 4.89e-18 91 22 15 465 3 menE 2-succinylbenzoate--CoA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9LPK6 5.05e-18 91 26 16 395 2 AEE9 Probable acyl-activating enzyme 9 Arabidopsis thaliana
A0A2I2F2N6 5.14e-18 93 25 20 509 1 cfoA Chalcone synthase cfoA Aspergillus candidus
Q8DKH2 5.26e-18 92 24 18 492 3 acsA Acetyl-coenzyme A synthetase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q65FT5 5.6e-18 91 25 16 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P80436 5.69e-18 91 29 10 364 1 trsA Triostin synthetase I Streptomyces triostinicus
Q9LPK7 8.46e-18 90 26 15 390 2 AEE10 Probable acyl-activating enzyme 10 Arabidopsis thaliana
Q84P24 1.14e-17 90 22 13 483 1 4CLL6 4-coumarate--CoA ligase-like 6 Arabidopsis thaliana
Q6TNA5 1.32e-17 90 27 16 373 1 CmaA L-allo-isoleucine:holo-[CmaA peptidyl-carrier protein] ligase Pseudomonas savastanoi pv. glycinea
A0B8F1 1.46e-17 90 23 19 528 1 acsA Acetyl-coenzyme A synthetase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q96V34 1.5e-17 91 27 10 324 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 1.17e-11 72 24 12 395 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 8.22e-08 60 25 10 314 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
P9WQ53 1.5e-17 90 25 8 355 3 fadD11 Putative fatty-acid--CoA ligase fadD11 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ52 1.5e-17 90 25 8 355 3 fadD11 Putative fatty-acid--CoA ligase fadD11 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q55DR6 1.71e-17 90 22 17 501 1 fcsA Fatty acyl-CoA synthetase A Dictyostelium discoideum
A0R5G1 1.75e-17 90 23 16 466 3 acsA Acetyl-coenzyme A synthetase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A2R6H0 2.22e-17 90 26 16 387 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H0 3.48e-13 77 25 14 398 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
F8J3D9 2.28e-17 90 26 9 354 1 tmlU Marinolic acid--CoA ligase Pseudoalteromonas sp. (strain SANK 73390)
O88813 2.34e-17 90 27 12 325 1 Acsl5 Long-chain-fatty-acid--CoA ligase 5 Rattus norvegicus
Q6FXI2 2.45e-17 90 23 18 514 3 ACS2 Acetyl-coenzyme A synthetase 2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
W7NDP3 2.67e-17 89 25 16 425 2 FVEG_12633 CoA ligase FVEG_12633 Gibberella moniliformis (strain M3125 / FGSC 7600)
B9WZX0 3.19e-17 90 29 11 296 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
B9WZX0 2.56e-11 71 25 17 397 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
P0DUV4 3.26e-17 90 27 12 383 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 7.79e-12 73 25 16 378 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.01e-10 69 25 11 355 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 9.71e-10 66 25 15 376 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.27e-08 62 23 12 373 1 mpbA Malpibaldin synthetase Mortierella alpina
P63526 3.31e-17 89 26 13 344 1 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain N315)
P63525 3.31e-17 89 26 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITW2 3.31e-17 89 26 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH9)
A6U2Q7 3.31e-17 89 26 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH1)
A7X3P0 3.31e-17 89 26 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
M4IQQ5 3.39e-17 89 26 16 386 1 CCL4 2-methylpropanoate--CoA ligase CCL4 Humulus lupulus
P18163 3.4e-17 89 26 12 327 1 Acsl1 Long-chain-fatty-acid--CoA ligase 1 Rattus norvegicus
Q4WAW3 3.42e-17 90 29 11 296 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAW3 2.76e-11 71 25 17 397 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6GFR0 3.49e-17 88 26 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MRSA252)
Q9JID6 3.61e-17 89 26 19 422 2 ACSL1 Long-chain-fatty-acid--CoA ligase 1 Cavia porcellus
Q2YTP0 3.64e-17 88 25 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A0R3D6 3.79e-17 89 27 18 398 1 MSMEG_5435 Putative ligase MSMEG_5435/MSMEI_5285 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q336M7 4.05e-17 89 27 9 311 3 4CLL2 4-coumarate--CoA ligase-like 2 Oryza sativa subsp. japonica
B6HJU6 4.67e-17 90 24 17 540 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HJU6 3.71e-12 73 23 14 380 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q71YZ5 5.01e-17 88 22 8 345 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serotype 4b (strain F2365)
A7Z809 5.02e-17 88 25 11 346 3 menE 2-succinylbenzoate--CoA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q9ULC5 5.83e-17 89 27 13 326 1 ACSL5 Long-chain-fatty-acid--CoA ligase 5 Homo sapiens
O93800 6.13e-17 88 26 13 384 4 AKT1 Acyl-CoA ligase AKT1 Alternaria alternata
Q5AUZ6 6.55e-17 89 28 16 393 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 6.06e-13 76 27 8 282 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 6.82e-13 76 28 11 285 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 2.01e-12 75 27 15 351 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 2.26e-12 74 25 16 397 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.3e-09 65 24 13 387 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
W7L9F0 6.8e-17 88 25 15 333 3 FUM16 Acyl-CoA synthetase FUM16 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q01158 6.84e-17 88 23 11 370 2 None Luciferin 4-monooxygenase Aquatica lateralis
Q9R9J0 8.17e-17 89 26 11 354 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 5.57e-13 77 24 12 369 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 6.6e-07 57 22 12 350 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
A0A0U1LQE6 8.41e-17 89 27 17 391 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 7.57e-09 63 25 12 302 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 2.22e-08 62 24 15 380 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 1.44e-07 59 25 17 399 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A8F4S6Z6 9.09e-17 89 27 17 399 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
Q9CHK3 9.22e-17 87 25 11 362 3 menE 2-succinylbenzoate--CoA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q8JZR0 9.73e-17 88 27 12 325 1 Acsl5 Long-chain-fatty-acid--CoA ligase 5 Mus musculus
Q8NVZ4 1e-16 87 25 13 352 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MW2)
Q6G8D6 1e-16 87 25 13 352 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MSSA476)
Q6BS00 1.12e-16 87 24 19 528 3 ACS2 Acetyl-coenzyme A synthetase 2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P9WEV1 1.17e-16 88 28 15 404 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
P9WEV1 4.29e-15 83 27 16 394 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
A0A144KPJ6 1.28e-16 88 25 10 392 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 1.17e-11 72 28 14 297 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
I3PB36 1.28e-16 87 24 13 374 1 CNL Trans-cinnamate:CoA ligase, peroxisomal Petunia hybrida
Q96VB5 1.45e-16 87 27 11 377 3 AFT1-1 Acyl-CoA ligase AFT1-1 Alternaria alternata
A0A1W6BT46 1.83e-16 88 26 15 391 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
A0A1W6BT46 3.31e-15 84 27 10 304 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
P27095 1.86e-16 87 23 18 529 1 acsA Acetyl-coenzyme A synthetase Methanothrix soehngenii
P41216 2.18e-16 87 26 18 419 1 Acsl1 Long-chain-fatty-acid--CoA ligase 1 Mus musculus
A0A319BQC1 2.3e-16 87 26 15 389 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 2.46e-14 81 28 16 392 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 3.36e-08 61 21 16 532 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 5.95e-07 57 28 12 293 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
Q04747 2.51e-16 87 26 14 390 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 9.83e-12 72 26 13 359 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 3.61e-11 70 26 13 365 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
A1DN09 2.67e-16 87 26 13 394 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DN09 2.67e-07 58 23 13 322 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
G7XQ31 2.78e-16 87 26 14 388 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 5.3e-14 80 29 21 400 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 9.11e-12 72 25 14 390 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 3.09e-05 51 28 12 294 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
Q8J2R0 2.9e-16 86 25 9 381 3 FUM10 Acyl-CoA synthetase FUM10 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q6YYZ2 2.98e-16 86 22 11 489 3 4CLL3 4-coumarate--CoA ligase-like 3 Oryza sativa subsp. japonica
Q8LPS1 3.46e-16 86 28 10 324 1 LACS6 Long chain acyl-CoA synthetase 6, peroxisomal Arabidopsis thaliana
C0LTL9 3.89e-16 85 29 16 376 1 sibE 3-hydroxy-4-methylanthranilate adenylyltransferase Streptosporangium sibiricum
A0A0S6XHH0 3.9e-16 87 27 14 348 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.13e-13 78 25 12 393 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.52e-12 74 25 14 388 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 5.84e-11 70 26 12 286 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.69e-10 68 25 14 400 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 3.41e-10 67 25 15 401 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.48e-09 65 26 17 388 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.86e-09 65 26 12 375 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 9.16e-09 63 26 16 395 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.62e-08 62 24 11 354 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 6.55e-08 60 25 15 395 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
S7ZFK6 4.32e-16 87 28 17 388 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
P45745 4.7e-16 86 27 16 371 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
P45745 6.51e-09 63 25 14 359 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
O54154 4.72e-16 85 29 16 384 1 redM L-proline--[L-prolyl-carrier protein] ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q17577 4.97e-16 85 24 13 379 1 acs-7 Acyl-CoA synthetase 7 Caenorhabditis elegans
B6D9A8 5.26e-16 86 26 16 390 1 Beas Beauvericin nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
A0A318Z3U0 5.4e-16 86 26 15 387 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 4.69e-12 73 27 16 400 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 7.54e-12 73 22 15 531 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 6.69e-07 57 28 14 295 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A1W5T1U1 5.93e-16 86 28 17 388 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
P58730 6.75e-16 84 22 8 347 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
C9K7B5 6.84e-16 86 25 16 421 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 1.12e-09 66 25 12 286 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 6.4e-05 50 24 14 337 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
P96575 6.92e-16 84 24 11 361 3 ydaB Putative acyl--CoA ligase YdaB Bacillus subtilis (strain 168)
I1RF49 7.22e-16 86 26 17 410 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 3.14e-14 80 24 12 403 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 1.94e-10 68 23 9 286 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 1.16e-07 59 22 9 309 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 0.000166 49 22 12 301 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
B8NR69 7.64e-16 85 26 14 413 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NR69 8.81e-12 72 27 9 292 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A395I3F8 7.8e-16 86 26 13 389 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 1.05e-15 85 28 15 393 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 1.42e-09 65 25 15 392 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 5.33e-07 57 25 15 392 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A3G9H9I5 8.94e-16 84 25 14 396 3 ALT10 Acyl-CoA synthetase ALT10 Alternaria alternata
K3VDP2 1.01e-15 85 24 15 383 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.52e-12 75 26 12 319 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 3.18e-12 74 25 13 397 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.45e-10 68 27 12 342 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.06e-09 66 24 8 297 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 9.35e-06 53 23 9 298 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
F4HUK6 1.04e-15 84 24 16 502 1 AAE1 Butanoate--CoA ligase AAE1 Arabidopsis thaliana
A0A1L9NGU5 1.08e-15 85 26 14 387 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 4.34e-13 77 28 16 390 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 1.15e-10 69 22 15 531 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
S3DB78 1.21e-15 84 26 18 475 1 gloD Acyl-CoA ligase gloD Glarea lozoyensis (strain ATCC 20868 / MF5171)
C7ZBE4 1.26e-15 85 29 14 303 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 8.55e-09 63 26 10 279 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 2.01e-08 62 26 13 306 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
P39846 1.29e-15 85 25 13 372 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
P39846 1.46e-09 65 25 13 381 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
Q55404 1.32e-15 84 23 16 503 3 acsA Acetyl-coenzyme A synthetase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P10378 1.34e-15 84 23 8 363 1 entE Enterobactin synthase component E Escherichia coli (strain K12)
P39518 1.36e-15 84 26 11 342 1 FAA2 Long-chain-fatty-acid--CoA ligase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A317VEE1 1.38e-15 85 26 15 389 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 1.34e-14 82 27 16 413 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 1.13e-09 66 24 15 398 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 5.37e-07 57 28 13 295 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
P33124 1.39e-15 84 24 10 336 1 Acsl6 Long-chain-fatty-acid--CoA ligase 6 Rattus norvegicus
Q53634 1.45e-15 83 25 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus
A8Z4L9 1.45e-15 83 25 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300 / TCH1516)
A6QHX6 1.45e-15 83 25 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Newman)
Q5HEY2 1.45e-15 83 25 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain COL)
Q2G2V3 1.45e-15 83 25 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFU9 1.45e-15 83 25 13 344 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300)
Q92AY8 1.46e-15 83 22 9 348 3 menE 2-succinylbenzoate--CoA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0A1R3RGK1 1.52e-15 85 29 9 278 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
A0A1R3RGK1 1.4e-13 78 25 14 380 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
K0E2F3 1.6e-15 84 25 14 465 1 ecdI Fatty-acyl-AMP ligase ecdI Aspergillus rugulosus
O93730 1.63e-15 84 22 18 552 3 acsA Acetyl-coenzyme A synthetase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q8XBV3 1.75e-15 83 23 9 362 3 entE Enterobactin synthase component E Escherichia coli O157:H7
Q91WC3 1.81e-15 84 24 11 338 1 Acsl6 Long-chain-fatty-acid--CoA ligase 6 Mus musculus
Q9R9I9 1.9e-15 84 27 12 355 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q9R9I9 8.55e-07 56 23 12 365 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
A0A179H164 1.92e-15 84 28 18 357 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.19e-14 82 27 16 368 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 2.87e-12 74 28 11 300 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.84e-11 72 24 9 297 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.99e-10 68 27 9 287 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 8.48e-10 66 26 12 290 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 8.74e-09 63 25 13 316 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 3.69e-08 61 25 15 388 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 7.29e-07 57 26 20 438 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
P23971 1.93e-15 83 23 13 418 1 menE 2-succinylbenzoate--CoA ligase Bacillus subtilis (strain 168)
Q53FZ2 1.94e-15 83 26 15 354 1 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Homo sapiens
A0A1M3T4K3 1.98e-15 84 26 14 383 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 8.25e-14 79 29 21 400 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 1.03e-11 72 25 14 390 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 7.18e-06 53 28 12 294 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
M4ISH2 2.11e-15 83 25 11 377 2 CCL11 Probable CoA ligase CCL11 Humulus lupulus
Q70LM5 2.15e-15 84 28 15 356 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 4.71e-12 73 26 15 395 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 5.98e-12 73 26 15 357 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 9.07e-12 72 27 14 355 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 2.82e-07 58 26 16 357 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 5.41e-07 57 25 14 356 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q5REV5 2.29e-15 83 26 15 354 2 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Pongo abelii
Q7X279 2.3e-15 83 26 12 361 1 sdgA Salicylyl-CoA synthase / salicylate adenylyltransferase Streptomyces sp.
Q9CZW4 2.32e-15 84 26 10 330 1 Acsl3 Fatty acid CoA ligase Acsl3 Mus musculus
P35854 2.49e-15 83 27 16 372 1 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus rhamnosus
G4N137 2.54e-15 84 25 14 386 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A8F4S8Q3 2.57e-15 84 26 15 398 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
P39847 2.67e-15 84 26 12 372 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P39847 8.61e-10 66 26 14 356 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
Q72YK9 2.71e-15 82 24 10 345 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
B2HGV4 2.82e-15 83 28 12 311 3 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium marinum (strain ATCC BAA-535 / M)
A4WJG1 2.96e-15 83 23 21 538 3 acsA Acetyl-coenzyme A synthetase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q63151 3.09e-15 83 26 10 330 1 Acsl3 Fatty acid CoA ligase Acsl3 Rattus norvegicus
C5D6U5 3.1e-15 82 25 12 362 3 menE 2-succinylbenzoate--CoA ligase Geobacillus sp. (strain WCH70)
Q9RRL7 3.2e-15 83 24 16 515 3 acsA Acetyl-coenzyme A synthetase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8CS21 3.33e-15 82 24 15 369 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q73ZP7 3.4e-15 82 27 16 381 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WEP7 3.59e-15 84 24 15 393 1 None PF 1022-synthetase Rosellinia sp.
Q816I1 3.67e-15 82 22 16 490 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9UKU0 4.24e-15 82 26 13 337 1 ACSL6 Long-chain-fatty-acid--CoA ligase 6 Homo sapiens
P0DUV3 4.25e-15 83 28 14 356 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 7.36e-14 79 25 13 371 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.48e-09 65 26 15 375 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.42e-06 55 24 15 372 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 2.59e-05 52 23 12 377 1 mpcA Malpicyclin synthetase Mortierella alpina
Q39EK2 4.34e-15 82 26 10 363 3 acsA Acetyl-coenzyme A synthetase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9Y7B5 4.38e-15 82 24 17 483 3 ACS2 Acetyl-coenzyme A synthetase 2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q5SIW6 4.76e-15 82 23 17 531 3 acsA Acetyl-coenzyme A synthetase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P9WQD1 5.84e-15 82 24 13 375 1 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD0 5.84e-15 82 24 13 375 3 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8NI19 6.06e-15 83 28 13 287 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 1.1e-13 79 27 11 293 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 3.91e-06 54 24 9 290 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
I1RVD9 6.23e-15 83 24 13 380 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD9 2.72e-12 74 25 14 378 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD9 5.32e-05 50 24 13 336 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P59871 6.26e-15 82 24 13 375 3 acsA Acetyl-coenzyme A synthetase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
S0EN43 6.61e-15 83 24 15 395 2 BEA1 Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
O95573 6.72e-15 82 26 10 330 1 ACSL3 Fatty acid CoA ligase Acsl3 Homo sapiens
P36333 7.33e-15 82 24 15 491 3 facA Acetyl-coenzyme A synthetase Penicillium chrysogenum
Q5R668 7.39e-15 82 26 10 330 2 ACSL3 Fatty acid CoA ligase Acsl3 Pongo abelii
A1DA59 7.51e-15 82 29 12 292 3 ftmPS Nonribosomal peptide synthetase ftmPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DA59 2e-09 65 23 15 400 3 ftmPS Nonribosomal peptide synthetase ftmPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
B7HTW3 7.96e-15 81 23 9 346 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH187)
Q9QUJ7 8.11e-15 82 27 11 331 1 Acsl4 Long-chain-fatty-acid--CoA ligase 4 Mus musculus
A0A1W6BT53 8.41e-15 82 25 17 379 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
O60488 8.47e-15 82 27 11 331 1 ACSL4 Long-chain-fatty-acid--CoA ligase 4 Homo sapiens
Q96VC7 8.95e-15 81 25 19 505 3 ACS2 Acetyl-coenzyme A synthetase 2 Zygosaccharomyces bailii
O35547 9.31e-15 81 27 11 331 1 Acsl4 Long-chain-fatty-acid--CoA ligase 4 Rattus norvegicus
A0A2I1D2N0 9.39e-15 82 25 15 406 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.72e-13 78 24 14 454 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 9.61e-13 76 23 13 416 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1e-10 69 24 13 403 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.6e-10 68 26 16 408 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.78e-06 55 24 16 400 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 3.54e-06 54 23 14 425 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
Q5KVX9 1.09e-14 80 25 12 350 3 menE 2-succinylbenzoate--CoA ligase Geobacillus kaustophilus (strain HTA426)
B9J2F2 1.26e-14 80 22 13 487 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain Q1)
Q1IAK8 1.35e-14 81 25 13 368 1 pmsE Pseudomonine synthase PmsE Pseudomonas entomophila (strain L48)
C8VPS9 1.41e-14 82 28 11 310 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 5.74e-10 67 22 11 391 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 2.32e-08 61 23 13 365 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0CS64 1.54e-14 81 28 15 363 3 ataP Nonribosomal peptide synthetase ataP Aspergillus terreus (strain NIH 2624 / FGSC A1156)
C8V7P4 1.57e-14 81 30 11 281 1 ivoA Nonribosomal peptide synthetase ivoA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0C063 1.73e-14 81 26 13 368 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 3.49e-10 67 23 10 390 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 9.11e-10 66 25 18 369 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 5.95e-09 63 26 13 353 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
A0A1L9U7P9 1.78e-14 81 25 14 390 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 2e-13 78 27 16 395 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 3.61e-12 74 24 19 545 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 1.93e-06 55 25 18 411 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
Q08787 1.79e-14 81 28 18 372 1 srfAC Surfactin synthase subunit 3 Bacillus subtilis (strain 168)
Q6AYT9 1.82e-14 80 26 13 374 2 Acsm5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Rattus norvegicus
Q8J0L6 1.89e-14 81 25 12 395 1 lpsB D-lysergyl-peptide-synthetase subunit 2 Claviceps purpurea
A2TBU4 2.08e-14 81 26 15 371 2 lpsB D-lysergyl-peptide-synthetase subunit 2 Epichloe festucae var. lolii
C1D6V9 2.21e-14 80 22 14 522 3 acsA Acetyl-coenzyme A synthetase Laribacter hongkongensis (strain HLHK9)
I1SAJ7 2.27e-14 81 25 14 366 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 7.17e-13 76 24 9 307 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 6.7e-12 73 28 14 324 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.57e-08 62 25 12 382 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 3.1e-06 54 25 12 288 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 7.23e-06 53 24 15 382 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.79e-05 52 24 13 386 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A017SQ41 2.52e-14 81 24 17 500 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
A0A017SQ41 4.02e-11 70 23 19 505 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
Q8NJN3 2.6e-14 80 25 14 398 1 ACS2 Acetyl-coenzyme A synthetase 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
M1W5Z4 2.72e-14 81 25 18 423 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 1.68e-10 68 25 16 396 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 5.06e-08 60 25 12 299 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
O68008 2.76e-14 81 27 15 384 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 3e-12 74 26 15 367 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 1.7e-09 65 26 13 372 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 5.11e-09 63 24 14 373 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 0.000144 49 23 14 359 3 bacC Bacitracin synthase 3 Bacillus licheniformis
G3XUF0 2.84e-14 80 26 14 390 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 8.8e-14 79 28 18 394 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 3.72e-09 64 22 17 532 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 3.28e-07 58 26 18 392 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A024F910 3.3e-14 80 24 11 391 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 6.27e-12 73 25 16 397 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 1.29e-11 72 25 15 381 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 7.73e-08 60 22 11 308 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 1.04e-07 59 27 11 285 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 2.69e-07 58 25 11 307 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A2QYX4 3.32e-14 80 26 14 390 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 9.69e-14 79 28 18 394 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 4.41e-09 64 22 17 532 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 3.48e-07 57 26 18 392 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q6FLU2 3.38e-14 80 23 15 524 3 ACS1 Acetyl-coenzyme A synthetase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q750T7 3.86e-14 79 24 20 519 3 ACS2 Acetyl-coenzyme A synthetase 2 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A0A319A6V2 3.87e-14 80 26 14 390 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 1.04e-13 79 28 18 394 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 4.93e-09 63 22 17 532 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 3.73e-07 57 26 18 392 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
Q5HNB2 4.32e-14 79 24 15 369 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P59872 4.61e-14 79 22 18 515 3 acsA Acetyl-coenzyme A synthetase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
J5JV76 4.82e-14 80 23 15 409 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana (strain ARSEF 2860)
P16929 4.91e-14 79 23 19 518 2 acu-5 Acetyl-coenzyme A synthetase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A0A1E3B0T2 4.96e-14 80 25 19 499 1 criC Nonribosomal peptide synthetase criC Aspergillus cristatus
A0A1E3B0T2 2.26e-08 61 24 14 365 1 criC Nonribosomal peptide synthetase criC Aspergillus cristatus
Q72J95 4.99e-14 79 23 17 531 3 acsA Acetyl-coenzyme A synthetase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P0C064 5.07e-14 80 26 12 368 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 2.92e-11 71 25 16 364 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 3.8e-10 67 23 10 390 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 6.37e-09 63 26 13 353 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
A0A1U9YHZ2 5.38e-14 80 27 12 362 2 verP Nonribosomal peptide synthetase verP Clonostachys rogersoniana
A0A1U9YHZ2 7.52e-10 66 25 15 359 2 verP Nonribosomal peptide synthetase verP Clonostachys rogersoniana
F8P1W3 5.7e-14 79 25 15 404 2 nps3 Atromentin synthetase nps3 Serpula lacrymans var. lacrymans (strain S7.9)
E9FCP4 6.11e-14 80 28 19 425 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 1.91e-13 78 27 18 455 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 3.19e-10 67 27 13 300 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 1.58e-08 62 25 13 381 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 4.31e-06 54 22 9 315 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q8BGA8 7.09e-14 78 24 18 479 1 Acsm5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Mus musculus
P16928 7.28e-14 79 23 17 514 2 facA Acetyl-coenzyme A synthetase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B0CN26 7.72e-14 79 30 18 368 1 sfmB Nonribosomal peptide synthase SfmB Streptomyces lavendulae
Q8ENZ7 8.07e-14 78 21 14 464 3 menE 2-succinylbenzoate--CoA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7BQ71 8.08e-14 78 23 12 364 1 zmaJ Zwittermicin A synthase ZmaJ Bacillus cereus
G3GBU7 8.23e-14 79 23 14 391 3 None Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella intermedia
M1W600 8.42e-14 79 25 10 344 1 lpsB D-lysergyl-peptide-synthetase subunit 2 Claviceps purpurea (strain 20.1)
Q5B7I5 8.46e-14 79 28 11 298 2 inpA Nonribosomal peptide synthase inpA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B7JDD6 8.8e-14 78 21 11 459 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH820)
C0SPB0 8.84e-14 78 23 12 371 3 ytcI Uncharacterized acyl--CoA ligase YtcI Bacillus subtilis (strain 168)
Q9R9J1 9.04e-14 79 26 14 394 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q9R9J1 1.5e-12 75 26 13 372 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q7NSY7 9.15e-14 78 22 12 454 3 acsA Acetyl-coenzyme A synthetase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P28812 1.06e-13 78 23 11 390 3 PA3568 Uncharacterized protein PA3568 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6HC29 1.15e-13 77 21 11 459 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q01574 1.15e-13 78 26 11 379 1 ACS1 Acetyl-coenzyme A synthetase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q63NC4 1.17e-13 78 25 11 388 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain K96243)
A3NH07 1.17e-13 78 25 11 388 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 668)
Q3JH62 1.17e-13 78 25 11 388 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 1710b)
A3P2K7 1.17e-13 78 25 11 388 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 1106a)
A1UWN5 1.17e-13 78 25 11 388 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain SAVP1)
Q62AD1 1.17e-13 78 25 11 388 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain ATCC 23344)
A2RYW5 1.17e-13 78 25 11 388 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain NCTC 10229)
A3MG40 1.17e-13 78 25 11 388 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain NCTC 10247)
Q2T3N9 1.23e-13 78 26 13 390 3 acsA Acetyl-coenzyme A synthetase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A9VM74 1.25e-13 77 23 11 359 3 menE 2-succinylbenzoate--CoA ligase Bacillus mycoides (strain KBAB4)
A0A0S2E7V8 1.26e-13 78 23 15 473 1 invA3 Inactive atromentin synthetase invA3 Paxillus involutus
A0RK73 1.33e-13 77 21 11 459 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis (strain Al Hakam)
Q70LM4 1.41e-13 79 28 17 385 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 1.59e-09 65 27 18 381 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 8.97e-05 50 24 16 365 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q4WT66 1.42e-13 79 23 14 462 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 8.46e-08 60 24 13 385 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 2.01e-06 55 23 11 290 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 9.19e-05 50 22 11 303 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WF61 1.43e-13 78 24 13 390 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WF61 7.24e-08 60 22 9 362 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8RU95 1.44e-13 77 23 11 372 2 4CLL6 4-coumarate--CoA ligase-like 6 Oryza sativa subsp. japonica
Q01576 1.48e-13 77 24 12 375 2 facA Acetyl-coenzyme A synthetase Phycomyces blakesleeanus (strain ATCC 8743b / DSM 1359 / FGSC 10004 / NBRC 33097 / NRRL 1555)
Q81K97 1.5e-13 77 21 12 462 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis
C3LB87 1.64e-13 77 21 12 462 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PCK3 1.64e-13 77 21 12 462 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain A0248)
Q8VYJ1 1.72e-13 77 23 13 387 1 AAE14 2-succinylbenzoate--CoA ligase, chloroplastic/peroxisomal Arabidopsis thaliana
B6HLU1 1.97e-13 78 27 17 378 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLU1 1.77e-07 58 25 15 381 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLU1 0.00012 49 25 19 378 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
P19787 1.97e-13 78 27 17 378 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
P19787 1.77e-07 58 25 15 381 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
P19787 0.00012 49 25 19 378 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
Q4WLW5 2.01e-13 78 25 11 340 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 1.05e-11 72 25 11 307 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 6.83e-11 70 27 12 303 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q91VA0 2.19e-13 77 22 13 366 1 Acsm1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Mus musculus
B8NHE4 2.21e-13 77 23 16 499 1 flvI Nonribosomal peptide synthetase flvI Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
O60135 2.28e-13 77 26 12 320 3 lcf1 Long-chain-fatty-acid--CoA ligase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54Z60 2.54e-13 77 22 13 477 3 acsA Acetyl-coenzyme A synthetase Dictyostelium discoideum
P9WEY3 2.56e-13 77 25 9 328 1 None Acyl-CoA ligase 891, peroxisomal Penicillium brevicompactum
Q99NB1 3.03e-13 77 23 21 522 1 Acss1 Acetyl-coenzyme A synthetase 2-like, mitochondrial Mus musculus
Q2PBY4 3.16e-13 77 25 17 399 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 3.15e-11 71 25 11 316 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 8.86e-08 59 23 12 348 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
A0A0S2E7W7 3.21e-13 77 24 17 421 1 invA5 Atromentin synthetase invA5 Paxillus involutus
A0A1L9WUW3 3.48e-13 77 22 17 533 1 aneB Nonribosomal peptide synthase aneB Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
P27742 5.02e-13 77 25 14 379 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 4.87e-06 54 23 13 365 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C1CU95 5.03e-13 75 28 10 288 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain Taiwan19F-14)
B8ZQ14 5.03e-13 75 28 10 288 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
P09095 5.05e-13 76 23 13 376 1 tycA Tyrocidine synthase 1 Brevibacillus parabrevis
A0A089FSA4 5.1e-13 77 25 16 399 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
A0A7L9EYL1 5.14e-13 77 27 16 382 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
P86832 5.78e-13 75 23 14 490 1 fcbA2 4-chlorobenzoate--CoA ligase Arthrobacter sp.
P86831 5.78e-13 75 23 14 490 1 fcbA1 4-chlorobenzoate--CoA ligase Arthrobacter sp.
D1FVF0 5.9e-13 76 24 16 387 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
O60011 6.01e-13 75 24 16 468 3 ACS1 Acetyl-coenzyme A synthetase 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
C1CB20 7.14e-13 75 28 10 288 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain 70585)
C1CNE9 7.2e-13 75 28 10 288 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain P1031)
P0A399 7.2e-13 75 28 10 288 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A398 7.2e-13 75 28 10 288 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HZ7 7.2e-13 75 28 10 288 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1BBA2 7.43e-13 75 24 17 401 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium sp. (strain MCS)
Q632I5 7.94e-13 75 22 13 466 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ZK / E33L)
A0A5K6CNB8 7.97e-13 75 25 14 384 1 posA Delta-poly-L-ornithine synthetase Acinetobacter baumannii (strain AB307-0294)
Q1AXQ5 8.27e-13 75 24 11 362 3 acsA Acetyl-coenzyme A synthetase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
L0E2Z1 8.92e-13 76 25 10 324 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
L0E2Z1 3.39e-11 70 23 11 326 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
Q03AZ2 1.06e-12 74 28 18 370 3 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WC77 1.08e-12 74 28 18 370 3 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus casei (strain BL23)
P25464 1.09e-12 75 26 15 392 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
P25464 3.16e-10 67 24 13 373 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
P25464 6.91e-10 66 26 16 398 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
Q6NUN0 1.16e-12 74 26 13 366 1 ACSM5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Homo sapiens
O30408 1.18e-12 75 25 14 370 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 3.12e-12 74 25 13 359 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 3.83e-09 64 24 15 376 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
Q4WD47 1.42e-12 75 27 13 306 2 fsqF Nonribosomal peptide synthetase-like enzyme fsqF Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A4YDR9 1.44e-12 74 24 14 379 1 Msed_0394 4-hydroxybutyrate--CoA ligase 2 Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q08AH1 1.45e-12 74 23 16 407 1 ACSM1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Homo sapiens
Q9SFW5 1.53e-12 74 22 14 438 3 AEE21 Probable acyl-activating enzyme 21 Arabidopsis thaliana
P52910 1.55e-12 74 25 12 394 1 ACS2 Acetyl-coenzyme A synthetase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A0C1E5J8 2.09e-12 75 28 16 344 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
A0A0C1E5J8 7.29e-09 63 24 15 351 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
A0A0C1E5J8 8.23e-07 56 24 11 303 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
Q4WZ44 2.09e-12 74 25 11 366 3 NRPS7 Nonribosomal peptide synthetase 7 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WZ44 1.06e-05 53 24 17 381 3 NRPS7 Nonribosomal peptide synthetase 7 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
G3J456 2.12e-12 75 25 10 303 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 8.55e-12 72 23 10 297 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 1.3e-10 68 23 16 396 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
P9WQ41 2.18e-12 73 26 19 391 1 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A4X9 2.18e-12 73 26 19 391 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q87C00 2.32e-12 73 22 17 529 3 acsA Acetyl-coenzyme A synthetase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A4G3L8 2.51e-12 73 26 15 376 3 acsA Acetyl-coenzyme A synthetase Herminiimonas arsenicoxydans
Q5SBL6 2.89e-12 74 25 16 390 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
A0A0S1RUN4 2.94e-12 73 23 17 421 1 invA2 Atromentin synthetase invA2 Paxillus involutus
P9WQ40 3.01e-12 73 26 19 391 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5SKN9 3.18e-12 73 27 12 312 1 TTHA0604 Long-chain-fatty-acid--CoA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B5R1R0 3.19e-12 73 26 12 370 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella enteritidis PT4 (strain P125109)
I6NXV7 3.29e-12 73 24 14 353 1 greA Atromentin synthetase greA Suillus grevillei
Q88VM6 3.4e-12 73 27 15 365 3 dltA D-alanine--D-alanyl carrier protein ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9PB89 3.4e-12 73 22 18 534 3 acsA Acetyl-coenzyme A synthetase Xylella fastidiosa (strain 9a5c)
Q9SS00 3.54e-12 73 23 10 385 2 AAE12 Probable acyl-activating enzyme 12, peroxisomal Arabidopsis thaliana
M1W0X8 3.82e-12 73 24 15 325 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 9.36e-11 69 25 11 317 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 5.16e-06 53 24 13 345 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
Q4R4P9 4.22e-12 73 23 8 315 2 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Macaca fascicularis
B5F750 4.48e-12 72 26 11 357 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella agona (strain SL483)
Q8ZRX4 4.52e-12 72 26 12 369 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TIH0 4.52e-12 72 26 12 369 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella heidelberg (strain SL476)
O94205 4.68e-12 73 25 14 327 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
O94205 1.22e-10 69 26 10 296 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
O94205 5.25e-06 53 24 13 345 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2KHW5 5.28e-12 73 24 9 315 2 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Bos taurus
P78773 5.48e-12 72 26 12 368 1 SPCC191.02c Probable acetyl-coenzyme A synthetase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6SKG1 5.49e-12 72 24 12 353 2 Acsm3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Rattus norvegicus
Q70LM6 5.81e-12 73 27 15 358 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 2.21e-10 68 26 20 409 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 5.66e-10 67 24 13 358 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 6.7e-07 57 26 16 359 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q9VP61 5.97e-12 72 24 14 401 2 AcCoAS Acetyl-coenzyme A synthetase Drosophila melanogaster
Q9NUB1 6.05e-12 72 23 20 522 1 ACSS1 Acetyl-coenzyme A synthetase 2-like, mitochondrial Homo sapiens
Q5B7J0 6.28e-12 72 27 14 399 2 inpC Acyl-CoA ligase inpC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A319DV72 6.88e-12 73 25 15 394 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 8.74e-11 69 24 15 389 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 5.37e-09 63 26 15 394 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 4.77e-07 57 25 17 392 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
Q3UNX5 7.06e-12 72 23 8 345 1 Acsm3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Mus musculus
Q0CG34 7.08e-12 73 28 11 291 1 tpzB Nonribosomal peptide synthetase tpzA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CG34 3.29e-08 61 24 10 304 1 tpzB Nonribosomal peptide synthetase tpzA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q7TN78 7.18e-12 72 23 9 362 1 Acsm4 Acyl-coenzyme A synthetase ACSM4, mitochondrial Rattus norvegicus
Q96GR2 7.26e-12 72 23 8 315 1 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Homo sapiens
P37418 7.55e-12 71 27 11 284 3 menE 2-succinylbenzoate--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q52400 7.65e-12 72 27 16 375 1 syrB1 Syringomycin synthase SyrB1 Pseudomonas syringae pv. syringae
C0Q4L3 8.33e-12 72 25 15 429 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi C (strain RKS4594)
Q9SEY5 9.1e-12 72 24 11 378 1 AAE2 Isovalerate--CoA ligase AAE2 Arabidopsis thaliana
B4TWR4 9.17e-12 71 26 12 370 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella schwarzengrund (strain CVM19633)
Q17WR1 9.27e-12 72 23 16 484 3 acsA Acetyl-coenzyme A synthetase Helicobacter acinonychis (strain Sheeba)
Q9Y2P5 9.4e-12 72 26 14 357 1 SLC27A5 Long-chain fatty acid transport protein 5 Homo sapiens
Q2UB01 9.57e-12 72 26 11 279 1 ppsA Acyl-CoA ligase ppsA Aspergillus oryzae (strain ATCC 42149 / RIB 40)
B5FHG5 9.58e-12 71 26 12 370 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella dublin (strain CT_02021853)
Q8Z9L4 1e-11 71 26 12 370 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhi
E1ACQ0 1e-11 72 26 17 399 1 notE Nonribisomal peptide synthase notE Aspergillus sp. (strain MF297-2)
E1ACQ0 2.72e-08 61 24 12 341 1 notE Nonribisomal peptide synthase notE Aspergillus sp. (strain MF297-2)
B4T6J6 1.02e-11 71 26 12 370 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella newport (strain SL254)
Q1CUA3 1.07e-11 72 23 16 484 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain HPAG1)
Q9BEA2 1.08e-11 71 22 14 374 1 ACSM1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Bos taurus
I1RIV2 1.11e-11 72 24 16 421 2 NPS6 Nonribosomal peptide synthetase 6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9LQ12 1.13e-11 71 23 15 525 1 4CLL1 4-coumarate--CoA ligase-like 1 Arabidopsis thaliana
Q7XXL2 1.13e-11 71 27 12 302 2 4CLL9 4-coumarate--CoA ligase-like 9 Oryza sativa subsp. japonica
Q99PU5 1.14e-11 72 23 11 343 1 Acsbg1 Long-chain-fatty-acid--CoA ligase ACSBG1 Mus musculus
O25686 1.32e-11 71 23 16 484 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain ATCC 700392 / 26695)
A0A125SUR3 1.33e-11 72 24 15 401 3 ACTTS4 Nonribosomal peptide synthetase ACTTS4 Alternaria alternata
K7NCP5 1.39e-11 72 28 21 413 1 sidN Nonribosomal peptide synthase sidN (Fragment) Epichloe festucae var. lolii
A0QUA1 1.4e-11 71 26 18 378 1 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1CLY8 1.52e-11 72 26 17 390 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A9MYJ6 1.56e-11 71 26 11 357 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
P40806 1.6e-11 72 27 15 292 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 3.43e-10 67 27 16 370 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
Q6BQF2 1.63e-11 71 23 21 524 3 ACS1 Acetyl-coenzyme A synthetase 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P9WEU8 1.66e-11 71 24 12 385 3 benY Nonribisomal peptide synthetase benY Aspergillus terreus
Q4WVN4 1.69e-11 72 27 12 293 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 2.96e-10 68 25 15 403 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 3.21e-09 64 23 11 376 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 2.42e-08 61 25 9 294 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 2.61e-08 61 24 11 307 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 6.3e-08 60 23 14 384 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A179HJB8 1.81e-11 70 25 7 268 2 lcsD Acyl-CoA ligase lcsD Purpureocillium lilacinum
M4IS88 2.06e-11 70 25 20 381 1 CCL3 Acetate--CoA ligase CCL3 Humulus lupulus
Q9C8D4 2.08e-11 70 23 12 367 1 AAE11 Butyrate--CoA ligase AAE11, peroxisomal Arabidopsis thaliana
P27206 2.3e-11 71 26 13 365 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 3.4e-11 70 25 13 351 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 4.57e-08 60 25 14 362 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
S0DLP2 2.66e-11 71 25 17 448 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 1.74e-09 65 23 15 400 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 3.04e-09 64 25 14 372 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 1.15e-06 56 25 11 280 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12225
Feature type CDS
Gene aas
Product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
Location 27741 - 29894 (strand: -1)
Length 2154 (nucleotides) / 717 (amino acids)

Contig

Accession term accessions NZ_VXKB01000003 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2031
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00501 AMP-binding enzyme
PF01553 Acyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0318 Lipid transport and metabolism (I) I O-succinylbenzoic acid-CoA ligase MenE or related acyl-CoA synthetase (AMP-forming)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05939 acyl-[acyl-carrier-protein]-phospholipid O-acyltransferase / long-chain-fatty-acid--[acyl-carrier-protein] ligase [EC:2.3.1.40 6.2.1.20] Fatty acid degradation
Glycerophospholipid metabolism		 -

Protein Sequence

MLMNVLRALLRGLFRIRVTGDLSNLNQPRSVITPNHASFIDGVLLGLFLPTRPVFAMYTNYATPLLIRCLKPIADIVPVDPRNPLALRHLIREIEKGRQIVIFPEGRVTITDSLMKIYDGAAFVAAKTGAKIIPVRIDGAELTYLSRMRKVIKTHFFPKITIHILPATEIPMPVAPRAAERRRLAGELLRDIMMEARMACRPSLTLPQAFLGAVNRYGRFQLCIDDINFSEDSYQGLLKKSLGLSCIISHCTTEGERTGFLLPNATVMAAAILGASMRRRVPALLNYTAGVSGLRNAMKAAGIKTIITSRQFLEKGKLMHLPEQLTEANWIYLEEAKQAVTLKDKLWVMKSLVIPKSALLPQKPEDDALILFTSGSEGTPKGVVHSHDSLLTNVEQIKTVADFTPKDRFMSALPLFHAFGLTAGLFTPLLCGCRIFLYPSPLHYRMVPELIYDQNCTVLFGTSTFLTNYARFAHPYDFTRVRYVIAGAEKLAEATKQVWQEKFGVRILEGYGVTECAPVVSINTPMAARSGTVGRLVPGMESRLLPVAGIEHGGLLQVRGPNVMKGYLRVEAPGRIEPPAAENAQGERQTGWYDTGDIVSIDADGFITIRGRVKRFAKLAGEMISLESVEQLALSVSPGQQHAVVTRPDLKRGEALVMFTTDSALDRAQLLAQAKAKGLPELAVPRDIRYIGQLPVLGSGKPDFVTLKQMALQEPEL

Flanking regions ( +/- flanking 50bp)

ATCTGCCGCCTGAATCATTAGCGGAACAATAAATACACAGGGAATTCAGTATGTTGATGAATGTGTTACGTGCGTTGCTTCGCGGATTATTCCGCATTCGTGTCACCGGTGACCTGAGTAATCTTAATCAACCACGAAGTGTTATCACCCCGAATCATGCTTCTTTTATTGATGGTGTTCTGCTGGGGCTTTTTTTACCTACCCGCCCGGTGTTCGCGATGTACACCAATTACGCCACACCTCTCCTGATCCGCTGTTTAAAACCCATTGCTGACATTGTGCCGGTTGATCCGCGTAACCCGCTGGCATTGAGGCATTTGATCCGCGAAATAGAAAAAGGCCGTCAGATTGTGATTTTCCCGGAAGGTCGGGTGACTATCACGGATTCCCTGATGAAAATCTATGATGGCGCGGCGTTTGTCGCTGCCAAAACCGGCGCAAAAATAATCCCGGTGCGGATAGACGGCGCGGAACTGACGTATTTAAGTCGGATGCGTAAGGTCATCAAAACCCATTTTTTCCCGAAAATTACCATTCATATTCTGCCGGCTACGGAAATCCCGATGCCGGTTGCCCCGCGTGCCGCTGAACGCCGCCGTCTGGCGGGTGAGCTTTTGCGGGATATTATGATGGAGGCACGTATGGCGTGCCGTCCTTCACTGACACTACCGCAGGCGTTTCTGGGTGCCGTCAATCGCTACGGGCGTTTTCAGCTGTGTATTGATGACATCAATTTCAGTGAAGACAGTTATCAGGGATTATTAAAAAAATCCCTCGGGTTGAGCTGCATTATCAGCCACTGTACAACCGAAGGGGAGCGGACAGGCTTCCTGTTACCGAACGCGACCGTCATGGCGGCAGCTATTCTCGGGGCATCGATGCGCCGCCGGGTGCCGGCGTTATTAAATTATACCGCCGGTGTTTCCGGGCTGCGTAATGCCATGAAAGCGGCGGGGATAAAAACGATTATTACATCGCGCCAGTTTCTGGAGAAAGGCAAGTTAATGCATCTGCCGGAGCAACTGACAGAGGCAAACTGGATCTATCTGGAAGAGGCAAAACAGGCGGTTACCCTGAAAGACAAATTGTGGGTAATGAAATCGCTGGTGATACCAAAATCGGCATTATTACCGCAGAAACCGGAAGATGATGCATTGATCCTCTTTACCTCCGGCTCAGAAGGAACGCCGAAAGGGGTGGTACACAGCCATGATTCTCTGCTGACAAATGTGGAGCAGATTAAGACGGTAGCTGACTTTACGCCGAAAGATCGTTTTATGTCCGCACTGCCGCTGTTTCATGCCTTTGGTCTGACCGCCGGGCTGTTTACACCGTTATTGTGTGGCTGCCGGATCTTTCTTTATCCCAGCCCGCTGCATTACCGGATGGTGCCGGAATTGATTTATGATCAGAATTGTACTGTTCTTTTCGGCACATCCACGTTTCTGACAAATTACGCCCGCTTTGCGCATCCTTATGATTTTACCCGTGTCCGTTATGTCATTGCCGGGGCTGAAAAATTAGCAGAAGCCACAAAACAGGTCTGGCAGGAAAAATTCGGTGTGCGCATTCTTGAAGGCTACGGGGTGACTGAATGTGCGCCGGTTGTGTCTATTAATACGCCGATGGCAGCCCGCTCCGGTACGGTCGGACGTCTGGTTCCGGGGATGGAGTCCCGTCTTCTGCCGGTTGCCGGTATTGAGCACGGCGGATTGTTACAGGTGCGCGGACCAAATGTGATGAAAGGCTATCTGCGGGTGGAAGCGCCCGGGCGGATTGAACCACCTGCGGCTGAAAATGCACAGGGTGAGAGACAGACAGGTTGGTATGATACCGGTGATATTGTCAGTATTGATGCAGACGGGTTTATTACTATCCGCGGCCGTGTAAAACGCTTTGCCAAACTTGCCGGGGAAATGATCTCACTGGAAAGTGTTGAGCAACTGGCACTGAGTGTCTCACCCGGACAACAGCACGCGGTTGTCACCAGACCGGATTTGAAACGCGGTGAAGCACTGGTGATGTTTACCACAGACAGTGCGTTGGATCGCGCGCAACTATTGGCGCAGGCGAAAGCAAAAGGATTACCTGAACTGGCGGTTCCGAGGGATATCCGTTATATCGGGCAACTGCCGGTGCTCGGCAGCGGAAAACCGGATTTTGTGACGCTCAAACAAATGGCATTACAGGAGCCGGAACTATGACAGCATCAGCCCCGTTACTGAATAGAGGCATGAAAGCCGTTTTAGCCTCA