Homologs in group_2031

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15220 FBDBKF_15220 64.1 Morganella morganii S1 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
EHELCC_11025 EHELCC_11025 64.1 Morganella morganii S2 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
NLDBIP_11370 NLDBIP_11370 64.1 Morganella morganii S4 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
LHKJJB_11230 LHKJJB_11230 64.1 Morganella morganii S3 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
HKOGLL_09840 HKOGLL_09840 64.1 Morganella morganii S5 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
F4V73_RS12225 F4V73_RS12225 63.6 Morganella psychrotolerans aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase

Distribution of the homologs in the orthogroup group_2031

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2031

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JPF0 0.0 986 65 3 715 3 aas Bifunctional protein Aas Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DE43 0.0 984 65 3 716 3 aas Bifunctional protein Aas Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A4TLD3 0.0 983 65 3 715 3 aas Bifunctional protein Aas Yersinia pestis (strain Pestoides F)
A9R2S1 0.0 983 65 3 715 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Angola)
B1JQC1 0.0 983 65 3 715 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667F1 0.0 983 65 3 715 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZ75 0.0 983 65 3 715 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FFD1 0.0 983 65 3 715 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q74RZ6 0.0 980 65 3 715 3 aas Bifunctional protein Aas Yersinia pestis
Q1CAS8 0.0 980 65 3 715 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Antiqua)
Q6D107 0.0 980 65 3 719 3 aas Bifunctional protein Aas Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VFS7 0.0 944 62 3 719 3 aas Bifunctional protein Aas Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4WE11 0.0 919 61 3 719 3 aas Bifunctional protein Aas Enterobacter sp. (strain 638)
A7MR36 0.0 915 60 3 719 3 aas Bifunctional protein Aas Cronobacter sakazakii (strain ATCC BAA-894)
B7NVY2 0.0 908 61 4 722 3 aas Bifunctional protein Aas Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8AP56 0.0 908 61 3 716 3 aas Bifunctional protein Aas Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2TYQ5 0.0 907 61 4 722 3 aas Bifunctional protein Aas Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LNJ2 0.0 907 61 4 716 3 aas Bifunctional protein Aas Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8FEA6 0.0 907 61 4 722 3 aas Bifunctional protein Aas Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHQ4 0.0 907 61 4 722 3 aas Bifunctional protein Aas Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3YY21 0.0 906 61 4 722 3 aas Bifunctional protein Aas Shigella sonnei (strain Ss046)
B6I6W1 0.0 906 61 4 722 3 aas Bifunctional protein Aas Escherichia coli (strain SE11)
B7N768 0.0 906 61 4 722 3 aas Bifunctional protein Aas Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P31119 0.0 906 61 4 722 1 aas Bifunctional protein Aas Escherichia coli (strain K12)
B1IU08 0.0 906 61 4 722 3 aas Bifunctional protein Aas Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3X0 0.0 906 61 4 722 3 aas Bifunctional protein Aas Escherichia coli O9:H4 (strain HS)
B1XDP2 0.0 906 61 4 722 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / DH10B)
C4ZZY9 0.0 906 61 4 722 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / MC4100 / BW2952)
B7LF13 0.0 906 61 4 722 3 aas Bifunctional protein Aas Escherichia coli (strain 55989 / EAEC)
A7ZQU2 0.0 906 61 4 722 3 aas Bifunctional protein Aas Escherichia coli O139:H28 (strain E24377A / ETEC)
B5Z4F4 0.0 905 61 3 716 3 aas Bifunctional protein Aas Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6J8 0.0 905 61 3 716 3 aas Bifunctional protein Aas Escherichia coli O157:H7
C0PXJ8 0.0 905 61 3 715 3 aas Bifunctional protein Aas Salmonella paratyphi C (strain RKS4594)
B4TGR5 0.0 905 60 3 715 3 aas Bifunctional protein Aas Salmonella heidelberg (strain SL476)
B5QWU2 0.0 905 60 3 715 3 aas Bifunctional protein Aas Salmonella enteritidis PT4 (strain P125109)
Q57KA7 0.0 905 61 3 715 3 aas Bifunctional protein Aas Salmonella choleraesuis (strain SC-B67)
Q83JV7 0.0 904 61 4 722 3 aas Bifunctional protein Aas Shigella flexneri
Q0T128 0.0 904 61 4 722 3 aas Bifunctional protein Aas Shigella flexneri serotype 5b (strain 8401)
Q8Z406 0.0 904 60 3 715 3 aas Bifunctional protein Aas Salmonella typhi
A9N3H8 0.0 904 60 3 715 3 aas Bifunctional protein Aas Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T503 0.0 904 60 3 715 3 aas Bifunctional protein Aas Salmonella newport (strain SL254)
B5F4V4 0.0 904 60 3 715 3 aas Bifunctional protein Aas Salmonella agona (strain SL483)
B1LR34 0.0 904 61 4 722 3 aas Bifunctional protein Aas Escherichia coli (strain SMS-3-5 / SECEC)
Q8ZMA4 0.0 904 60 3 715 3 aas Bifunctional protein Aas Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUM9 0.0 904 60 3 715 3 aas Bifunctional protein Aas Salmonella schwarzengrund (strain CVM19633)
B5BFH6 0.0 904 60 3 715 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain AKU_12601)
Q5PEN7 0.0 904 60 3 715 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1R7H5 0.0 902 60 4 722 3 aas Bifunctional protein Aas Escherichia coli (strain UTI89 / UPEC)
Q0TDZ6 0.0 902 60 4 722 3 aas Bifunctional protein Aas Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AF47 0.0 902 60 4 722 3 aas Bifunctional protein Aas Escherichia coli O1:K1 / APEC
B7MLI2 0.0 902 60 4 722 3 aas Bifunctional protein Aas Escherichia coli O45:K1 (strain S88 / ExPEC)
B5RDY6 0.0 902 60 3 715 3 aas Bifunctional protein Aas Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FUB9 0.0 900 60 3 715 3 aas Bifunctional protein Aas Salmonella dublin (strain CT_02021853)
A6TDH2 0.0 895 60 3 716 3 aas Bifunctional protein Aas Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XUP2 0.0 892 60 3 716 3 aas Bifunctional protein Aas Klebsiella pneumoniae (strain 342)
Q7N7A9 0.0 813 61 3 626 3 aas Bifunctional protein Aas Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O07610 4.85e-39 155 29 18 489 2 lcfB Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
Q8ZES9 9.5e-34 140 32 15 359 3 fadD Long-chain-fatty-acid--CoA ligase Yersinia pestis
P38135 1.56e-31 133 30 10 348 1 fadK Medium-chain fatty-acid--CoA ligase Escherichia coli (strain K12)
P63521 3.49e-31 132 28 21 488 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63522 3.49e-31 132 28 21 488 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhi
Q8XDR6 7.86e-30 128 27 21 487 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O157:H7
P69451 6.13e-29 125 27 21 495 1 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli (strain K12)
P69452 6.13e-29 125 27 21 495 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B2KWI3 1.2e-27 122 26 17 514 2 SID4 Acyl-CoA ligase SID4 Ajellomyces capsulatus
Q4WR83 1.38e-27 121 24 12 543 2 sidI Acyl-CoA ligase sidI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P94547 6.24e-27 119 26 22 503 3 lcfA Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
P46450 1.49e-26 118 29 14 356 3 fadD Long-chain-fatty-acid--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
S5M744 3.51e-26 116 25 15 474 1 fcs Feruloyl-CoA synthase Streptomyces sp.
Q9EY88 3.51e-26 116 25 15 474 1 fcs Feruloyl-CoA synthase Amycolatopsis sp.
Q499N5 1.05e-25 116 26 12 378 2 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Rattus norvegicus
O31826 1.2e-25 115 28 14 357 3 yngI Putative acyl-CoA synthetase YngI Bacillus subtilis (strain 168)
Q0S7V5 2.27e-25 114 30 13 351 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Rhodococcus jostii (strain RHA1)
P96843 2.46e-25 114 26 15 487 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q84P26 4.66e-25 113 28 10 352 2 4CLL8 4-coumarate--CoA ligase-like 8 Arabidopsis thaliana
Q8VCW8 6.95e-25 113 26 11 368 1 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Mus musculus
Q54P79 1.55e-24 112 25 16 495 3 4cl3 Probable 4-coumarate--CoA ligase 3 Dictyostelium discoideum
A0A6B9HER0 1.73e-24 112 27 11 361 1 None Piperic acid--CoA ligase Piper nigrum
Q4R4Z9 3.24e-24 111 26 12 388 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Macaca fascicularis
Q9AJS8 3.25e-24 110 25 13 481 1 hcl 3-hydroxybenzoate--CoA/4-hydroxybenzoate--CoA ligase Thauera aromatica
Q0K844 4.85e-24 110 26 8 354 2 sauT Sulfoacetate--CoA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q84P21 6.39e-24 110 27 14 354 1 4CLL5 Peroxisomal OPC-8:0-CoA ligase 1 Arabidopsis thaliana
M4IQR7 8.17e-24 109 27 13 366 2 CCL5 Probable CoA ligase CCL5 Humulus lupulus
Q54P77 1.55e-23 108 28 10 351 3 4cl1 Probable 4-coumarate--CoA ligase 1 Dictyostelium discoideum
Q84P25 2.72e-23 108 27 12 364 2 4CLL2 4-coumarate--CoA ligase-like 2 Arabidopsis thaliana
Q9S777 4.8e-23 107 28 17 445 1 4CL3 4-coumarate--CoA ligase 3 Arabidopsis thaliana
Q10S72 6.7e-23 107 27 19 437 2 4CLL4 4-coumarate--CoA ligase-like 4 Oryza sativa subsp. japonica
Q96CM8 6.94e-23 107 26 12 372 1 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Homo sapiens
Q54P78 1.03e-22 106 27 10 360 3 4cl2 Probable 4-coumarate--CoA ligase 2 Dictyostelium discoideum
Q17QJ1 1.66e-22 106 26 11 370 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Bos taurus
P39062 2.6e-22 105 24 18 509 1 acsA Acetyl-coenzyme A synthetase Bacillus subtilis (strain 168)
Q0P4F7 7.08e-22 103 26 13 367 2 acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Danio rerio
P41636 7.09e-22 103 26 14 428 2 4CL 4-coumarate--CoA ligase Pinus taeda
O24145 7.69e-22 103 24 18 522 2 4CL1 4-coumarate--CoA ligase 1 Nicotiana tabacum
M4IS90 1.48e-21 103 28 8 296 2 CCL8 Probable CoA ligase CCL8 Humulus lupulus
Q5R9G9 1.81e-21 102 25 13 394 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Pongo abelii
I3PB37 1.96e-21 102 23 16 521 1 4CL1 4-coumarate:CoA ligase 1 Petunia hybrida
P9WQ61 2.84e-21 102 31 5 272 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ60 2.84e-21 102 31 5 272 3 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXK7 2.84e-21 102 31 5 272 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0C5B6 3.02e-21 101 27 12 362 2 4CLL4 OPC-6:CoA ligase Arabidopsis thaliana
Q7WSH3 3.05e-21 101 25 13 412 3 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Comamonas testosteroni
P0DX84 3.09e-21 101 24 10 363 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria lacuscaerulensis (strain DSM 11314 / KCTC 2953 / ITI-1157)
P38137 5.05e-21 101 25 17 469 1 PCS60 Oxalate--CoA ligase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
M4IQQ7 6.49e-21 100 25 19 470 2 CCL9 Probable CoA ligase CCL9 Humulus lupulus
Q5LRT0 1.03e-20 100 25 12 363 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q84P23 1.4e-20 99 30 12 319 1 4CLL9 4-coumarate--CoA ligase-like 9 Arabidopsis thaliana
Q3E6Y4 2.58e-20 99 28 13 365 2 4CLL3 4-coumarate--CoA ligase-like 3 Arabidopsis thaliana
Q8H151 3.71e-20 98 26 9 317 1 AAE13 Malonate--CoA ligase Arabidopsis thaliana
Q27757 4.99e-20 97 24 10 369 2 None Luciferin 4-monooxygenase Photuris pensylvanica
Q0DV32 6.04e-20 97 24 14 481 2 4CLL1 4-coumarate--CoA ligase-like 1 Oryza sativa subsp. japonica
Q9S725 7.87e-20 97 25 14 422 1 4CL2 4-coumarate--CoA ligase 2 Arabidopsis thaliana
Q5P603 9.28e-20 97 26 12 358 1 iaaB Indoleacetate--CoA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
M4IRL6 1.02e-19 97 27 14 379 2 CCL7 Probable CoA ligase CCL7 Humulus lupulus
Q84P24 1.38e-19 96 24 14 439 1 4CLL6 4-coumarate--CoA ligase-like 6 Arabidopsis thaliana
A0A2H5AIX5 1.78e-19 96 26 16 432 2 4CL1 4-coumarate-CoA ligase 1 Narcissus pseudonarcissus
B2HIL6 2.27e-19 96 27 4 272 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium marinum (strain ATCC BAA-535 / M)
M4IQS1 2.31e-19 95 24 13 437 2 CCL10 Probable CoA ligase CCL10 Humulus lupulus
P13129 2.57e-19 95 26 14 376 1 None Luciferin 4-monooxygenase Nipponoluciola cruciata
Q9FFE6 2.76e-19 95 27 15 391 1 AAE5 Probable acyl-activating enzyme 5, peroxisomal Arabidopsis thaliana
Q42982 2.82e-19 95 27 19 492 1 4CL2 4-coumarate--CoA ligase 2 Oryza sativa subsp. japonica
Q838K1 3.62e-19 94 25 10 359 3 menE 2-succinylbenzoate--CoA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
P08659 3.86e-19 95 23 17 500 1 None Luciferin 4-monooxygenase Photinus pyralis
Q8GQN9 4.63e-19 94 28 12 367 1 bclA Benzoate--CoA ligase Thauera aromatica
Q58DN7 7.54e-19 94 26 15 399 2 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Bos taurus
O74976 8.9e-19 94 24 10 350 1 pcs60 Oxalate--CoA ligase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3URE1 9.64e-19 94 28 17 389 1 Acsf3 Malonate--CoA ligase ACSF3, mitochondrial Mus musculus
O80658 9.65e-19 94 28 18 382 2 AEE4 Probable acyl-activating enzyme 4 Arabidopsis thaliana
Q00594 1.59e-18 93 25 10 364 1 alkK Medium-chain-fatty-acid--CoA ligase Pseudomonas oleovorans
K0E2F3 2.35e-18 92 27 18 480 1 ecdI Fatty-acyl-AMP ligase ecdI Aspergillus rugulosus
Q42524 2.5e-18 92 25 22 550 1 4CL1 4-coumarate--CoA ligase 1 Arabidopsis thaliana
P40871 3.6e-18 92 25 10 363 1 dhbE 2,3-dihydroxybenzoate-AMP ligase Bacillus subtilis (strain 168)
P31685 3.76e-18 92 25 16 493 3 4CL2 4-coumarate--CoA ligase 2 Solanum tuberosum
M4ISH0 3.9e-18 92 24 15 432 1 CCL1 4-coumarate--CoA ligase CCL1 Humulus lupulus
Q26304 4.45e-18 92 22 19 533 1 None Luciferin 4-monooxygenase Luciola mingrelica
Q53005 5.04e-18 91 25 18 505 1 hbaA 4-hydroxybenzoate--CoA/benzoate--CoA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q01158 5.45e-18 91 25 14 376 2 None Luciferin 4-monooxygenase Aquatica lateralis
Q9FFE9 5.54e-18 91 26 17 391 2 AAE6 Probable acyl-activating enzyme 6 Arabidopsis thaliana
Q9SMT7 6.16e-18 91 24 20 488 1 AAE3 Oxalate--CoA ligase Arabidopsis thaliana
Q8VYJ1 8.31e-18 91 27 13 396 1 AAE14 2-succinylbenzoate--CoA ligase, chloroplastic/peroxisomal Arabidopsis thaliana
W3X8X8 9.56e-18 92 25 14 406 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
Q4G176 1.35e-17 90 26 16 386 1 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Homo sapiens
Q9LQS1 1.47e-17 90 26 15 382 2 AAE8 Probable acyl-activating enzyme 8 Arabidopsis thaliana
P31684 1.59e-17 90 25 16 493 3 4CL1 4-coumarate--CoA ligase 1 Solanum tuberosum
A0A0H2ZF83 1.86e-17 90 25 10 364 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain UCBPP-PA14)
Q17577 2.34e-17 89 27 15 385 1 acs-7 Acyl-CoA synthetase 7 Caenorhabditis elegans
Q6ETN3 2.51e-17 89 27 10 311 1 4CL3 4-coumarate--CoA ligase 3 Oryza sativa subsp. japonica
Q8KBY0 2.59e-17 89 25 11 372 3 acsA Acetyl-coenzyme A synthetase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
O07899 3.25e-17 89 24 13 376 3 vibE Vibriobactin-specific 2,3-dihydroxybenzoate-AMP ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
S3DB78 3.7e-17 89 24 18 528 1 gloD Acyl-CoA ligase gloD Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q84HC5 5.27e-17 88 26 22 517 1 ncsB2 2-hydroxy-7-methoxy-5-methyl-1-naphthoate--CoA ligase Streptomyces carzinostaticus
Q5SKN9 5.29e-17 88 28 20 388 1 TTHA0604 Long-chain-fatty-acid--CoA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B8NI19 6.97e-17 89 28 13 298 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 1.54e-10 68 26 11 287 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 5.2e-09 63 25 12 316 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
P33121 1.05e-16 88 23 24 573 1 ACSL1 Long-chain-fatty-acid--CoA ligase 1 Homo sapiens
A2R6H0 1.18e-16 88 27 13 318 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H0 5.85e-10 67 23 12 377 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A0U1LQE6 1.21e-16 89 25 11 392 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 1.6e-06 55 21 10 287 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
P14912 1.21e-16 87 26 15 427 2 4CL1 4-coumarate--CoA ligase 1 Petroselinum crispum
Q9I4X3 1.43e-16 87 27 15 388 1 pqsA Anthranilate--CoA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HWG3 1.55e-16 87 25 10 364 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q53FZ2 1.78e-16 87 26 13 383 1 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Homo sapiens
Q5REV5 1.9e-16 87 26 13 383 2 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Pongo abelii
P14913 2.24e-16 86 26 15 427 2 4CL2 4-coumarate--CoA ligase 2 Petroselinum crispum
M4ISH2 2.42e-16 86 24 24 526 2 CCL11 Probable CoA ligase CCL11 Humulus lupulus
Q5SIW6 2.44e-16 86 23 20 538 3 acsA Acetyl-coenzyme A synthetase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72J95 2.57e-16 86 23 20 538 3 acsA Acetyl-coenzyme A synthetase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q8XBV3 2.71e-16 86 23 11 372 3 entE Enterobactin synthase component E Escherichia coli O157:H7
Q9M0X9 2.81e-16 86 26 12 323 1 4CLL7 4-coumarate--CoA ligase-like 7 Arabidopsis thaliana
O24146 2.82e-16 86 25 16 486 1 4CL2 4-coumarate--CoA ligase 2 Nicotiana tabacum
Q96V34 3.03e-16 87 26 11 329 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 1.19e-10 69 26 9 285 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
P10378 4.32e-16 85 23 12 391 1 entE Enterobactin synthase component E Escherichia coli (strain K12)
Q6GLK6 4.38e-16 85 25 13 388 2 acsf3 Malonate--CoA ligase ACSF3, mitochondrial Xenopus laevis
A0B8F1 4.6e-16 85 25 12 365 1 acsA Acetyl-coenzyme A synthetase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q8CS21 5.88e-16 84 24 22 485 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A0A2I2F2N6 6.31e-16 86 26 12 316 1 cfoA Chalcone synthase cfoA Aspergillus candidus
W7L9F0 7.12e-16 85 25 14 356 3 FUM16 Acyl-CoA synthetase FUM16 Gibberella moniliformis (strain M3125 / FGSC 7600)
C0SPB0 9.31e-16 84 27 13 364 3 ytcI Uncharacterized acyl--CoA ligase YtcI Bacillus subtilis (strain 168)
Q8LPS1 1.04e-15 84 28 9 325 1 LACS6 Long chain acyl-CoA synthetase 6, peroxisomal Arabidopsis thaliana
A0A0A2J5U8 1.05e-15 84 25 6 301 3 cnsG Acyl-CoA ligase cnsG Penicillium expansum
Q91WC3 1.05e-15 84 22 21 583 1 Acsl6 Long-chain-fatty-acid--CoA ligase 6 Mus musculus
I3PB36 1.09e-15 84 23 21 520 1 CNL Trans-cinnamate:CoA ligase, peroxisomal Petunia hybrida
Q6TNA5 1.13e-15 84 28 13 360 1 CmaA L-allo-isoleucine:holo-[CmaA peptidyl-carrier protein] ligase Pseudomonas savastanoi pv. glycinea
Q92AY8 1.23e-15 84 25 11 348 3 menE 2-succinylbenzoate--CoA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
I1SAJ7 1.4e-15 85 26 11 300 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 2.49e-08 61 27 13 288 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 7.13e-06 53 21 9 295 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P58730 1.54e-15 83 25 13 352 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P31687 1.61e-15 84 28 9 311 2 None 4-coumarate--CoA ligase 2 Glycine max
Q70LM5 1.69e-15 85 26 16 404 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 2.99e-10 68 24 18 395 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 7.24e-07 57 25 17 371 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 9.03e-07 56 23 14 372 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 9.2e-06 53 24 12 354 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 0.000152 49 23 14 356 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q5HNB2 1.9e-15 83 24 23 494 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9CMW1 1.91e-15 84 25 14 384 3 acsA Acetyl-coenzyme A synthetase Pasteurella multocida (strain Pm70)
A0A2H5AIY4 2.08e-15 83 29 11 314 2 4CL2 4-coumarate-CoA ligase 2 Narcissus pseudonarcissus
Q71YZ5 2.33e-15 82 25 14 354 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serotype 4b (strain F2365)
Q336M7 2.7e-15 83 28 11 312 3 4CLL2 4-coumarate--CoA ligase-like 2 Oryza sativa subsp. japonica
Q9LU36 2.98e-15 83 26 10 315 1 4CL4 4-coumarate--CoA ligase 4 Arabidopsis thaliana
O24540 3.19e-15 82 25 18 500 2 4CL 4-coumarate--CoA ligase Vanilla planifolia
Q6BS00 3.37e-15 83 22 20 553 3 ACS2 Acetyl-coenzyme A synthetase 2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q1IAK8 4.03e-15 82 25 11 383 1 pmsE Pseudomonine synthase PmsE Pseudomonas entomophila (strain L48)
Q8NVZ4 4.13e-15 82 23 18 490 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MW2)
Q6G8D6 4.13e-15 82 23 18 490 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MSSA476)
C0LTL9 4.19e-15 82 26 11 367 1 sibE 3-hydroxy-4-methylanthranilate adenylyltransferase Streptosporangium sibiricum
P17814 4.83e-15 82 26 18 473 1 4CL1 4-coumarate--CoA ligase 1 Oryza sativa subsp. japonica
P33124 5.57e-15 82 23 15 501 1 Acsl6 Long-chain-fatty-acid--CoA ligase 6 Rattus norvegicus
Q2YTP0 6.89e-15 81 23 18 490 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
P9WQ37 7.78e-15 81 23 16 462 1 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ36 7.78e-15 81 23 16 462 3 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8J2R0 8.25e-15 81 25 12 384 3 FUM10 Acyl-CoA synthetase FUM10 Gibberella moniliformis (strain M3125 / FGSC 7600)
O05598 9.96e-15 81 26 11 319 1 pks16 Putative ligase Rv1013 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7X279 1.1e-14 81 24 15 502 1 sdgA Salicylyl-CoA synthase / salicylate adenylyltransferase Streptomyces sp.
P9WEP7 1.44e-14 82 27 11 288 1 None PF 1022-synthetase Rosellinia sp.
A0A098D1P1 1.46e-14 82 26 12 328 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 1.48e-12 75 25 13 395 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 4.92e-09 63 24 14 365 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 5.15e-08 60 22 16 401 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6GFR0 1.92e-14 80 23 18 500 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MRSA252)
A1L1K7 2.04e-14 80 23 17 492 2 Acsbg2 Long-chain-fatty-acid--CoA ligase ACSBG2 Rattus norvegicus
Q65FT5 2.53e-14 79 26 16 360 3 menE 2-succinylbenzoate--CoA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q72YK9 2.63e-14 79 24 13 366 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q1BBA2 2.64e-14 79 26 20 403 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium sp. (strain MCS)
Q9ULC5 2.75e-14 80 22 23 547 1 ACSL5 Long-chain-fatty-acid--CoA ligase 5 Homo sapiens
P18163 2.79e-14 80 23 12 348 1 Acsl1 Long-chain-fatty-acid--CoA ligase 1 Rattus norvegicus
C5D6U5 3.03e-14 79 24 13 366 3 menE 2-succinylbenzoate--CoA ligase Geobacillus sp. (strain WCH70)
A0A1E3B0T2 3.04e-14 80 23 20 502 1 criC Nonribosomal peptide synthetase criC Aspergillus cristatus
A0A1E3B0T2 1.67e-07 58 26 9 277 1 criC Nonribosomal peptide synthetase criC Aspergillus cristatus
Q9UKU0 3.06e-14 80 23 14 414 1 ACSL6 Long-chain-fatty-acid--CoA ligase 6 Homo sapiens
Q9BEA2 3.73e-14 79 25 11 375 1 ACSM1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Bos taurus
P63526 4.38e-14 79 23 20 501 1 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain N315)
P63525 4.38e-14 79 23 20 501 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITW2 4.38e-14 79 23 20 501 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH9)
A6U2Q7 4.38e-14 79 23 20 501 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH1)
A7X3P0 4.38e-14 79 23 20 501 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6YYZ2 4.86e-14 79 26 11 368 3 4CLL3 4-coumarate--CoA ligase-like 3 Oryza sativa subsp. japonica
A8FGK6 5.11e-14 79 25 11 348 3 menE 2-succinylbenzoate--CoA ligase Bacillus pumilus (strain SAFR-032)
P0DUV4 5.4e-14 80 26 15 391 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 8.24e-12 73 25 15 374 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 3.83e-10 67 25 13 359 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 8.14e-09 63 24 13 360 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.72e-07 58 24 15 379 1 mpbA Malpibaldin synthetase Mortierella alpina
P27095 5.47e-14 79 22 11 361 1 acsA Acetyl-coenzyme A synthetase Methanothrix soehngenii
B7HTW3 6.14e-14 78 24 13 366 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH187)
O93800 9.17e-14 78 25 10 313 4 AKT1 Acyl-CoA ligase AKT1 Alternaria alternata
Q53634 9.17e-14 78 23 17 489 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus
A8Z4L9 9.17e-14 78 23 17 489 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300 / TCH1516)
A6QHX6 9.17e-14 78 23 17 489 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Newman)
Q5HEY2 9.17e-14 78 23 17 489 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain COL)
Q2G2V3 9.17e-14 78 23 17 489 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFU9 9.17e-14 78 23 17 489 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300)
A0A0S2E7V8 9.78e-14 79 26 18 393 1 invA3 Inactive atromentin synthetase invA3 Paxillus involutus
P59871 1.07e-13 78 22 14 379 3 acsA Acetyl-coenzyme A synthetase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9JID6 1.09e-13 78 24 15 407 2 ACSL1 Long-chain-fatty-acid--CoA ligase 1 Cavia porcellus
P9WQD1 1.13e-13 78 22 14 379 1 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD0 1.13e-13 78 22 14 379 3 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P96575 1.17e-13 77 23 17 486 3 ydaB Putative acyl--CoA ligase YdaB Bacillus subtilis (strain 168)
J5JV76 1.22e-13 79 26 10 301 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana (strain ARSEF 2860)
A7GU88 1.25e-13 77 21 20 528 3 menE 2-succinylbenzoate--CoA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5B7I5 1.53e-13 78 25 9 287 2 inpA Nonribosomal peptide synthase inpA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0R3D6 1.54e-13 77 25 10 319 1 MSMEG_5435 Putative ligase MSMEG_5435/MSMEI_5285 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q67W82 1.6e-13 77 26 9 311 1 4CL4 4-coumarate--CoA ligase 4 Oryza sativa subsp. japonica
A0A1R3RGK1 1.84e-13 78 27 8 300 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
A0A1R3RGK1 7.21e-08 60 23 13 358 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
O13440 1.91e-13 77 22 20 521 2 ACS-1 Acetyl-coenzyme A synthetase Coprinopsis cinerea
W7NDP3 1.95e-13 77 26 10 288 2 FVEG_12633 CoA ligase FVEG_12633 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q6HC29 2.01e-13 77 24 12 362 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JDD6 2.43e-13 76 24 12 366 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH820)
B9J2F2 2.62e-13 76 24 13 362 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain Q1)
A0A8F4S6Z6 2.74e-13 77 26 19 388 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
C3LB87 2.83e-13 76 24 12 366 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PCK3 2.83e-13 76 24 12 366 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain A0248)
Q55DR6 2.83e-13 77 23 16 447 1 fcsA Fatty acyl-CoA synthetase A Dictyostelium discoideum
A0A017SQ41 2.93e-13 77 22 16 489 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
A0A017SQ41 6.06e-09 63 24 13 394 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
G3GBU7 3.05e-13 77 26 11 309 3 None Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella intermedia
A4G3L8 3.17e-13 77 27 18 391 3 acsA Acetyl-coenzyme A synthetase Herminiimonas arsenicoxydans
Q81K97 3.21e-13 76 24 12 366 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis
S0EN43 3.65e-13 77 25 10 300 2 BEA1 Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q9CHK3 3.81e-13 75 24 16 451 3 menE 2-succinylbenzoate--CoA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q816I1 3.84e-13 75 21 17 538 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q4R4P9 3.86e-13 76 23 11 375 2 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Macaca fascicularis
Q8NJN3 3.99e-13 76 23 23 554 1 ACS2 Acetyl-coenzyme A synthetase 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q6ZAC1 4.21e-13 76 26 11 296 1 4CL5 4-coumarate--CoA ligase 5 Oryza sativa subsp. japonica
P9WQ53 4.52e-13 76 30 5 186 3 fadD11 Putative fatty-acid--CoA ligase fadD11 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ52 4.52e-13 76 30 5 186 3 fadD11 Putative fatty-acid--CoA ligase fadD11 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
G3J455 4.9e-13 76 24 19 437 1 cm3C Acyl-CoA ligase cm3C Cordyceps militaris (strain CM01)
Q3UNX5 4.93e-13 75 26 13 380 1 Acsm3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Mus musculus
B6D9A8 5.01e-13 77 23 14 394 1 Beas Beauvericin nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
M4IQQ5 5.35e-13 75 23 22 518 1 CCL4 2-methylpropanoate--CoA ligase CCL4 Humulus lupulus
A0R5G1 5.8e-13 76 23 14 382 3 acsA Acetyl-coenzyme A synthetase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0RK73 6.02e-13 75 24 12 362 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis (strain Al Hakam)
Q5B7J0 6.22e-13 75 26 18 490 2 inpC Acyl-CoA ligase inpC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0S1RUN4 6.47e-13 76 24 16 390 1 invA2 Atromentin synthetase invA2 Paxillus involutus
Q4WF61 7.13e-13 76 24 11 378 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WF61 4.16e-12 73 25 12 366 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P41216 7.17e-13 75 23 12 348 1 Acsl1 Long-chain-fatty-acid--CoA ligase 1 Mus musculus
O88813 7.35e-13 75 22 21 546 1 Acsl5 Long-chain-fatty-acid--CoA ligase 5 Rattus norvegicus
L0E2Z1 7.69e-13 76 26 12 373 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
L0E2Z1 6.1e-08 60 23 12 345 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
Q9LPK7 7.86e-13 75 26 18 404 2 AEE10 Probable acyl-activating enzyme 10 Arabidopsis thaliana
Q6AYT9 7.99e-13 75 25 22 493 2 Acsm5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Rattus norvegicus
A0A5K6CNB8 8.57e-13 75 26 15 382 1 posA Delta-poly-L-ornithine synthetase Acinetobacter baumannii (strain AB307-0294)
A8PDE3 9.68e-13 75 21 20 521 3 ACS-1 Acetyl-coenzyme A synthetase Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
P80436 9.94e-13 75 26 11 356 1 trsA Triostin synthetase I Streptomyces triostinicus
Q04747 1.03e-12 75 25 15 396 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
P0DX14 1.16e-12 74 24 18 476 1 scoC Fatty acid--[acyl-carrier-protein] ligase ScoC Streptomyces coeruleorubidus
Q9RRL7 1.2e-12 75 25 11 368 3 acsA Acetyl-coenzyme A synthetase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P0C063 1.28e-12 75 26 13 357 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 3.64e-06 54 21 22 516 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 0.000274 48 21 20 495 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
C8VPS9 1.33e-12 75 27 11 286 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 4.49e-07 57 24 12 331 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 5.7e-06 53 23 12 298 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
D1FVF0 1.34e-12 75 26 10 301 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
O95573 1.44e-12 74 23 13 454 1 ACSL3 Fatty acid CoA ligase Acsl3 Homo sapiens
Q96VB5 1.55e-12 74 25 9 287 3 AFT1-1 Acyl-CoA ligase AFT1-1 Alternaria alternata
P9WEQ8 1.67e-12 74 24 17 428 3 olcI Nicotinic acid-CoA ligase olcI Penicillium canescens
Q96VC7 1.79e-12 74 24 13 384 3 ACS2 Acetyl-coenzyme A synthetase 2 Zygosaccharomyces bailii
Q5KVX9 1.87e-12 73 24 15 369 3 menE 2-succinylbenzoate--CoA ligase Geobacillus kaustophilus (strain HTA426)
Q6FXI2 1.87e-12 74 23 14 396 3 ACS2 Acetyl-coenzyme A synthetase 2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q5R668 1.91e-12 74 23 13 454 2 ACSL3 Fatty acid CoA ligase Acsl3 Pongo abelii
Q4WLW5 1.91e-12 75 25 13 397 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 2.95e-08 61 22 11 301 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 9.35e-08 59 23 13 390 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P9WEV1 1.91e-12 75 25 14 390 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
P9WEV1 5.29e-11 70 25 17 389 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
Q96GR2 1.98e-12 74 23 11 376 1 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Homo sapiens
Q9Y7B5 2.02e-12 74 25 18 409 3 ACS2 Acetyl-coenzyme A synthetase 2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9R9J1 2.12e-12 75 25 18 427 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q9R9J1 1.07e-06 56 23 14 382 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
O93730 2.21e-12 74 24 14 384 3 acsA Acetyl-coenzyme A synthetase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A0A7L9EYL1 2.39e-12 74 25 16 384 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
P0DUV3 2.48e-12 74 25 15 384 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 5.82e-11 70 25 18 374 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 6.98e-07 57 24 14 371 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 9.57e-06 53 25 17 387 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 0.000411 47 24 14 367 1 mpcA Malpicyclin synthetase Mortierella alpina
A9VM74 2.49e-12 73 24 12 376 3 menE 2-succinylbenzoate--CoA ligase Bacillus mycoides (strain KBAB4)
Q9SFW5 2.55e-12 73 23 19 467 3 AEE21 Probable acyl-activating enzyme 21 Arabidopsis thaliana
A4YGR1 2.59e-12 73 21 19 498 1 Msed_1456 3-hydroxypropionyl-coenzyme A synthetase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q63NC4 2.75e-12 73 26 15 381 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain K96243)
A3NH07 2.75e-12 73 26 15 381 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 668)
Q3JH62 2.75e-12 73 26 15 381 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 1710b)
A3P2K7 2.75e-12 73 26 15 381 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 1106a)
A1UWN5 2.75e-12 73 26 15 381 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain SAVP1)
Q62AD1 2.75e-12 73 26 15 381 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain ATCC 23344)
A2RYW5 2.75e-12 73 26 15 381 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain NCTC 10229)
A3MG40 2.75e-12 73 26 15 381 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain NCTC 10247)
A0A0S2E7W7 2.85e-12 73 24 17 390 1 invA5 Atromentin synthetase invA5 Paxillus involutus
Q2KHW5 2.91e-12 73 24 9 318 2 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Bos taurus
A0A179H164 2.91e-12 74 27 16 366 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.21e-09 65 24 17 371 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 8.95e-08 60 24 14 405 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.51e-07 59 24 18 389 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 2.47e-07 58 26 12 287 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 7.57e-07 57 25 19 394 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 8.52e-07 56 21 10 283 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.12e-05 53 23 13 382 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 3.28e-05 51 24 13 307 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
Q54Z60 3.99e-12 73 21 17 549 3 acsA Acetyl-coenzyme A synthetase Dictyostelium discoideum
Q9VP61 4.32e-12 73 23 16 428 2 AcCoAS Acetyl-coenzyme A synthetase Drosophila melanogaster
P28812 4.79e-12 73 23 12 381 3 PA3568 Uncharacterized protein PA3568 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O35547 5.14e-12 73 25 13 333 1 Acsl4 Long-chain-fatty-acid--CoA ligase 4 Rattus norvegicus
Q5AUZ6 5.19e-12 73 24 14 391 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.97e-11 72 26 12 283 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.01e-10 69 24 11 315 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 9.42e-09 63 23 10 301 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 5.01e-08 60 22 17 396 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O60488 5.19e-12 73 25 13 333 1 ACSL4 Long-chain-fatty-acid--CoA ligase 4 Homo sapiens
Q0AFF1 5.32e-12 72 23 11 370 3 acsA Acetyl-coenzyme A synthetase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P9WES4 5.32e-12 73 25 14 363 1 None Nonribosomal peptide synthetase acyN Ascocoryne sarcoides
Q9CZW4 5.42e-12 72 22 14 454 1 Acsl3 Fatty acid CoA ligase Acsl3 Mus musculus
Q9QUJ7 5.51e-12 72 25 13 333 1 Acsl4 Long-chain-fatty-acid--CoA ligase 4 Mus musculus
Q8JZR0 5.73e-12 72 22 21 556 1 Acsl5 Long-chain-fatty-acid--CoA ligase 5 Mus musculus
A0A144KPJ6 5.74e-12 73 24 13 393 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 1.06e-08 62 24 12 304 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
Q2T3N9 6.14e-12 72 26 14 379 3 acsA Acetyl-coenzyme A synthetase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9R9J0 6.27e-12 73 25 12 354 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 3.05e-06 54 23 11 310 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
B6HJU6 6.43e-12 73 24 14 389 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HJU6 5.29e-09 63 20 18 530 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A1U9YHZ2 6.86e-12 73 27 13 373 2 verP Nonribosomal peptide synthetase verP Clonostachys rogersoniana
Q73ZP7 7.68e-12 72 26 18 375 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q63151 7.78e-12 72 22 14 454 1 Acsl3 Fatty acid CoA ligase Acsl3 Rattus norvegicus
C7ZBE4 7.79e-12 73 24 14 391 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 4.95e-09 63 24 11 319 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 8.89e-06 53 25 16 377 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
Q08AH1 7.9e-12 72 22 10 384 1 ACSM1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Homo sapiens
Q7NSY7 8.76e-12 72 24 11 379 3 acsA Acetyl-coenzyme A synthetase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A0A0A1EA36 9.03e-12 72 25 11 294 1 ESYN1 Enniatin synthetase Fusarium oxysporum
Q6Q883 9.71e-12 72 26 16 386 2 sirP Nonribosomal peptide synthetase sirP Leptosphaeria maculans
Q6Q883 5.63e-05 50 24 17 383 2 sirP Nonribosomal peptide synthetase sirP Leptosphaeria maculans
A0A1W6BT46 1.02e-11 72 24 10 313 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
A0A1W6BT46 6.55e-11 70 24 13 383 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
Q2XU92 1.03e-11 72 25 14 336 1 Acsbg2 Long-chain-fatty-acid--CoA ligase ACSBG2 Mus musculus
Q6NUN0 1.05e-11 71 25 15 396 1 ACSM5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Homo sapiens
Q9LPK6 1.07e-11 71 25 18 427 2 AEE9 Probable acyl-activating enzyme 9 Arabidopsis thaliana
A0A8F4S8Q3 1.14e-11 72 25 16 372 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
Q82SI5 1.24e-11 71 24 12 373 3 acsA Acetyl-coenzyme A synthetase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
C9K7B5 1.24e-11 72 26 18 383 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 7.32e-07 57 23 11 293 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 8.56e-06 53 24 13 288 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
A0A179HJB8 1.27e-11 70 26 6 258 2 lcsD Acyl-CoA ligase lcsD Purpureocillium lilacinum
B2HGV4 1.28e-11 71 37 3 121 3 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium marinum (strain ATCC BAA-535 / M)
G3XMC0 1.28e-11 71 27 17 362 2 azaF Acyl-CoA ligase azaF Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
O94205 1.33e-11 72 24 14 369 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
O94205 8.56e-10 66 26 13 325 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q6SKG1 1.46e-11 71 25 11 375 2 Acsm3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Rattus norvegicus
P0C064 1.6e-11 72 25 13 357 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 6.85e-07 57 21 21 513 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 0.000296 48 21 20 495 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
Q632I5 1.61e-11 70 23 12 362 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ZK / E33L)
I1RF49 1.75e-11 72 24 17 415 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 6.72e-09 63 21 23 514 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 2.55e-08 61 22 14 401 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 6.9e-05 50 22 11 290 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q52400 1.79e-11 71 26 15 380 1 syrB1 Syringomycin synthase SyrB1 Pseudomonas syringae pv. syringae
Q00869 1.8e-11 72 25 11 294 1 ESYN1 Enniatin synthase Fusarium equiseti
A0A2I1D2N0 1.83e-11 72 27 8 278 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.22e-10 69 23 12 380 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 6.97e-10 66 26 16 400 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 3.32e-09 64 26 20 409 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 2.61e-08 61 25 14 390 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.28e-05 52 24 15 392 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 2.97e-05 51 24 15 386 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
O70490 1.91e-11 70 23 17 494 2 Acsm2 Acyl-coenzyme A synthetase ACSM2, mitochondrial Rattus norvegicus
P78773 2.03e-11 70 27 17 376 1 SPCC191.02c Probable acetyl-coenzyme A synthetase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q99NB1 2.12e-11 70 22 22 519 1 Acss1 Acetyl-coenzyme A synthetase 2-like, mitochondrial Mus musculus
A0QUA1 2.23e-11 70 24 19 440 1 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O30409 2.34e-11 71 26 15 362 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.68e-10 68 26 17 368 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.61e-07 58 23 14 366 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 3.5e-07 57 25 17 368 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.26e-06 56 23 10 360 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
Q39EK2 2.38e-11 70 26 17 384 3 acsA Acetyl-coenzyme A synthetase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A0A3G9H9I5 2.56e-11 70 25 14 391 3 ALT10 Acyl-CoA synthetase ALT10 Alternaria alternata
Q01576 2.65e-11 70 22 13 389 2 facA Acetyl-coenzyme A synthetase Phycomyces blakesleeanus (strain ATCC 8743b / DSM 1359 / FGSC 10004 / NBRC 33097 / NRRL 1555)
Q1H0J2 2.83e-11 70 24 13 379 3 acsA Acetyl-coenzyme A synthetase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q99PU5 3.11e-11 70 23 11 327 1 Acsbg1 Long-chain-fatty-acid--CoA ligase ACSBG1 Mus musculus
Q53526 3.22e-11 70 25 14 374 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q27549 3.25e-11 70 24 14 398 3 ACS Acetyl-coenzyme A synthetase Cryptosporidium parvum
Q0CWD0 3.38e-11 70 27 12 300 1 apvA Nonribosomal peptide synthetase apvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
C1D6V9 3.67e-11 70 22 16 482 3 acsA Acetyl-coenzyme A synthetase Laribacter hongkongensis (strain HLHK9)
C1CB20 3.71e-11 69 24 13 374 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain 70585)
F8J3D9 3.83e-11 70 21 16 524 1 tmlU Marinolic acid--CoA ligase Pseudoalteromonas sp. (strain SANK 73390)
P59872 4.19e-11 70 22 17 456 3 acsA Acetyl-coenzyme A synthetase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q5SBL6 4.19e-11 70 25 18 407 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
I1RIV2 4.82e-11 70 25 17 448 2 NPS6 Nonribosomal peptide synthetase 6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9PB89 4.93e-11 69 24 16 390 3 acsA Acetyl-coenzyme A synthetase Xylella fastidiosa (strain 9a5c)
B5BL55 5.55e-11 69 24 19 482 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PIL0 5.55e-11 69 24 19 482 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q87C00 5.66e-11 69 24 16 390 3 acsA Acetyl-coenzyme A synthetase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q924N5 5.89e-11 69 23 11 327 1 Acsbg1 Long-chain-fatty-acid--CoA ligase ACSBG1 Rattus norvegicus
A1DN09 5.92e-11 70 25 12 321 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DN09 1.58e-05 52 24 12 287 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q8BGA8 6.12e-11 69 24 12 376 1 Acsm5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Mus musculus
K3VDP2 6.51e-11 70 23 9 280 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.06e-09 66 26 11 292 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 7.54e-09 63 22 15 387 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 5.35e-08 60 25 10 283 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 2.19e-05 52 22 13 402 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 8.7e-05 50 22 10 297 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
Q8RU95 6.53e-11 69 25 15 382 2 4CLL6 4-coumarate--CoA ligase-like 6 Oryza sativa subsp. japonica
Q1AXQ5 6.87e-11 69 22 14 381 3 acsA Acetyl-coenzyme A synthetase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
P80435 7.01e-11 68 25 11 343 1 acmA 3-hydroxy-4-methylanthranilate adenylyltransferase Streptomyces anulatus
C1CNE9 7.71e-11 68 24 13 374 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain P1031)
P0A399 7.71e-11 68 24 13 374 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A398 7.71e-11 68 24 13 374 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HZ7 7.71e-11 68 24 13 374 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A2QTE5 8.59e-11 68 26 18 377 3 epaB Phenylacetyl-CoA ligase epaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
M1W5Z4 9.98e-11 69 24 19 405 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 1.75e-10 68 26 14 346 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
S7ZFK6 1.01e-10 69 25 16 403 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
P44565 1.05e-10 68 26 11 322 3 menE 2-succinylbenzoate--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7XXL2 1.07e-10 68 26 12 311 2 4CLL9 4-coumarate--CoA ligase-like 9 Oryza sativa subsp. japonica
P16929 1.08e-10 68 22 19 526 2 acu-5 Acetyl-coenzyme A synthetase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P39518 1.12e-10 68 26 5 174 1 FAA2 Long-chain-fatty-acid--CoA ligase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
M1W0X8 1.17e-10 69 26 14 346 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 5.01e-10 67 25 17 328 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
C0Q4L3 1.26e-10 68 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi C (strain RKS4594)
Q554Z5 1.34e-10 68 25 16 393 3 aslB Acyl-CoA synthetase short-chain family member B, mitochondrial Dictyostelium discoideum
A0A1W5T1U1 1.35e-10 68 25 16 403 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
Q8ZRX4 1.43e-10 68 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TIH0 1.43e-10 68 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella heidelberg (strain SL476)
Q2PBY4 1.44e-10 68 26 14 345 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 6.86e-10 66 25 17 328 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
B5F750 1.48e-10 67 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella agona (strain SL483)
A0A318Z3U0 1.56e-10 68 23 18 413 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 7.76e-07 56 24 18 396 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
C1CU95 1.57e-10 67 24 13 374 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain Taiwan19F-14)
B8ZQ14 1.57e-10 67 24 13 374 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q750T7 1.62e-10 68 22 14 399 3 ACS2 Acetyl-coenzyme A synthetase 2 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
G4N137 1.66e-10 68 24 14 367 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q8VM67 1.77e-10 67 24 14 384 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus agalactiae serotype III (strain NEM316)
G3J456 1.83e-10 68 25 10 304 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 1.08e-08 62 23 12 341 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 1.82e-06 55 25 13 291 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
B5R1R0 1.96e-10 67 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella enteritidis PT4 (strain P125109)
A0A0S2E7W3 2e-10 68 25 19 416 2 invA6 Inactive atromentin synthetase invA6 Paxillus involutus
P59591 2e-10 67 24 14 384 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZ94 2e-10 67 24 14 384 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A7IFD4 2.07e-10 67 24 14 390 3 acsA Acetyl-coenzyme A synthetase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A0A2V5H0B0 2.11e-10 68 22 13 393 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 2.99e-08 61 24 17 396 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 6.85e-08 60 25 16 384 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 5.2e-06 54 21 13 407 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
B2JD61 2.26e-10 67 25 17 424 3 acsA Acetyl-coenzyme A synthetase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A9MYJ6 2.33e-10 67 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8DKH2 2.45e-10 67 22 9 372 3 acsA Acetyl-coenzyme A synthetase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A2TBU4 2.47e-10 68 26 14 332 2 lpsB D-lysergyl-peptide-synthetase subunit 2 Epichloe festucae var. lolii
Q8Z9L4 2.48e-10 67 22 21 549 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhi
Q9L9F6 2.49e-10 67 27 16 292 1 novL 8-demethylnovobiocic acid synthase Streptomyces niveus
P52910 2.63e-10 67 23 13 392 1 ACS2 Acetyl-coenzyme A synthetase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A0C1E6T8 2.78e-10 67 25 16 360 1 pboA Nonribosomal peptide synthetase pboA Aspergillus ustus
A4YDR9 2.9e-10 67 24 20 389 1 Msed_0394 4-hydroxybutyrate--CoA ligase 2 Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q0S4D7 2.9e-10 67 26 17 379 1 casI Steroid-22-oyl-CoA synthetase Rhodococcus jostii (strain RHA1)
B8NR69 2.97e-10 67 22 14 419 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NR69 2.64e-08 61 24 11 301 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q08787 3.02e-10 67 23 14 368 1 srfAC Surfactin synthase subunit 3 Bacillus subtilis (strain 168)
P16928 3.73e-10 67 24 13 375 2 facA Acetyl-coenzyme A synthetase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q82EL5 3.96e-10 67 23 13 371 3 acsA Acetyl-coenzyme A synthetase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B8EPJ0 4.03e-10 67 24 13 398 3 acsA Acetyl-coenzyme A synthetase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
P36333 4.21e-10 67 22 17 516 3 facA Acetyl-coenzyme A synthetase Penicillium chrysogenum
A7Z809 4.41e-10 66 25 13 300 3 menE 2-succinylbenzoate--CoA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P9WQ41 4.71e-10 66 23 17 400 1 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A4X9 4.71e-10 66 23 17 400 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4WYG2 4.8e-10 67 24 15 355 3 NRPS5 Nonribosomal peptide synthetase 5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WYG2 0.00012 49 24 15 388 3 NRPS5 Nonribosomal peptide synthetase 5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P9WQ40 4.88e-10 66 23 17 400 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A0S2E7X0 5.07e-10 66 23 17 365 2 invA4 Inactive atromentin synthetase invA4 Paxillus involutus
B4T6J6 5.15e-10 66 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella newport (strain SL254)
Q8K0L3 5.3e-10 66 24 14 418 1 Acsm2 Acyl-coenzyme A synthetase ACSM2, mitochondrial Mus musculus
C8VTR6 5.5e-10 66 26 13 357 3 AN10074 Putative acyl-coenzyme A synthetase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2UB01 5.52e-10 66 25 13 309 1 ppsA Acyl-CoA ligase ppsA Aspergillus oryzae (strain ATCC 42149 / RIB 40)
E9FCP4 5.65e-10 67 26 17 400 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 4.26e-09 64 25 12 356 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 4.24e-08 60 25 14 383 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 4.19e-06 54 21 8 330 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 2.74e-05 51 23 11 311 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 0.000234 48 25 13 324 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
B4TWR4 5.71e-10 66 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella schwarzengrund (strain CVM19633)
A0A0S6XHH0 5.8e-10 67 26 16 394 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 7.54e-10 66 25 15 397 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 9.01e-10 66 26 10 296 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 7.9e-09 63 25 15 331 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.4e-08 61 22 13 410 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.15e-07 59 23 9 292 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.48e-07 59 26 14 305 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 4.03e-07 57 23 15 376 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 8.71e-06 53 25 13 290 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 9.17e-06 53 23 12 388 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
Q7TN78 6.19e-10 66 24 11 372 1 Acsm4 Acyl-coenzyme A synthetase ACSM4, mitochondrial Rattus norvegicus
Q0CRX1 6.22e-10 66 26 15 310 1 melA Aspulvinone E synthetase melA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q70LM6 6.3e-10 67 24 13 365 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 5.9e-08 60 25 17 365 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 1.81e-07 58 24 14 358 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 0.000233 48 25 16 356 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q9NUB1 6.37e-10 66 22 23 527 1 ACSS1 Acetyl-coenzyme A synthetase 2-like, mitochondrial Homo sapiens
Q9V3S9 6.51e-10 66 21 10 310 1 bgm Very long-chain-fatty-acid--CoA ligase bubblegum Drosophila melanogaster
A0A336U965 7.44e-10 66 26 15 310 1 melA Aspulvinone E synthetase melA Aspergillus terreus
B8NY88 7.67e-10 66 27 20 412 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 0.000165 49 23 11 370 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 0.000471 47 23 16 381 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
K0E4D7 8.32e-10 66 25 15 391 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 2.47e-06 55 25 10 284 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 4.55e-06 54 24 9 296 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 6.94e-06 53 22 13 376 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 0.000321 48 23 10 288 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
Q5ZKR7 8.44e-10 65 22 11 345 2 ACSBG2 Long-chain-fatty-acid--CoA ligase ACSBG2 Gallus gallus
A0A1W6BT53 8.71e-10 66 23 15 376 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
A0A1W6BT53 4.85e-07 57 25 11 302 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
F8P1W3 9.36e-10 65 22 21 472 2 nps3 Atromentin synthetase nps3 Serpula lacrymans var. lacrymans (strain S7.9)
A0A395I3F8 9.38e-10 66 23 15 404 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 2.13e-08 62 24 17 387 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 4.27e-05 51 23 12 289 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
P40806 1.01e-09 66 23 14 373 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
B0CN26 1.04e-09 65 25 16 383 1 sfmB Nonribosomal peptide synthase SfmB Streptomyces lavendulae
Q9A2I0 1.09e-09 65 22 14 420 3 acsA Acetyl-coenzyme A synthetase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B7STY1 1.15e-09 65 23 15 395 1 atrA Atromentin synthetase Tapinella panuoides
C1AA44 1.2e-09 65 21 12 388 3 acsA Acetyl-coenzyme A synthetase Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q5BA81 1.31e-09 65 23 17 489 3 easD Acyl-CoA ligase easD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q88VM6 1.39e-09 64 24 16 370 3 dltA D-alanine--D-alanyl carrier protein ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q57TJ0 1.4e-09 64 23 17 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella choleraesuis (strain SC-B67)
B5FHG5 1.56e-09 64 22 17 473 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella dublin (strain CT_02021853)
Q70LM4 1.57e-09 65 27 19 396 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 8.19e-06 53 23 16 398 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
O30408 1.58e-09 65 25 13 358 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 8.36e-07 56 22 16 373 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
C8V7P4 1.6e-09 65 25 9 268 1 ivoA Nonribosomal peptide synthetase ivoA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
F9X9V1 1.73e-09 65 25 10 318 3 NRPS2 Nonribosomal peptide synthetase 2 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q0CS64 1.79e-09 65 26 17 360 3 ataP Nonribosomal peptide synthetase ataP Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A1L9NGU5 1.88e-09 65 22 17 411 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 4.49e-06 54 24 22 437 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 3.43e-05 51 23 10 290 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A319DV72 1.9e-09 65 24 11 301 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 4.69e-08 60 22 15 434 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319BQC1 2.01e-09 65 23 17 403 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 2.51e-07 58 25 13 295 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
Q9CAP8 2.02e-09 64 28 8 206 1 LACS9 Long chain acyl-CoA synthetase 9, chloroplastic Arabidopsis thaliana
Q9CAP8 3.73e-05 50 29 6 164 1 LACS9 Long chain acyl-CoA synthetase 9, chloroplastic Arabidopsis thaliana
K3VAW3 2.04e-09 64 24 10 253 3 FPSE_09184 Acyl-CoA ligase FPSE_09184 Fusarium pseudograminearum (strain CS3096)
A0A1M3T4K3 2.07e-09 65 23 13 304 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 1.06e-06 56 24 14 318 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 0.000137 49 22 15 392 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
Q973W5 2.07e-09 64 23 16 375 1 STK_07830 3-hydroxypropionyl-coenzyme A synthetase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
G7XQ31 2.08e-09 65 23 13 304 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 1.05e-06 56 24 14 318 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 0.000133 49 22 15 392 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
Q6P461 2.28e-09 63 26 10 290 1 ACSM6 Acyl-coenzyme A synthetase ACSM6, mitochondrial Homo sapiens
Q10896 2.33e-09 65 27 8 288 1 nrp Isonitrile lipopeptide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q02278 2.47e-09 64 21 17 500 3 fadD28 Long-chain-fatty-acid--AMP ligase FadD28 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P37418 2.54e-09 63 26 12 298 3 menE 2-succinylbenzoate--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P86832 2.55e-09 63 23 13 367 1 fcbA2 4-chlorobenzoate--CoA ligase Arthrobacter sp.
P86831 2.55e-09 63 23 13 367 1 fcbA1 4-chlorobenzoate--CoA ligase Arthrobacter sp.
Q46Z41 2.61e-09 64 25 15 383 3 acsA Acetyl-coenzyme A synthetase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9ES38 2.64e-09 64 26 11 303 1 Slc27a5 Long-chain fatty acid transport protein 5 Rattus norvegicus
Q6MNF1 2.66e-09 64 22 13 382 3 acsA Acetyl-coenzyme A synthetase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B4EY25 2.76e-09 63 24 14 353 3 caiC Crotonobetaine/carnitine--CoA ligase Proteus mirabilis (strain HI4320)
B8NHE4 3e-09 64 24 14 382 1 flvI Nonribosomal peptide synthetase flvI Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A0S2E7Z1 3.34e-09 64 23 22 476 1 invA1 Atromentin synthetase invA1 Paxillus involutus
Q4WT66 3.56e-09 64 23 11 309 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 9.06e-09 63 22 12 388 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 1.52e-08 62 23 15 398 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01780
Feature type CDS
Gene aas
Product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
Location 421591 - 423750 (strand: 1)
Length 2160 (nucleotides) / 719 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2031
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00501 AMP-binding enzyme
PF01553 Acyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0318 Lipid transport and metabolism (I) I O-succinylbenzoic acid-CoA ligase MenE or related acyl-CoA synthetase (AMP-forming)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05939 acyl-[acyl-carrier-protein]-phospholipid O-acyltransferase / long-chain-fatty-acid--[acyl-carrier-protein] ligase [EC:2.3.1.40 6.2.1.20] Fatty acid degradation
Glycerophospholipid metabolism		 -

Protein Sequence

MMLIAFFKTLFKFLFRVRIEGLINQFSQYEKCIITPNHTSFIDGILLRLFLPINPVFAVYTSVANAKHTKWLSRYADIVPLDPANPMAVRQLVKEVDKGRPVVIFPEGRITVTIGLMKIYEGAAFIAAKSGAKVIPVRIEGAEFSYFSRVHKTLNIKAKLFPKITIKVLPAVDLPMPTAEKSAERRRLSGEKLRDIMMDAIMQARPNITLYEAFLQGMSQFGRFSPLISDINMKEDSYQGLLKKILGVSRIIERYTEPNERIGLLLPNTTVTVAALFGATMRQRVVAMLNYTAGSLGVQNAMKAASIKTIFTSRQFLEKGNLLHIPEQTPDANWVYLEDLKDSITREDKRWIAQHLLTPHKAMLAQKSTDAAVILFTSGSEGTPKGVVHSHSSLLANVEQIRAIADFSPRDKFMAALPLFHAFGLTVSVLAPICLGARVFLYPSPLHYRVVPELVYDQNCIVLFGTSTFLGNYGKFAHPYDFARLRYVVAGAEKLSESTRVLWQDKFGIRILEGYGVTECAPVVSINVPMSAKPYTVGRLLPGMEGRLIPISGITDGGRLQLRGPNIMLGYLRVESPYKLEQPTAINAEGIEEVGWYDTGDIVAIDSEGFCTIKGRVKRFAKIAGEMVSLESVEQLAAKASEGNHAVVAVNDPRRGESLVLFTTDKQLDRSMLSALAKSTGVAEIAVPKDIRFLKEIPVLGSGKTDFVSLKQLAEQENN

Flanking regions ( +/- flanking 50bp)

ATCATATCCTATTTATAGTAAGGCTAATTATAGCAAAATGAGATATGGATATGATGTTGATAGCGTTTTTTAAAACACTATTTAAATTCTTATTTCGAGTAAGAATTGAAGGACTAATTAATCAGTTTTCACAATATGAAAAATGCATTATTACGCCAAATCATACATCGTTTATTGATGGTATATTATTGCGTTTATTTTTACCGATTAACCCTGTCTTTGCTGTTTACACCTCAGTGGCTAATGCCAAACATACCAAATGGCTCAGTCGTTATGCGGATATTGTTCCTTTAGATCCCGCTAATCCAATGGCGGTTCGCCAATTAGTTAAAGAAGTCGATAAAGGCCGTCCTGTTGTTATTTTCCCTGAAGGGAGAATTACGGTAACTATTGGTTTGATGAAGATTTATGAAGGTGCTGCGTTTATTGCTGCTAAATCAGGGGCAAAAGTTATCCCTGTTAGAATAGAAGGTGCTGAATTTAGCTACTTTTCTCGAGTGCATAAAACGTTAAATATAAAAGCAAAGCTCTTTCCTAAAATCACAATAAAAGTGCTACCTGCGGTTGATTTACCTATGCCTACAGCGGAAAAATCAGCAGAGCGCCGTCGCTTATCGGGAGAAAAGCTCCGTGATATTATGATGGATGCTATTATGCAAGCACGTCCTAATATCACGCTCTATGAGGCATTTTTACAAGGAATGTCTCAGTTTGGTCGTTTCAGTCCTCTTATTTCAGATATTAATATGAAAGAGGATAGTTATCAGGGCCTATTGAAAAAAATATTAGGTGTTAGTCGTATTATTGAACGCTATACCGAACCTAATGAACGAATTGGCCTTTTACTTCCTAATACTACCGTTACGGTTGCGGCTTTATTTGGGGCAACGATGCGCCAACGGGTTGTGGCGATGCTTAACTATACTGCGGGTAGCTTAGGTGTACAAAATGCCATGAAAGCGGCATCCATTAAAACGATTTTTACCTCACGCCAATTTTTAGAGAAAGGAAATTTATTACATATTCCAGAACAGACTCCGGATGCAAACTGGGTTTATCTTGAAGATCTCAAAGATAGCATTACTAGAGAAGATAAACGCTGGATTGCACAGCACTTACTCACTCCTCATAAAGCGATGTTAGCGCAAAAATCGACGGATGCAGCAGTTATCTTATTTACTTCTGGATCTGAAGGCACTCCGAAAGGTGTCGTTCATAGCCACTCCAGTTTATTGGCGAATGTAGAGCAAATTCGCGCTATTGCTGACTTTTCACCCAGAGATAAATTTATGGCTGCATTACCGTTATTCCATGCTTTCGGTTTAACGGTAAGTGTATTAGCACCTATCTGCTTAGGGGCACGAGTATTCCTCTACCCAAGCCCACTACATTATCGTGTAGTACCTGAATTAGTGTATGACCAAAATTGTATAGTATTATTTGGTACTTCAACTTTCTTAGGTAATTATGGCAAATTTGCTCATCCTTATGATTTTGCTCGACTAAGATATGTGGTTGCAGGGGCGGAAAAACTGTCCGAATCGACACGAGTATTATGGCAGGATAAATTTGGTATTCGTATTTTAGAAGGTTATGGGGTCACTGAATGTGCTCCTGTTGTCTCCATTAATGTACCAATGAGTGCTAAGCCATATACCGTGGGGCGTTTATTACCAGGCATGGAAGGGCGTTTAATTCCCATAAGCGGCATTACGGATGGTGGAAGATTACAACTGCGTGGTCCTAATATCATGCTTGGCTATTTGCGCGTTGAGTCCCCTTATAAATTAGAACAGCCTACAGCAATAAATGCCGAAGGCATCGAAGAAGTGGGTTGGTATGATACGGGAGATATCGTTGCTATTGATAGCGAAGGTTTTTGCACTATTAAAGGGCGTGTAAAACGTTTTGCAAAAATAGCGGGAGAAATGGTTTCTCTTGAAAGTGTAGAGCAATTAGCGGCTAAAGCCTCGGAAGGCAACCATGCTGTGGTGGCGGTAAATGATCCACGTCGAGGTGAGTCATTAGTGCTTTTTACAACCGATAAGCAACTTGATCGCAGTATGTTATCGGCATTAGCTAAATCCACTGGTGTGGCAGAAATTGCGGTACCAAAAGATATTCGTTTTCTCAAAGAAATTCCTGTTTTAGGAAGTGGCAAAACGGATTTTGTCTCGTTAAAGCAACTCGCTGAACAGGAAAATAATTAATGTCAGAGAATATAAGTCAGCCCCCATTACTGAGTAAGGGCATGAAAGCA