Homologs in group_2031

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15220 FBDBKF_15220 100.0 Morganella morganii S1 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
EHELCC_11025 EHELCC_11025 100.0 Morganella morganii S2 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
LHKJJB_11230 LHKJJB_11230 100.0 Morganella morganii S3 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
HKOGLL_09840 HKOGLL_09840 100.0 Morganella morganii S5 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
F4V73_RS12225 F4V73_RS12225 89.4 Morganella psychrotolerans aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
PMI_RS01780 PMI_RS01780 64.1 Proteus mirabilis HI4320 aas bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase

Distribution of the homologs in the orthogroup group_2031

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2031

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JQC1 0.0 1021 66 1 717 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667F1 0.0 1021 66 1 717 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZ75 0.0 1021 66 1 717 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FFD1 0.0 1021 66 1 717 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TLD3 0.0 1021 66 1 717 3 aas Bifunctional protein Aas Yersinia pestis (strain Pestoides F)
A9R2S1 0.0 1021 66 1 717 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Angola)
Q74RZ6 0.0 1017 66 1 717 3 aas Bifunctional protein Aas Yersinia pestis
Q1CAS8 0.0 1017 66 1 717 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Antiqua)
A1JPF0 0.0 1016 66 1 717 3 aas Bifunctional protein Aas Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DE43 0.0 1014 67 1 715 3 aas Bifunctional protein Aas Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D107 0.0 1012 66 1 716 3 aas Bifunctional protein Aas Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5BFH6 0.0 996 66 0 708 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain AKU_12601)
Q5PEN7 0.0 996 66 0 708 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RDY6 0.0 994 66 0 708 3 aas Bifunctional protein Aas Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7LNJ2 0.0 994 64 1 716 3 aas Bifunctional protein Aas Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
C0PXJ8 0.0 993 66 0 708 3 aas Bifunctional protein Aas Salmonella paratyphi C (strain RKS4594)
B4TGR5 0.0 993 66 0 708 3 aas Bifunctional protein Aas Salmonella heidelberg (strain SL476)
B5QWU2 0.0 993 66 0 708 3 aas Bifunctional protein Aas Salmonella enteritidis PT4 (strain P125109)
Q57KA7 0.0 993 66 0 708 3 aas Bifunctional protein Aas Salmonella choleraesuis (strain SC-B67)
Q8ZMA4 0.0 993 66 0 708 3 aas Bifunctional protein Aas Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUM9 0.0 993 66 0 708 3 aas Bifunctional protein Aas Salmonella schwarzengrund (strain CVM19633)
A9N3H8 0.0 992 66 0 708 3 aas Bifunctional protein Aas Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F4V4 0.0 991 66 0 708 3 aas Bifunctional protein Aas Salmonella agona (strain SL483)
Q3YY21 0.0 990 64 0 716 3 aas Bifunctional protein Aas Shigella sonnei (strain Ss046)
B6I6W1 0.0 990 64 0 716 3 aas Bifunctional protein Aas Escherichia coli (strain SE11)
B1IU08 0.0 990 64 0 716 3 aas Bifunctional protein Aas Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3X0 0.0 990 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O9:H4 (strain HS)
B7LF13 0.0 990 64 0 716 3 aas Bifunctional protein Aas Escherichia coli (strain 55989 / EAEC)
A7ZQU2 0.0 990 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8Z406 0.0 990 66 0 708 3 aas Bifunctional protein Aas Salmonella typhi
B5FUB9 0.0 990 66 0 708 3 aas Bifunctional protein Aas Salmonella dublin (strain CT_02021853)
B4T503 0.0 989 66 0 708 3 aas Bifunctional protein Aas Salmonella newport (strain SL254)
A8AP56 0.0 989 64 1 716 3 aas Bifunctional protein Aas Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P31119 0.0 989 64 0 716 1 aas Bifunctional protein Aas Escherichia coli (strain K12)
Q8FEA6 0.0 989 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1XDP2 0.0 989 64 0 716 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / DH10B)
C4ZZY9 0.0 989 64 0 716 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / MC4100 / BW2952)
B7UHQ4 0.0 989 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83JV7 0.0 989 64 0 716 3 aas Bifunctional protein Aas Shigella flexneri
Q0T128 0.0 989 64 0 716 3 aas Bifunctional protein Aas Shigella flexneri serotype 5b (strain 8401)
B2TYQ5 0.0 988 65 0 708 3 aas Bifunctional protein Aas Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7N768 0.0 988 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5Z4F4 0.0 988 65 0 708 3 aas Bifunctional protein Aas Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6J8 0.0 988 65 0 708 3 aas Bifunctional protein Aas Escherichia coli O157:H7
A4WE11 0.0 988 64 0 714 3 aas Bifunctional protein Aas Enterobacter sp. (strain 638)
Q1R7H5 0.0 986 64 0 716 3 aas Bifunctional protein Aas Escherichia coli (strain UTI89 / UPEC)
B1LR34 0.0 986 64 0 716 3 aas Bifunctional protein Aas Escherichia coli (strain SMS-3-5 / SECEC)
A1AF47 0.0 986 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O1:K1 / APEC
B7MLI2 0.0 986 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NVY2 0.0 986 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q0TDZ6 0.0 984 64 0 716 3 aas Bifunctional protein Aas Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5XUP2 0.0 979 64 0 709 3 aas Bifunctional protein Aas Klebsiella pneumoniae (strain 342)
B2VFS7 0.0 979 63 0 713 3 aas Bifunctional protein Aas Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6TDH2 0.0 976 63 0 709 3 aas Bifunctional protein Aas Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MR36 0.0 964 63 0 714 3 aas Bifunctional protein Aas Cronobacter sakazakii (strain ATCC BAA-894)
Q7N7A9 0.0 824 61 1 623 3 aas Bifunctional protein Aas Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O07610 1.45e-35 144 30 12 351 2 lcfB Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
Q8ZES9 1.07e-34 143 27 20 510 3 fadD Long-chain-fatty-acid--CoA ligase Yersinia pestis
P63521 2.62e-33 139 27 18 509 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63522 2.62e-33 139 27 18 509 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhi
Q8XDR6 1.04e-32 137 27 19 514 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O157:H7
Q9AJS8 1.68e-32 135 26 10 473 1 hcl 3-hydroxybenzoate--CoA/4-hydroxybenzoate--CoA ligase Thauera aromatica
P69451 2.53e-32 135 27 19 514 1 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli (strain K12)
P69452 2.53e-32 135 27 19 514 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
S5M744 8.41e-29 124 26 15 472 1 fcs Feruloyl-CoA synthase Streptomyces sp.
Q9EY88 8.41e-29 124 26 15 472 1 fcs Feruloyl-CoA synthase Amycolatopsis sp.
M4IQQ7 1.18e-28 124 29 12 362 2 CCL9 Probable CoA ligase CCL9 Humulus lupulus
P38135 1.24e-28 124 30 11 353 1 fadK Medium-chain fatty-acid--CoA ligase Escherichia coli (strain K12)
Q0S7V5 1.13e-27 121 29 13 354 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Rhodococcus jostii (strain RHA1)
M4IS90 2.11e-27 121 30 10 347 2 CCL8 Probable CoA ligase CCL8 Humulus lupulus
P46450 5.85e-27 119 27 12 382 3 fadD Long-chain-fatty-acid--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q84P21 1.1e-26 118 29 12 354 1 4CLL5 Peroxisomal OPC-8:0-CoA ligase 1 Arabidopsis thaliana
Q0DV32 1.29e-26 118 29 12 360 2 4CLL1 4-coumarate--CoA ligase-like 1 Oryza sativa subsp. japonica
P41636 6.2e-26 116 25 12 467 2 4CL 4-coumarate--CoA ligase Pinus taeda
Q838K1 1.19e-25 114 27 12 365 3 menE 2-succinylbenzoate--CoA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
M4IQR7 2.23e-25 114 28 12 356 2 CCL5 Probable CoA ligase CCL5 Humulus lupulus
Q0K844 4.81e-25 113 29 12 354 2 sauT Sulfoacetate--CoA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q84P26 5.11e-25 113 28 10 352 2 4CLL8 4-coumarate--CoA ligase-like 8 Arabidopsis thaliana
P94547 1.47e-24 112 28 16 370 3 lcfA Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
Q9S777 2.06e-24 111 25 11 430 1 4CL3 4-coumarate--CoA ligase 3 Arabidopsis thaliana
Q7WSH3 2.43e-24 111 25 20 532 3 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Comamonas testosteroni
Q9I4X3 3.6e-24 110 29 12 357 1 pqsA Anthranilate--CoA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q10S72 3.82e-24 110 27 11 355 2 4CLL4 4-coumarate--CoA ligase-like 4 Oryza sativa subsp. japonica
Q8VCW8 4.73e-24 110 27 10 367 1 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Mus musculus
O31826 4.86e-24 110 28 16 370 3 yngI Putative acyl-CoA synthetase YngI Bacillus subtilis (strain 168)
Q84P25 5.73e-24 110 27 12 352 2 4CLL2 4-coumarate--CoA ligase-like 2 Arabidopsis thaliana
Q8GQN9 1.1e-23 109 28 12 388 1 bclA Benzoate--CoA ligase Thauera aromatica
A0A6B9HER0 1.45e-23 108 26 11 357 1 None Piperic acid--CoA ligase Piper nigrum
Q499N5 2.47e-23 108 27 11 370 2 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Rattus norvegicus
Q54P77 2.94e-23 108 25 17 535 3 4cl1 Probable 4-coumarate--CoA ligase 1 Dictyostelium discoideum
Q8H151 3.22e-23 108 29 9 317 1 AAE13 Malonate--CoA ligase Arabidopsis thaliana
Q54P79 3.33e-23 107 28 11 368 3 4cl3 Probable 4-coumarate--CoA ligase 3 Dictyostelium discoideum
B2KWI3 3.77e-23 108 27 9 373 2 SID4 Acyl-CoA ligase SID4 Ajellomyces capsulatus
M4IQS1 4.88e-23 107 26 14 414 2 CCL10 Probable CoA ligase CCL10 Humulus lupulus
P96843 7.02e-23 106 29 11 351 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q54P78 8.89e-23 106 27 10 355 3 4cl2 Probable 4-coumarate--CoA ligase 2 Dictyostelium discoideum
P0C5B6 1.09e-22 106 26 13 353 2 4CLL4 OPC-6:CoA ligase Arabidopsis thaliana
O74976 7.5e-22 103 26 12 410 1 pcs60 Oxalate--CoA ligase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q84P23 9.93e-22 103 29 12 351 1 4CLL9 4-coumarate--CoA ligase-like 9 Arabidopsis thaliana
O24145 1.03e-21 103 26 14 423 2 4CL1 4-coumarate--CoA ligase 1 Nicotiana tabacum
A0A2H5AIX5 1.63e-21 102 25 12 431 2 4CL1 4-coumarate-CoA ligase 1 Narcissus pseudonarcissus
Q4WR83 2.07e-21 102 26 7 388 2 sidI Acyl-CoA ligase sidI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9S725 2.63e-21 102 24 13 443 1 4CL2 4-coumarate--CoA ligase 2 Arabidopsis thaliana
M4IRL6 3.93e-21 101 25 13 461 2 CCL7 Probable CoA ligase CCL7 Humulus lupulus
Q4R4Z9 3.95e-21 101 27 17 401 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Macaca fascicularis
Q0P4F7 3.96e-21 101 27 14 356 2 acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Danio rerio
Q9SMT7 3.98e-21 101 29 13 382 1 AAE3 Oxalate--CoA ligase Arabidopsis thaliana
Q8LKS5 5.67e-21 101 30 9 322 1 LACS7 Long chain acyl-CoA synthetase 7, peroxisomal Arabidopsis thaliana
A0A2H5AIY4 6.03e-21 100 27 15 456 2 4CL2 4-coumarate-CoA ligase 2 Narcissus pseudonarcissus
Q42982 7.94e-21 100 28 13 363 1 4CL2 4-coumarate--CoA ligase 2 Oryza sativa subsp. japonica
Q3E6Y4 1.12e-20 100 27 14 367 2 4CLL3 4-coumarate--CoA ligase-like 3 Arabidopsis thaliana
Q58DN7 1.14e-20 100 27 16 405 2 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Bos taurus
W3X8X8 1.17e-20 101 29 15 357 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
P14912 1.44e-20 99 27 14 431 2 4CL1 4-coumarate--CoA ligase 1 Petroselinum crispum
P31687 1.59e-20 99 28 11 357 2 None 4-coumarate--CoA ligase 2 Glycine max
Q53005 1.6e-20 99 28 8 364 1 hbaA 4-hydroxybenzoate--CoA/benzoate--CoA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P38137 1.67e-20 99 26 10 354 1 PCS60 Oxalate--CoA ligase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39062 1.83e-20 99 24 12 490 1 acsA Acetyl-coenzyme A synthetase Bacillus subtilis (strain 168)
P0DX84 1.95e-20 99 26 10 360 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria lacuscaerulensis (strain DSM 11314 / KCTC 2953 / ITI-1157)
P14913 2.07e-20 99 27 14 431 2 4CL2 4-coumarate--CoA ligase 2 Petroselinum crispum
Q6ETN3 2.17e-20 99 27 9 318 1 4CL3 4-coumarate--CoA ligase 3 Oryza sativa subsp. japonica
P9WQ61 2.54e-20 99 29 6 271 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ60 2.54e-20 99 29 6 271 3 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXK7 2.54e-20 99 29 6 271 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q17QJ1 2.75e-20 99 25 18 516 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Bos taurus
I3PB37 4.21e-20 98 26 13 422 1 4CL1 4-coumarate:CoA ligase 1 Petunia hybrida
Q5P603 4.29e-20 97 26 13 358 1 iaaB Indoleacetate--CoA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q9CMW1 5.44e-20 98 25 21 524 3 acsA Acetyl-coenzyme A synthetase Pasteurella multocida (strain Pm70)
Q5LRT0 5.61e-20 97 26 13 376 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q9M0X9 1.23e-19 96 26 13 357 1 4CLL7 4-coumarate--CoA ligase-like 7 Arabidopsis thaliana
Q9FFE9 2.2e-19 95 26 14 372 2 AAE6 Probable acyl-activating enzyme 6 Arabidopsis thaliana
A0A0H2ZF83 2.46e-19 95 27 10 359 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain UCBPP-PA14)
Q96CM8 3.07e-19 95 27 14 366 1 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Homo sapiens
B2HIL6 3.9e-19 95 27 4 271 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q4G176 4.93e-19 95 26 21 529 1 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Homo sapiens
Q9FFE6 6.52e-19 94 26 15 376 1 AAE5 Probable acyl-activating enzyme 5, peroxisomal Arabidopsis thaliana
Q42524 8.27e-19 94 26 17 438 1 4CL1 4-coumarate--CoA ligase 1 Arabidopsis thaliana
Q3URE1 8.48e-19 94 27 14 388 1 Acsf3 Malonate--CoA ligase ACSF3, mitochondrial Mus musculus
Q67W82 9.29e-19 94 24 15 484 1 4CL4 4-coumarate--CoA ligase 4 Oryza sativa subsp. japonica
P31685 1.35e-18 93 26 14 423 3 4CL2 4-coumarate--CoA ligase 2 Solanum tuberosum
M4ISH0 1.38e-18 93 26 10 319 1 CCL1 4-coumarate--CoA ligase CCL1 Humulus lupulus
Q9HWG3 1.61e-18 93 27 10 359 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6GLK6 2.9e-18 92 26 13 379 2 acsf3 Malonate--CoA ligase ACSF3, mitochondrial Xenopus laevis
Q5R9G9 3.29e-18 92 26 12 365 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Pongo abelii
O24540 3.65e-18 92 26 15 446 2 4CL 4-coumarate--CoA ligase Vanilla planifolia
O05598 3.66e-18 92 27 12 319 1 pks16 Putative ligase Rv1013 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ37 5.27e-18 91 24 11 356 1 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ36 5.27e-18 91 24 11 356 3 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P33121 6.58e-18 92 27 14 334 1 ACSL1 Long-chain-fatty-acid--CoA ligase 1 Homo sapiens
Q00594 1.05e-17 90 24 14 374 1 alkK Medium-chain-fatty-acid--CoA ligase Pseudomonas oleovorans
W7NDP3 1.34e-17 90 26 15 410 2 FVEG_12633 CoA ligase FVEG_12633 Gibberella moniliformis (strain M3125 / FGSC 7600)
P08659 1.7e-17 90 25 19 426 1 None Luciferin 4-monooxygenase Photinus pyralis
O88813 1.87e-17 90 27 12 325 1 Acsl5 Long-chain-fatty-acid--CoA ligase 5 Rattus norvegicus
A0B8F1 2.15e-17 90 23 15 524 1 acsA Acetyl-coenzyme A synthetase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q8LPS1 2.25e-17 90 29 10 328 1 LACS6 Long chain acyl-CoA synthetase 6, peroxisomal Arabidopsis thaliana
A4WJG1 2.35e-17 90 24 24 537 3 acsA Acetyl-coenzyme A synthetase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q9LU36 3.22e-17 89 27 11 320 1 4CL4 4-coumarate--CoA ligase 4 Arabidopsis thaliana
P31684 3.85e-17 89 26 13 422 3 4CL1 4-coumarate--CoA ligase 1 Solanum tuberosum
O80658 4.17e-17 89 25 14 392 2 AEE4 Probable acyl-activating enzyme 4 Arabidopsis thaliana
O24146 4.59e-17 88 26 14 427 1 4CL2 4-coumarate--CoA ligase 2 Nicotiana tabacum
A0R3D6 4.6e-17 88 28 12 314 1 MSMEG_5435 Putative ligase MSMEG_5435/MSMEI_5285 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q84HC5 5.15e-17 88 26 10 364 1 ncsB2 2-hydroxy-7-methoxy-5-methyl-1-naphthoate--CoA ligase Streptomyces carzinostaticus
Q84P24 6.69e-17 88 22 14 485 1 4CLL6 4-coumarate--CoA ligase-like 6 Arabidopsis thaliana
O07899 6.9e-17 88 24 10 361 3 vibE Vibriobactin-specific 2,3-dihydroxybenzoate-AMP ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B8NR69 7.04e-17 89 27 19 431 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NR69 1.54e-09 65 25 12 283 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q8KBY0 8.12e-17 88 25 11 364 3 acsA Acetyl-coenzyme A synthetase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
F8J3D9 9.09e-17 88 24 21 578 1 tmlU Marinolic acid--CoA ligase Pseudoalteromonas sp. (strain SANK 73390)
O93730 9.2e-17 88 23 20 529 3 acsA Acetyl-coenzyme A synthetase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q27757 1.34e-16 87 23 12 357 2 None Luciferin 4-monooxygenase Photuris pensylvanica
Q8JZR0 1.43e-16 87 27 11 325 1 Acsl5 Long-chain-fatty-acid--CoA ligase 5 Mus musculus
W7L9F0 1.72e-16 87 26 14 333 3 FUM16 Acyl-CoA synthetase FUM16 Gibberella moniliformis (strain M3125 / FGSC 7600)
P40871 1.74e-16 86 25 12 368 1 dhbE 2,3-dihydroxybenzoate-AMP ligase Bacillus subtilis (strain 168)
A0A0A2J5U8 1.77e-16 86 27 7 300 3 cnsG Acyl-CoA ligase cnsG Penicillium expansum
Q55DR6 2.02e-16 87 23 16 497 1 fcsA Fatty acyl-CoA synthetase A Dictyostelium discoideum
Q9ULC5 2.34e-16 87 27 12 324 1 ACSL5 Long-chain-fatty-acid--CoA ligase 5 Homo sapiens
P18163 2.73e-16 86 27 14 330 1 Acsl1 Long-chain-fatty-acid--CoA ligase 1 Rattus norvegicus
Q71YZ5 2.8e-16 85 24 10 351 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serotype 4b (strain F2365)
P13129 3.41e-16 85 24 11 357 1 None Luciferin 4-monooxygenase Nipponoluciola cruciata
Q9LPK7 4.45e-16 85 25 15 390 2 AEE10 Probable acyl-activating enzyme 10 Arabidopsis thaliana
C0LTL9 4.76e-16 85 28 16 373 1 sibE 3-hydroxy-4-methylanthranilate adenylyltransferase Streptosporangium sibiricum
F8P1W3 4.93e-16 86 25 15 404 2 nps3 Atromentin synthetase nps3 Serpula lacrymans var. lacrymans (strain S7.9)
A0A2I2F2N6 5.38e-16 86 27 15 369 1 cfoA Chalcone synthase cfoA Aspergillus candidus
O13440 6.73e-16 85 24 16 533 2 ACS-1 Acetyl-coenzyme A synthetase Coprinopsis cinerea
A8PDE3 7.34e-16 85 24 16 533 3 ACS-1 Acetyl-coenzyme A synthetase Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
A7GU88 7.7e-16 84 23 17 464 3 menE 2-succinylbenzoate--CoA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
P58730 9.21e-16 84 24 9 351 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P27095 1.07e-15 84 23 18 517 1 acsA Acetyl-coenzyme A synthetase Methanothrix soehngenii
Q92AY8 1.08e-15 84 23 7 345 3 menE 2-succinylbenzoate--CoA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9LQS1 1.38e-15 84 26 16 372 2 AAE8 Probable acyl-activating enzyme 8 Arabidopsis thaliana
Q5REV5 1.58e-15 84 24 14 385 2 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Pongo abelii
Q6ZAC1 1.74e-15 83 24 15 439 1 4CL5 4-coumarate--CoA ligase 5 Oryza sativa subsp. japonica
Q53FZ2 1.78e-15 84 24 14 385 1 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Homo sapiens
A2R6H0 1.89e-15 84 28 13 335 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H0 1.6e-11 72 24 12 393 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q26304 2.26e-15 83 23 13 366 1 None Luciferin 4-monooxygenase Luciola mingrelica
Q01158 2.26e-15 83 24 12 359 2 None Luciferin 4-monooxygenase Aquatica lateralis
Q9CHK3 2.35e-15 82 27 11 343 3 menE 2-succinylbenzoate--CoA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q4WAW3 2.56e-15 84 29 10 287 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAW3 2.88e-08 61 24 19 417 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B9WZX0 2.58e-15 84 29 10 287 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
B9WZX0 2.86e-08 61 24 19 417 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
P17814 2.92e-15 83 27 15 365 1 4CL1 4-coumarate--CoA ligase 1 Oryza sativa subsp. japonica
Q8J2R0 3.22e-15 82 25 12 383 3 FUM10 Acyl-CoA synthetase FUM10 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q2YTP0 3.73e-15 82 25 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9LPK6 3.95e-15 82 25 16 446 2 AEE9 Probable acyl-activating enzyme 9 Arabidopsis thaliana
P41216 3.96e-15 83 26 14 330 1 Acsl1 Long-chain-fatty-acid--CoA ligase 1 Mus musculus
P63526 4.18e-15 82 25 13 351 1 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain N315)
P63525 4.18e-15 82 25 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITW2 4.18e-15 82 25 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH9)
A6U2Q7 4.18e-15 82 25 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH1)
A7X3P0 4.18e-15 82 25 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q17577 6.16e-15 82 25 13 360 1 acs-7 Acyl-CoA synthetase 7 Caenorhabditis elegans
Q9JID6 6.31e-15 82 27 14 334 2 ACSL1 Long-chain-fatty-acid--CoA ligase 1 Cavia porcellus
Q1BBA2 7.17e-15 81 27 20 383 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium sp. (strain MCS)
Q65FT5 7.65e-15 81 27 18 451 3 menE 2-succinylbenzoate--CoA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8NVZ4 7.97e-15 81 25 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MW2)
Q6G8D6 7.97e-15 81 25 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MSSA476)
A8FGK6 8.96e-15 81 26 16 410 3 menE 2-succinylbenzoate--CoA ligase Bacillus pumilus (strain SAFR-032)
Q6GFR0 1.06e-14 80 25 15 352 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MRSA252)
C0SPB0 1.36e-14 80 24 12 368 3 ytcI Uncharacterized acyl--CoA ligase YtcI Bacillus subtilis (strain 168)
Q72YK9 1.92e-14 80 22 15 513 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9UKU0 1.92e-14 80 25 18 418 1 ACSL6 Long-chain-fatty-acid--CoA ligase 6 Homo sapiens
M4IQQ5 2.06e-14 80 26 21 384 1 CCL4 2-methylpropanoate--CoA ligase CCL4 Humulus lupulus
Q6YYZ2 2.08e-14 80 22 13 490 3 4CLL3 4-coumarate--CoA ligase-like 3 Oryza sativa subsp. japonica
B2HGV4 2.2e-14 80 27 11 312 3 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium marinum (strain ATCC BAA-535 / M)
I1SAJ7 2.39e-14 81 26 10 300 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.61e-10 68 25 14 390 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.67e-07 58 22 9 301 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 5.37e-06 53 25 16 378 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P39846 2.41e-14 81 23 12 371 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
Q4WF61 2.52e-14 81 26 12 382 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WF61 2.36e-10 68 24 11 365 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A0S2E7V8 2.75e-14 80 25 17 400 1 invA3 Inactive atromentin synthetase invA3 Paxillus involutus
I3PB36 2.84e-14 80 23 12 375 1 CNL Trans-cinnamate:CoA ligase, peroxisomal Petunia hybrida
Q6TNA5 2.9e-14 80 26 13 371 1 CmaA L-allo-isoleucine:holo-[CmaA peptidyl-carrier protein] ligase Pseudomonas savastanoi pv. glycinea
Q8CS21 2.91e-14 79 24 14 357 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8XBV3 3.1e-14 79 22 10 365 3 entE Enterobactin synthase component E Escherichia coli O157:H7
M1W5Z4 3.33e-14 80 26 19 420 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 3.46e-09 64 25 15 374 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 8.08e-06 53 26 15 293 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
P10378 3.45e-14 79 22 9 366 1 entE Enterobactin synthase component E Escherichia coli (strain K12)
B6HJU6 3.91e-14 80 23 14 509 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HJU6 5.92e-10 67 23 14 380 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A0S2E7W7 4.2e-14 80 25 17 421 1 invA5 Atromentin synthetase invA5 Paxillus involutus
O30409 4.38e-14 80 26 12 369 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 2.8e-13 77 27 16 374 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 4.15e-12 73 27 19 373 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 2.23e-09 65 24 14 363 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 9.03e-09 63 23 8 360 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.82e-06 55 27 15 363 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
S3DB78 4.61e-14 79 27 13 372 1 gloD Acyl-CoA ligase gloD Glarea lozoyensis (strain ATCC 20868 / MF5171)
P96575 4.74e-14 79 23 11 360 3 ydaB Putative acyl--CoA ligase YdaB Bacillus subtilis (strain 168)
Q7X279 5.29e-14 79 25 9 358 1 sdgA Salicylyl-CoA synthase / salicylate adenylyltransferase Streptomyces sp.
P35854 5.56e-14 79 27 12 371 1 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus rhamnosus
A0A3G9H9I5 6.17e-14 79 24 12 416 3 ALT10 Acyl-CoA synthetase ALT10 Alternaria alternata
P33124 6.34e-14 79 25 12 336 1 Acsl6 Long-chain-fatty-acid--CoA ligase 6 Rattus norvegicus
P80436 6.42e-14 78 26 8 361 1 trsA Triostin synthetase I Streptomyces triostinicus
A7Z809 8.29e-14 78 24 8 347 3 menE 2-succinylbenzoate--CoA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P80435 8.31e-14 78 26 12 343 1 acmA 3-hydroxy-4-methylanthranilate adenylyltransferase Streptomyces anulatus
Q5HNB2 8.38e-14 78 23 13 355 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5AUZ6 8.86e-14 79 27 16 382 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 7.5e-12 73 26 14 388 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.3e-11 72 25 15 395 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 3.7e-10 67 24 8 282 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.68e-09 65 27 17 352 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 2.67e-07 58 24 13 345 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q91WC3 8.89e-14 78 25 13 338 1 Acsl6 Long-chain-fatty-acid--CoA ligase 6 Mus musculus
S7ZFK6 9.38e-14 79 26 15 387 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A1W5T1U1 9.87e-14 79 27 16 387 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A179H164 1.12e-13 79 28 15 366 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 7.18e-12 73 26 14 294 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.03e-11 72 27 16 367 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 2.01e-09 65 28 12 289 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 2.66e-07 58 22 10 297 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 7.93e-07 56 25 15 319 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.16e-06 56 25 16 411 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.54e-06 55 24 14 388 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.66e-05 52 23 11 314 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
B6D9A8 1.21e-13 79 24 14 390 1 Beas Beauvericin nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
Q73ZP7 1.23e-13 77 27 12 313 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
S0EN43 1.25e-13 79 24 15 383 2 BEA1 Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q53634 1.38e-13 77 24 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus
A8Z4L9 1.38e-13 77 24 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300 / TCH1516)
A6QHX6 1.38e-13 77 24 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Newman)
Q5HEY2 1.38e-13 77 24 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain COL)
Q2G2V3 1.38e-13 77 24 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFU9 1.38e-13 77 24 13 351 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300)
G7XQ31 1.41e-13 79 25 14 389 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 1.48e-12 75 27 17 396 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 2.94e-07 58 24 14 390 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
Q6FXI2 1.67e-13 77 23 19 542 3 ACS2 Acetyl-coenzyme A synthetase 2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P9WEV1 1.72e-13 78 26 13 392 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
P9WEV1 8.26e-13 76 26 15 392 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
A0A098D1P1 1.76e-13 78 26 11 316 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 3.59e-10 67 22 7 289 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 2.87e-07 58 25 14 388 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 1.85e-06 55 26 14 300 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 6.1e-06 53 24 14 295 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 8e-06 53 22 15 382 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
B7JDD6 2.18e-13 76 22 16 490 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH820)
B9J2F2 2.37e-13 76 22 17 513 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain Q1)
A0A1W6BT46 2.68e-13 77 27 12 304 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
A0A1W6BT46 5.26e-13 76 24 14 391 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
B7HTW3 2.8e-13 76 22 16 518 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH187)
A0RK73 3.02e-13 76 23 15 462 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis (strain Al Hakam)
O93800 3.14e-13 76 26 14 367 4 AKT1 Acyl-CoA ligase AKT1 Alternaria alternata
A0A0S1RUN4 3.36e-13 77 25 18 423 1 invA2 Atromentin synthetase invA2 Paxillus involutus
G3GBU7 3.39e-13 77 23 14 384 3 None Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella intermedia
Q4WLW5 3.59e-13 77 25 13 310 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 1.92e-09 65 26 18 367 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 2.56e-08 61 23 11 302 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6HC29 3.6e-13 76 22 16 490 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
A0A395I3F8 3.72e-13 77 27 16 393 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 1.57e-11 72 25 15 395 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 3.35e-06 54 25 17 379 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
P0C064 3.88e-13 77 26 12 367 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 2.2e-08 62 24 17 366 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 2.3e-07 58 26 13 353 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 3.05e-07 58 22 10 359 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C063 3.95e-13 77 26 13 367 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 2.05e-07 58 26 13 353 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 2.62e-07 58 22 10 359 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 6.48e-07 57 24 19 371 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
Q81K97 4.09e-13 75 25 13 348 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis
I1RF49 4.21e-13 77 24 16 418 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 7.52e-12 73 24 16 398 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 1.77e-05 52 22 11 286 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 2.87e-05 51 23 15 351 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
C3LB87 4.22e-13 75 25 13 348 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PCK3 4.22e-13 75 25 13 348 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain A0248)
A0A0U1LQE6 4.52e-13 77 25 18 396 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 2.35e-07 58 23 9 279 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 1.71e-05 52 26 17 365 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A1DA59 5.26e-13 76 27 10 298 3 ftmPS Nonribosomal peptide synthetase ftmPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DA59 1.53e-09 65 24 20 454 3 ftmPS Nonribosomal peptide synthetase ftmPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q8DKH2 5.32e-13 76 23 17 493 3 acsA Acetyl-coenzyme A synthetase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A0A318Z3U0 5.83e-13 76 25 14 388 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 1.18e-09 65 26 14 396 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 9.39e-07 56 23 13 390 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
M4ISH2 6.6e-13 75 25 16 382 2 CCL11 Probable CoA ligase CCL11 Humulus lupulus
Q1IAK8 6.97e-13 75 24 12 364 1 pmsE Pseudomonine synthase PmsE Pseudomonas entomophila (strain L48)
C5NN18 7.49e-13 75 22 18 528 3 ACTT5 Acyl-CoA synthetase ACTT5 Alternaria alternata
Q6BS00 7.54e-13 75 23 19 531 3 ACS2 Acetyl-coenzyme A synthetase 2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A0A0S2E7X0 7.63e-13 75 23 14 396 2 invA4 Inactive atromentin synthetase invA4 Paxillus involutus
Q7NSY7 7.69e-13 75 24 19 514 3 acsA Acetyl-coenzyme A synthetase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P9WQ53 8.13e-13 75 25 14 356 3 fadD11 Putative fatty-acid--CoA ligase fadD11 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ52 8.13e-13 75 25 14 356 3 fadD11 Putative fatty-acid--CoA ligase fadD11 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O94205 8.18e-13 76 24 14 417 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
O94205 8.43e-08 60 25 11 302 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
A0A1M3T4K3 8.49e-13 76 25 14 384 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 1.42e-12 75 27 17 396 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 2.84e-07 58 24 14 390 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
Q55404 9.95e-13 75 23 16 503 3 acsA Acetyl-coenzyme A synthetase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0R5G1 9.99e-13 75 23 16 469 3 acsA Acetyl-coenzyme A synthetase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0A1E3B0T2 1.02e-12 75 25 11 376 1 criC Nonribosomal peptide synthetase criC Aspergillus cristatus
A0A1E3B0T2 3.04e-08 61 23 12 365 1 criC Nonribosomal peptide synthetase criC Aspergillus cristatus
K0E2F3 1.11e-12 74 25 16 469 1 ecdI Fatty-acyl-AMP ligase ecdI Aspergillus rugulosus
Q5B7I5 1.15e-12 75 28 12 301 2 inpA Nonribosomal peptide synthase inpA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1L9NGU5 1.16e-12 75 26 14 390 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 1.23e-12 75 25 13 389 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 1.67e-08 62 22 15 531 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
Q96VB5 1.17e-12 74 26 11 360 3 AFT1-1 Acyl-CoA ligase AFT1-1 Alternaria alternata
C5D6U5 1.23e-12 74 25 12 357 3 menE 2-succinylbenzoate--CoA ligase Geobacillus sp. (strain WCH70)
Q9R9J1 1.24e-12 75 25 14 407 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q9R9J1 1.34e-09 65 24 11 368 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q5KVX9 1.29e-12 74 27 14 349 3 menE 2-succinylbenzoate--CoA ligase Geobacillus kaustophilus (strain HTA426)
Q8VYJ1 1.29e-12 74 23 13 403 1 AAE14 2-succinylbenzoate--CoA ligase, chloroplastic/peroxisomal Arabidopsis thaliana
A0QUA1 1.29e-12 74 25 19 395 1 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0A319BQC1 1.33e-12 75 25 13 389 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 2.66e-12 74 26 14 393 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 0.000354 48 21 15 528 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
Q2KHW5 1.44e-12 74 25 9 315 2 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Bos taurus
I6NXV7 1.5e-12 75 24 15 402 1 greA Atromentin synthetase greA Suillus grevillei
Q816I1 1.66e-12 73 22 15 517 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q04747 1.76e-12 75 25 12 359 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 3.13e-10 67 26 13 362 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 2.25e-06 55 24 13 365 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
P9WEY3 1.77e-12 74 26 9 328 1 None Acyl-CoA ligase 891, peroxisomal Penicillium brevicompactum
A0A0S6XHH0 1.84e-12 75 24 14 376 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.07e-09 66 24 15 402 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.04e-09 65 27 14 386 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 3.83e-09 64 25 10 285 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 4.65e-09 63 25 14 396 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.13e-08 62 24 13 395 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 4.14e-08 60 26 16 385 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.14e-07 59 24 8 319 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.01e-05 52 24 12 375 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 0.000837 47 23 9 291 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
K3VDP2 2.04e-12 75 23 12 379 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 4.98e-11 70 25 10 305 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 4.09e-10 67 23 10 391 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 2.03e-08 62 26 10 285 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.09e-07 59 23 15 393 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 0.000802 47 23 8 283 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
Q9R9J0 2.05e-12 75 26 13 355 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 2.62e-10 68 24 11 352 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q4R4P9 2.19e-12 74 25 9 315 2 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Macaca fascicularis
A0A144KPJ6 2.38e-12 74 26 13 394 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 9.67e-10 66 27 13 288 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
O60488 2.53e-12 73 27 16 387 1 ACSL4 Long-chain-fatty-acid--CoA ligase 4 Homo sapiens
C1CNE9 2.54e-12 73 28 10 287 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain P1031)
P0A399 2.54e-12 73 28 10 287 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A398 2.54e-12 73 28 10 287 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HZ7 2.54e-12 73 28 10 287 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8J0L6 2.56e-12 74 26 17 400 1 lpsB D-lysergyl-peptide-synthetase subunit 2 Claviceps purpurea
Q6AYT9 2.62e-12 73 25 14 383 2 Acsm5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Rattus norvegicus
C1CB20 2.63e-12 73 28 10 287 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain 70585)
O68008 2.69e-12 74 28 16 370 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 5.67e-10 67 24 17 439 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 1.67e-07 58 24 14 369 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 2.82e-07 58 26 16 372 3 bacC Bacitracin synthase 3 Bacillus licheniformis
C1CU95 2.79e-12 73 28 10 287 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain Taiwan19F-14)
B8ZQ14 2.79e-12 73 28 10 287 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
A0A5K6CNB8 2.82e-12 74 24 12 383 1 posA Delta-poly-L-ornithine synthetase Acinetobacter baumannii (strain AB307-0294)
Q99NB1 2.86e-12 73 24 21 522 1 Acss1 Acetyl-coenzyme A synthetase 2-like, mitochondrial Mus musculus
P39518 2.97e-12 73 30 4 163 1 FAA2 Long-chain-fatty-acid--CoA ligase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A317VEE1 3.09e-12 74 26 15 393 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 1.37e-11 72 25 12 390 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 6.49e-06 53 23 15 393 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
C8V7P4 3.16e-12 74 29 10 303 1 ivoA Nonribosomal peptide synthetase ivoA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q99PU5 3.16e-12 73 25 10 317 1 Acsbg1 Long-chain-fatty-acid--CoA ligase ACSBG1 Mus musculus
Q9QUJ7 3.21e-12 73 27 13 339 1 Acsl4 Long-chain-fatty-acid--CoA ligase 4 Mus musculus
Q96GR2 3.43e-12 73 25 9 315 1 ACSBG1 Long-chain-fatty-acid--CoA ligase ACSBG1 Homo sapiens
G3J455 3.63e-12 73 24 17 427 1 cm3C Acyl-CoA ligase cm3C Cordyceps militaris (strain CM01)
P47912 3.66e-12 73 26 12 331 1 FAA4 Long-chain-fatty-acid--CoA ligase 4 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O35547 3.66e-12 73 27 13 339 1 Acsl4 Long-chain-fatty-acid--CoA ligase 4 Rattus norvegicus
Q5B7J0 3.83e-12 73 27 13 390 2 inpC Acyl-CoA ligase inpC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9CZW4 3.89e-12 73 26 10 330 1 Acsl3 Fatty acid CoA ligase Acsl3 Mus musculus
Q91VA0 4.03e-12 73 23 17 456 1 Acsm1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Mus musculus
J5JV76 4.29e-12 73 24 16 376 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana (strain ARSEF 2860)
A0A1R3RGK1 4.89e-12 73 28 9 278 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
A0A1R3RGK1 5.59e-11 70 24 17 390 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
B8NI19 5.07e-12 73 26 13 322 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 1.88e-11 71 25 13 289 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 3.53e-06 54 23 14 409 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q336M7 5.47e-12 72 25 12 327 3 4CLL2 4-coumarate--CoA ligase-like 2 Oryza sativa subsp. japonica
Q63151 5.73e-12 72 26 10 330 1 Acsl3 Fatty acid CoA ligase Acsl3 Rattus norvegicus
P9WEP7 5.89e-12 73 23 15 393 1 None PF 1022-synthetase Rosellinia sp.
Q2UB01 5.98e-12 72 26 16 351 1 ppsA Acyl-CoA ligase ppsA Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q8NJN3 6.3e-12 72 23 23 525 1 ACS2 Acetyl-coenzyme A synthetase 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9RRL7 6.35e-12 72 25 14 381 3 acsA Acetyl-coenzyme A synthetase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P23971 7.33e-12 72 23 11 398 1 menE 2-succinylbenzoate--CoA ligase Bacillus subtilis (strain 168)
P9WQD1 9.39e-12 72 23 16 397 1 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD0 9.39e-12 72 23 16 397 3 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O54154 9.58e-12 71 27 15 391 1 redM L-proline--[L-prolyl-carrier protein] ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q70LM6 9.84e-12 72 27 20 407 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 2.22e-09 65 26 19 427 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 4.2e-07 57 25 18 430 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 1.83e-05 52 22 10 354 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
P59871 1.02e-11 72 23 16 397 3 acsA Acetyl-coenzyme A synthetase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6SKG1 1.02e-11 72 25 11 353 2 Acsm3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Rattus norvegicus
A2TBU4 1.03e-11 72 26 16 361 2 lpsB D-lysergyl-peptide-synthetase subunit 2 Epichloe festucae var. lolii
E9FCP4 1.04e-11 72 26 14 371 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 1.32e-10 69 26 17 426 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 6.75e-07 57 24 14 374 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 5.61e-06 53 23 9 328 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 0.000122 49 25 15 384 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A0S2E7Z1 1.06e-11 72 23 16 401 1 invA1 Atromentin synthetase invA1 Paxillus involutus
C7ZBE4 1.09e-11 72 25 16 399 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 7.85e-07 56 26 14 320 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 1.9e-05 52 25 16 310 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
A0A1U9YHZ2 1.13e-11 72 26 15 372 2 verP Nonribosomal peptide synthetase verP Clonostachys rogersoniana
Q96VC7 1.19e-11 71 23 17 522 3 ACS2 Acetyl-coenzyme A synthetase 2 Zygosaccharomyces bailii
A4YDR9 1.19e-11 71 26 16 384 1 Msed_0394 4-hydroxybutyrate--CoA ligase 2 Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
O95573 1.2e-11 72 26 10 330 1 ACSL3 Fatty acid CoA ligase Acsl3 Homo sapiens
P39847 1.22e-11 72 24 12 372 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P39847 0.000231 48 23 13 356 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P45745 1.23e-11 72 25 16 371 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
P45745 6.94e-05 50 23 14 373 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
A0A8F4S8Q3 1.25e-11 72 27 15 388 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
G4N137 1.26e-11 72 24 14 378 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q96V34 1.27e-11 72 25 10 322 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 4.07e-09 64 24 14 440 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 1.45e-05 52 26 15 325 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
C1D6V9 1.27e-11 71 22 16 534 3 acsA Acetyl-coenzyme A synthetase Laribacter hongkongensis (strain HLHK9)
Q5SKN9 1.4e-11 71 25 13 368 1 TTHA0604 Long-chain-fatty-acid--CoA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q5R668 1.42e-11 71 26 10 330 2 ACSL3 Fatty acid CoA ligase Acsl3 Pongo abelii
Q01576 1.42e-11 71 24 14 401 2 facA Acetyl-coenzyme A synthetase Phycomyces blakesleeanus (strain ATCC 8743b / DSM 1359 / FGSC 10004 / NBRC 33097 / NRRL 1555)
C0Q4L3 1.52e-11 71 25 19 480 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi C (strain RKS4594)
G3XUF0 1.55e-11 72 26 14 391 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 2.84e-11 71 27 18 407 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 1.24e-05 52 22 18 516 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q3UNX5 1.67e-11 71 23 8 350 1 Acsm3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Mus musculus
A2QYX4 1.68e-11 72 26 14 391 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 3.34e-11 70 27 18 407 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 1.4e-05 52 22 18 516 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
M1W600 1.69e-11 71 27 17 349 1 lpsB D-lysergyl-peptide-synthetase subunit 2 Claviceps purpurea (strain 20.1)
P16929 1.74e-11 71 23 16 513 2 acu-5 Acetyl-coenzyme A synthetase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q08787 1.76e-11 71 27 16 365 1 srfAC Surfactin synthase subunit 3 Bacillus subtilis (strain 168)
P36333 1.8e-11 71 24 16 494 3 facA Acetyl-coenzyme A synthetase Penicillium chrysogenum
A0A319A6V2 1.84e-11 72 26 14 391 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 3.9e-11 70 27 18 407 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 1.51e-05 52 22 18 516 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
L0E2Z1 1.88e-11 71 25 18 452 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
L0E2Z1 5.41e-11 70 23 12 333 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
Q39EK2 2.01e-11 70 25 12 371 3 acsA Acetyl-coenzyme A synthetase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P30624 2.08e-11 71 24 14 396 1 FAA1 Long-chain-fatty-acid--CoA ligase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
I1RIV2 2.15e-11 71 25 19 471 2 NPS6 Nonribosomal peptide synthetase 6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q8BGA8 2.27e-11 70 25 14 381 1 Acsm5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Mus musculus
A0A089FSA4 2.28e-11 71 28 15 323 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
Q88VM6 2.38e-11 70 27 18 379 3 dltA D-alanine--D-alanyl carrier protein ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A0A8F4S6Z6 2.43e-11 71 25 17 381 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
O70490 2.51e-11 70 24 13 373 2 Acsm2 Acyl-coenzyme A synthetase ACSM2, mitochondrial Rattus norvegicus
Q924N5 2.54e-11 70 24 10 317 1 Acsbg1 Long-chain-fatty-acid--CoA ligase ACSBG1 Rattus norvegicus
A9VM74 2.57e-11 70 24 12 350 3 menE 2-succinylbenzoate--CoA ligase Bacillus mycoides (strain KBAB4)
Q632I5 2.6e-11 70 24 12 345 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ZK / E33L)
A0A1W6BT53 2.62e-11 71 25 13 285 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
Q8RU95 2.76e-11 70 23 12 372 2 4CLL6 4-coumarate--CoA ligase-like 6 Oryza sativa subsp. japonica
Q8ZRX4 2.85e-11 70 26 14 374 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TIH0 2.85e-11 70 26 14 374 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella heidelberg (strain SL476)
P9WQ41 3.06e-11 70 25 18 378 1 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A4X9 3.06e-11 70 25 18 378 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
D1FVF0 3.33e-11 70 24 16 376 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
P9WQ40 3.7e-11 69 25 18 378 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B5R1R0 3.73e-11 69 26 14 374 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella enteritidis PT4 (strain P125109)
A0A017SQ41 3.85e-11 70 25 11 367 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
A0A017SQ41 1.34e-09 65 25 14 390 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
A0A1L9U7P9 4.47e-11 70 26 17 400 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 1.62e-10 68 24 15 405 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 7.1e-09 63 25 14 398 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A179HJB8 4.74e-11 68 27 10 259 2 lcsD Acyl-CoA ligase lcsD Purpureocillium lilacinum
Q0S4D7 4.84e-11 69 26 13 376 1 casI Steroid-22-oyl-CoA synthetase Rhodococcus jostii (strain RHA1)
F4HUK6 5.06e-11 69 23 17 502 1 AAE1 Butanoate--CoA ligase AAE1 Arabidopsis thaliana
Q70LM5 5.63e-11 70 25 12 390 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 9.95e-11 69 26 15 366 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 5.42e-09 63 25 14 381 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.23e-07 59 25 16 366 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 6.42e-06 53 24 13 353 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q8ENZ7 5.64e-11 69 21 13 456 3 menE 2-succinylbenzoate--CoA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
I1RVD9 5.81e-11 70 23 9 369 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD9 1.54e-10 68 25 12 375 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q70LM4 5.96e-11 70 27 16 385 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 4.55e-06 54 24 16 384 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q57TJ0 6.24e-11 69 26 13 375 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella choleraesuis (strain SC-B67)
P16928 6.3e-11 69 24 19 517 2 facA Acetyl-coenzyme A synthetase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B5F750 6.4e-11 68 26 14 374 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella agona (strain SL483)
Q9NUB1 6.48e-11 69 23 22 525 1 ACSS1 Acetyl-coenzyme A synthetase 2-like, mitochondrial Homo sapiens
Q80W40 6.72e-11 69 23 8 363 2 Acsm4 Acyl-coenzyme A synthetase ACSM4, mitochondrial Mus musculus
A0A2I1D2N0 7.57e-11 70 23 14 442 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 9.12e-11 69 26 13 375 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 4.39e-10 67 23 14 388 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.45e-06 55 22 12 393 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 6.96e-06 53 23 13 394 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 8.25e-06 53 23 15 405 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
Q9Y7B5 7.59e-11 69 24 16 480 3 ACS2 Acetyl-coenzyme A synthetase 2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q4WVN4 7.61e-11 70 25 16 398 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 4.49e-10 67 27 13 297 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 1.41e-06 55 25 11 286 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 8.3e-06 53 23 12 305 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 1.7e-05 52 24 14 352 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q63NC4 7.73e-11 69 24 13 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain K96243)
A3NH07 7.73e-11 69 24 13 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 668)
Q3JH62 7.73e-11 69 24 13 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 1710b)
A3P2K7 7.73e-11 69 24 13 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia pseudomallei (strain 1106a)
A1UWN5 7.73e-11 69 24 13 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain SAVP1)
Q62AD1 7.73e-11 69 24 13 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain ATCC 23344)
A2RYW5 7.73e-11 69 24 13 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain NCTC 10229)
A3MG40 7.73e-11 69 24 13 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia mallei (strain NCTC 10247)
B0CN26 8.79e-11 69 28 16 367 1 sfmB Nonribosomal peptide synthase SfmB Streptomyces lavendulae
B5BL55 9.15e-11 68 24 25 555 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PIL0 9.15e-11 68 24 25 555 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0CS64 9.24e-11 69 25 11 373 3 ataP Nonribosomal peptide synthetase ataP Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q8K0L3 9.35e-11 68 23 12 370 1 Acsm2 Acyl-coenzyme A synthetase ACSM2, mitochondrial Mus musculus
B4TWR4 9.48e-11 68 26 14 374 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella schwarzengrund (strain CVM19633)
B4T6J6 1.02e-10 68 26 14 374 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella newport (strain SL254)
Q8Z9L4 1.04e-10 68 26 14 374 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhi
O25686 1.13e-10 68 24 12 464 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain ATCC 700392 / 26695)
B5FHG5 1.17e-10 68 26 14 374 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella dublin (strain CT_02021853)
Q2PBY4 1.2e-10 69 24 20 474 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 2.87e-08 61 25 11 314 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 1.15e-06 56 25 12 289 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
L0E2U2 1.25e-10 68 28 10 291 1 phqB Nonribisomal peptide synthase phqB Penicillium fellutanum
L0E2U2 5.8e-09 63 24 11 326 1 phqB Nonribisomal peptide synthase phqB Penicillium fellutanum
A1DN09 1.27e-10 68 25 11 328 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DN09 2.7e-05 51 23 11 288 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q9R9I9 1.28e-10 68 26 13 357 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q6NUN0 1.28e-10 68 24 13 378 1 ACSM5 Acyl-coenzyme A synthetase ACSM5, mitochondrial Homo sapiens
Q08AH1 1.36e-10 68 21 9 377 1 ACSM1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Homo sapiens
P39002 1.45e-10 68 27 13 340 1 FAA3 Long-chain-fatty-acid--CoA ligase 3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
K3VAW3 1.49e-10 68 23 10 355 3 FPSE_09184 Acyl-CoA ligase FPSE_09184 Fusarium pseudograminearum (strain CS3096)
Q2XU92 1.5e-10 68 23 12 384 1 Acsbg2 Long-chain-fatty-acid--CoA ligase ACSBG2 Mus musculus
P0DUV4 1.59e-10 68 26 15 357 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.41e-08 62 23 15 386 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 3.86e-08 61 25 16 379 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 2.12e-07 58 25 14 360 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 6.51e-06 53 25 14 377 1 mpbA Malpibaldin synthetase Mortierella alpina
Q6FLU2 1.88e-10 68 24 16 521 3 ACS1 Acetyl-coenzyme A synthetase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
C9K7B5 1.91e-10 68 24 14 378 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 4.4e-08 60 23 12 352 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
B8NHE4 1.97e-10 68 24 12 387 1 flvI Nonribosomal peptide synthetase flvI Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q4WT66 2.08e-10 68 23 15 463 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 8.37e-05 50 23 13 391 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 0.000433 47 21 13 382 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A9MYJ6 2.2e-10 67 26 13 356 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q9VP61 2.35e-10 67 24 15 388 2 AcCoAS Acetyl-coenzyme A synthetase Drosophila melanogaster
P52910 2.36e-10 67 25 11 391 1 ACS2 Acetyl-coenzyme A synthetase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
W6R1D9 2.4e-10 67 25 9 335 3 PROQFM164_S04g000523 Acyl-CoA ligase 891, peroxisomal Penicillium roqueforti (strain FM164)
Q9SS00 2.41e-10 67 23 11 377 2 AAE12 Probable acyl-activating enzyme 12, peroxisomal Arabidopsis thaliana
Q2T3N9 2.63e-10 67 24 12 396 3 acsA Acetyl-coenzyme A synthetase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q54Z60 2.71e-10 67 22 12 515 3 acsA Acetyl-coenzyme A synthetase Dictyostelium discoideum
O60135 2.96e-10 67 27 16 322 3 lcf1 Long-chain-fatty-acid--CoA ligase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A024F910 3.2e-10 67 23 11 391 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 3.51e-10 67 23 13 400 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 3.11e-09 64 23 11 369 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 1.5e-07 59 25 15 400 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 4.58e-07 57 22 9 303 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 0.000293 48 24 12 326 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
G3J456 3.3e-10 67 24 11 292 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 1.21e-09 65 25 12 287 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 1.9e-07 58 23 19 428 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
A1L1K7 3.31e-10 67 21 17 595 2 Acsbg2 Long-chain-fatty-acid--CoA ligase ACSBG2 Rattus norvegicus
B3WC77 3.36e-10 66 26 15 368 3 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus casei (strain BL23)
Q9T0A0 3.4e-10 67 25 14 339 2 LACS4 Long chain acyl-CoA synthetase 4 Arabidopsis thaliana
Q17WR1 3.5e-10 67 24 15 475 3 acsA Acetyl-coenzyme A synthetase Helicobacter acinonychis (strain Sheeba)
Q5SIW6 3.54e-10 67 23 16 514 3 acsA Acetyl-coenzyme A synthetase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q1CUA3 3.98e-10 67 24 15 475 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain HPAG1)
Q03AZ2 3.99e-10 66 26 15 368 3 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A0A2V5H0B0 4.1e-10 67 23 11 391 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 1.79e-08 62 21 16 481 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 2.2e-06 55 23 14 382 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
P59872 4.16e-10 67 23 22 516 3 acsA Acetyl-coenzyme A synthetase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q9BEA2 4.3e-10 66 22 13 371 1 ACSM1 Acyl-coenzyme A synthetase ACSM1, mitochondrial Bos taurus
Q6BQF2 4.34e-10 66 25 13 374 3 ACS1 Acetyl-coenzyme A synthetase 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5SBL6 4.47e-10 67 26 17 390 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
A4G3L8 4.49e-10 66 24 13 387 3 acsA Acetyl-coenzyme A synthetase Herminiimonas arsenicoxydans
P0DUV3 4.68e-10 67 26 14 356 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 7.01e-09 63 24 15 375 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 5.98e-06 53 24 14 373 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 3.12e-05 51 25 17 376 1 mpcA Malpicyclin synthetase Mortierella alpina
A0A336U965 4.75e-10 67 26 13 310 1 melA Aspulvinone E synthetase melA Aspergillus terreus
B6HLU1 4.76e-10 67 25 13 376 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLU1 0.000431 47 24 18 372 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
P19787 4.76e-10 67 25 13 376 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
P19787 0.000431 47 24 18 372 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
Q9C8D4 4.82e-10 66 22 11 376 1 AAE11 Butyrate--CoA ligase AAE11, peroxisomal Arabidopsis thaliana
P09095 5.04e-10 67 23 16 376 1 tycA Tyrocidine synthase 1 Brevibacillus parabrevis
Q7TN78 5.1e-10 66 22 10 374 1 Acsm4 Acyl-coenzyme A synthetase ACSM4, mitochondrial Rattus norvegicus
Q9ES38 5.48e-10 66 26 19 372 1 Slc27a5 Long-chain fatty acid transport protein 5 Rattus norvegicus
Q9Y2P5 5.78e-10 66 25 15 355 1 SLC27A5 Long-chain fatty acid transport protein 5 Homo sapiens
P40806 5.95e-10 67 26 15 295 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 5.3e-08 60 26 15 369 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
M1W0X8 6.23e-10 67 23 20 470 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 6.42e-08 60 25 11 313 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
Q0CRX1 6.24e-10 66 26 13 310 1 melA Aspulvinone E synthetase melA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P27742 7.04e-10 66 25 14 376 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 0.000249 48 23 13 365 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q66FM8 7.59e-10 65 23 15 452 3 acs Acetyl-coenzyme A synthetase Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FNG1 7.59e-10 65 23 15 452 3 acs Acetyl-coenzyme A synthetase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P28812 7.66e-10 65 22 12 377 3 PA3568 Uncharacterized protein PA3568 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P71716 8.45e-10 65 26 10 323 1 mbtA Salicyl-AMP ligase / salicyl-S-ArCP synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B2HHZ8 8.76e-10 65 22 16 439 3 fadD17 Medium/long-chain-fatty-acid--CoA ligase FadD17 Mycobacterium marinum (strain ATCC BAA-535 / M)
B6JKX8 8.8e-10 65 25 12 390 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain P12)
P39845 9.06e-10 66 24 11 362 1 ppsA Plipastatin synthase subunit A Bacillus subtilis (strain 168)
P39845 0.000324 48 24 14 358 1 ppsA Plipastatin synthase subunit A Bacillus subtilis (strain 168)
Q1ZXQ4 9.21e-10 65 21 10 383 2 fcsB Fatty acyl-CoA synthetase B Dictyostelium discoideum
A4TS06 9.75e-10 65 23 15 452 3 acs Acetyl-coenzyme A synthetase Yersinia pestis (strain Pestoides F)
Q1CE37 9.75e-10 65 23 15 452 3 acs Acetyl-coenzyme A synthetase Yersinia pestis bv. Antiqua (strain Nepal516)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_11370
Feature type CDS
Gene aas
Product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase
Location 28267 - 30420 (strand: -1)
Length 2154 (nucleotides) / 717 (amino acids)

Contig

Accession ZDB_526
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2031
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00501 AMP-binding enzyme
PF01553 Acyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0318 Lipid transport and metabolism (I) I O-succinylbenzoic acid-CoA ligase MenE or related acyl-CoA synthetase (AMP-forming)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05939 acyl-[acyl-carrier-protein]-phospholipid O-acyltransferase / long-chain-fatty-acid--[acyl-carrier-protein] ligase [EC:2.3.1.40 6.2.1.20] Fatty acid degradation
Glycerophospholipid metabolism		 -

Protein Sequence

MLMNVLRALLRGLFRIRVTGDLSNLNQPRSVITPNHASFIDGVLLGLFLPTRPVFAMYTNYATPFFIRCLKPIADIIPVDPRNPLALRHLIREVEKGRQIVIFPEGRVTITDSLMKIYDGAAFIAAKTGAKVIPVRIDGAELTYFSRMRKVIKSHFFPAITIHVLPPETIPMPEAPRAAERRRLAGEHLRDIMMDARMTCRPSLTLPQAFLGAVKRYGRFQRIIDDINFSEDSYQGLLKKSLGLSCIISHYTKEGERTGFLLPNATVMGAAILGASMRRRIPALLNYTAGVAGLRNAMKAAGITTIITSRQFLEKGKMTHLPEQLTEANWVYLEEAKASVTLKDKLWVMRHLVTPQAALLPQKPEDDAIILFTSGSEGTPKGVVHSHDSLLANVEQIKTVADFTPKDRFMSALPLFHAFGLTAGLITPLLCGSRIFLYPSPLHYRMVPELTYDQNCTVIFGTSTFLANYARFAHPYDFARVRYAVAGAEKLAEGTKQVWQDKFGLRILEGYGVTECAPVISINVPMAARTGTVGRLVPGMEARLLPVAGIENGGLLQVRGPNVMKGYLRVEKPGQIEPPSAENIQGEVQIGWYDTGDIVTQDAAGFITIRGRVKRFAKLAGEMISLESVEQLALSVSPDKLHAVVTKPDAKRGEALVMFTTDSELDRTQLLTEAKAKGLPELAVPRDIRYIRQLPVLGSGKPDFVTLKQQALQEPQV

Flanking regions ( +/- flanking 50bp)

TCTGCCCGCCGAACTGATTGGTGGAATAATAAATACACAGGGAATTCAGTATGTTGATGAATGTGTTACGTGCACTGCTCCGCGGATTATTCCGCATTCGTGTTACAGGTGACCTGAGTAATCTTAATCAACCGCGAAGTGTTATCACCCCGAACCACGCCTCTTTTATCGATGGTGTTCTGCTGGGGTTATTCCTGCCGACCCGGCCGGTGTTCGCGATGTACACCAATTATGCCACGCCATTTTTCATCCGCTGTTTAAAACCTATTGCCGATATTATTCCGGTGGATCCGCGTAATCCGCTGGCACTGCGGCATCTGATCCGCGAAGTGGAAAAAGGGCGTCAGATAGTGATCTTCCCGGAAGGACGGGTGACGATCACTGATTCCCTGATGAAAATTTACGACGGCGCTGCCTTTATTGCCGCCAAAACCGGCGCGAAAGTGATCCCGGTGCGGATTGACGGCGCGGAACTGACATATTTCAGCCGGATGCGGAAAGTGATCAAAAGTCACTTTTTCCCGGCCATCACCATTCATGTTCTGCCGCCGGAGACCATTCCGATGCCGGAGGCACCGCGTGCCGCAGAGCGCCGCCGTCTGGCGGGGGAACATCTGCGCGACATTATGATGGATGCACGCATGACGTGCCGCCCGTCACTGACACTGCCGCAGGCATTTCTCGGCGCGGTAAAACGTTACGGCCGTTTCCAGCGGATCATTGATGACATCAATTTCAGCGAGGACAGTTATCAGGGGCTGCTGAAAAAATCCCTCGGACTGAGCTGCATTATCAGCCACTACACCAAAGAGGGGGAGCGCACCGGCTTCCTGCTGCCGAATGCCACCGTGATGGGGGCGGCGATCCTCGGTGCTTCCATGCGCCGCCGTATTCCGGCGCTGCTCAACTACACGGCGGGCGTCGCCGGGCTGCGTAATGCTATGAAAGCAGCGGGGATCACGACCATCATCACCTCGCGCCAGTTTCTGGAAAAGGGCAAGATGACACATTTGCCGGAGCAGCTGACAGAAGCCAACTGGGTCTATCTGGAAGAGGCAAAAGCATCCGTTACCCTGAAAGACAAACTGTGGGTGATGCGTCACCTGGTCACGCCGCAGGCGGCACTGCTGCCGCAAAAGCCGGAAGATGATGCGATTATTCTCTTTACCTCCGGCTCGGAAGGGACACCGAAAGGTGTGGTGCACAGCCACGACTCTCTGCTGGCGAACGTTGAGCAGATTAAAACGGTGGCGGATTTCACGCCGAAAGACCGTTTTATGTCCGCACTGCCGCTGTTTCACGCCTTTGGTCTGACTGCCGGGCTTATCACGCCGCTGCTGTGCGGCAGCCGGATTTTCCTCTATCCGAGCCCGCTGCATTACCGCATGGTGCCGGAGCTGACGTACGATCAGAACTGTACCGTTATTTTCGGGACATCCACCTTCCTTGCCAATTATGCCCGTTTTGCTCATCCGTATGATTTTGCCCGTGTCCGCTATGCTGTGGCCGGGGCGGAGAAGCTGGCGGAAGGCACCAAACAGGTCTGGCAGGATAAATTCGGCCTGCGCATCCTGGAAGGTTACGGGGTGACAGAGTGTGCGCCGGTGATCTCCATTAACGTGCCGATGGCCGCCCGTACCGGTACAGTCGGACGGCTGGTGCCGGGAATGGAAGCGCGGCTGCTGCCGGTTGCCGGTATTGAAAACGGCGGGTTGCTGCAGGTGCGCGGCCCGAATGTGATGAAAGGGTATCTGCGGGTGGAAAAACCGGGGCAGATTGAACCGCCGTCAGCGGAGAATATACAGGGCGAGGTTCAGATCGGCTGGTATGACACCGGTGATATCGTCACACAGGATGCAGCCGGGTTTATCACTATCCGCGGACGGGTCAAACGCTTTGCCAAACTGGCCGGTGAGATGATCTCGCTGGAGAGTGTTGAGCAGCTGGCACTGAGTGTTTCGCCGGATAAACTGCATGCCGTGGTGACGAAGCCGGATGCAAAACGCGGCGAAGCACTGGTGATGTTTACCACTGACAGTGAACTGGATCGCACACAACTGCTGACAGAAGCGAAAGCTAAAGGGCTGCCGGAACTGGCGGTTCCGCGTGATATCCGTTATATCAGACAGCTGCCGGTGCTCGGCAGCGGTAAACCGGATTTTGTCACACTGAAACAACAGGCATTACAGGAGCCGCAGGTATGACAGCATCCGCCCCGTTACTGAACAAAGGCATGAAAGCGGTACTGGTTTCC