Homologs in group_3

Help

24 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14600 FBDBKF_14600 36.0 Morganella morganii S1 fimC P pilus assembly protein, chaperone PapD
EHELCC_15405 EHELCC_15405 36.0 Morganella morganii S2 fimC P pilus assembly protein, chaperone PapD
NLDBIP_15935 NLDBIP_15935 36.0 Morganella morganii S4 fimC P pilus assembly protein, chaperone PapD
LHKJJB_15905 LHKJJB_15905 36.0 Morganella morganii S3 fimC P pilus assembly protein, chaperone PapD
HKOGLL_15025 HKOGLL_15025 36.0 Morganella morganii S5 fimC P pilus assembly protein, chaperone PapD
F4V73_RS01040 F4V73_RS01040 34.3 Morganella psychrotolerans - fimbria/pilus periplasmic chaperone
F4V73_RS01065 F4V73_RS01065 33.5 Morganella psychrotolerans - molecular chaperone
F4V73_RS01680 F4V73_RS01680 34.3 Morganella psychrotolerans - fimbria/pilus periplasmic chaperone
F4V73_RS01855 F4V73_RS01855 37.0 Morganella psychrotolerans - molecular chaperone
F4V73_RS05995 F4V73_RS05995 15.3 Morganella psychrotolerans - fimbria/pilus periplasmic chaperone
F4V73_RS07395 F4V73_RS07395 34.3 Morganella psychrotolerans - molecular chaperone
F4V73_RS08430 F4V73_RS08430 32.1 Morganella psychrotolerans - molecular chaperone
F4V73_RS08450 F4V73_RS08450 34.1 Morganella psychrotolerans - molecular chaperone
F4V73_RS08455 F4V73_RS08455 40.2 Morganella psychrotolerans - molecular chaperone
F4V73_RS09380 F4V73_RS09380 31.5 Morganella psychrotolerans - molecular chaperone
F4V73_RS10245 F4V73_RS10245 22.7 Morganella psychrotolerans - molecular chaperone
F4V73_RS10260 F4V73_RS10260 29.6 Morganella psychrotolerans - molecular chaperone
F4V73_RS10275 F4V73_RS10275 29.2 Morganella psychrotolerans - molecular chaperone
F4V73_RS12585 F4V73_RS12585 29.1 Morganella psychrotolerans - molecular chaperone
F4V73_RS13305 F4V73_RS13305 35.7 Morganella psychrotolerans - molecular chaperone
F4V73_RS13315 F4V73_RS13315 24.4 Morganella psychrotolerans - molecular chaperone
F4V73_RS13325 F4V73_RS13325 23.7 Morganella psychrotolerans - molecular chaperone
PMI_RS12530 PMI_RS12530 24.8 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS16665 PMI_RS16665 32.7 Proteus mirabilis HI4320 - molecular chaperone

Distribution of the homologs in the orthogroup group_3

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8X5K6 8.33e-56 180 46 6 224 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P43661 7.72e-50 165 44 5 210 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P62609 1.25e-49 164 42 7 224 1 focC Chaperone protein FocC Escherichia coli
P62610 1.25e-49 164 42 7 224 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P31697 2.37e-44 151 39 7 220 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P59590 8.65e-44 150 39 7 220 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P37923 2.55e-42 145 38 8 227 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42914 2.15e-41 143 37 8 232 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
Q8X5E4 3.5e-40 140 38 8 226 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P75856 3.81e-40 140 37 8 226 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
P77249 9.07e-40 139 35 8 234 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P46004 8.87e-39 137 36 6 230 3 aggD Chaperone protein AggD Escherichia coli
P33409 2.89e-37 133 34 8 232 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P21646 7.15e-37 132 38 11 226 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P53516 6.4e-36 130 39 5 191 3 afaB Chaperone protein AfaB Escherichia coli
P26926 3.07e-35 128 37 7 229 1 caf1M Chaperone protein caf1M Yersinia pestis
P45991 8.35e-35 127 33 7 233 3 hifB Chaperone protein HifB Haemophilus influenzae
P33128 9.36e-35 127 37 10 230 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P25402 3.78e-34 125 34 5 226 3 fanE Chaperone protein FanE Escherichia coli
P35757 7.24e-34 124 34 7 228 3 hifB Chaperone protein HifB Haemophilus influenzae
P69966 7.51e-33 122 35 8 223 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 7.51e-33 122 35 8 223 3 psaB Chaperone protein PsaB Yersinia pestis
P75749 1.04e-32 121 35 5 217 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P15483 1.27e-31 118 34 5 207 3 None Chaperone protein CS3-1 Escherichia coli
P53520 1.23e-30 116 38 5 162 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P46738 1.84e-30 115 37 5 191 3 nfaE Chaperone protein NfaE Escherichia coli
P33407 4.94e-29 112 29 6 240 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P15319 5.1e-28 109 32 6 220 1 papD Chaperone protein PapD Escherichia coli
P33342 3.12e-25 102 28 8 231 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P77599 1.6e-23 97 33 9 206 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P40876 6.26e-23 95 31 8 230 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P53518 1.8e-20 89 26 5 225 3 cssC Chaperone protein CssC Escherichia coli
P33387 1.9e-20 89 30 4 181 3 sefB Chaperone protein SefB Salmonella enteritidis
P53519 2.04e-20 89 26 5 225 3 cssC Chaperone protein CssC Escherichia coli
P25401 9.27e-18 82 26 4 173 1 faeE Chaperone protein FaeE Escherichia coli
Q05433 2.18e-17 81 26 4 173 3 clpE Chaperone protein ClpE Escherichia coli
P77616 9.13e-17 79 26 9 220 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P28722 2.02e-05 47 21 4 162 3 yhcA Uncharacterized fimbrial chaperone YhcA Escherichia coli (strain K12)
P42183 3.9e-05 45 27 3 101 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS10895
Feature type CDS
Gene -
Product molecular chaperone
Location 320133 - 320813 (strand: 1)
Length 681 (nucleotides) / 226 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3
Orthogroup size 25
N. genomes 7

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07346 fimbrial chaperone protein Two-component system -

Protein Sequence

MRKLFPVLLTAMFSFISVSSHAGVTLSGTRMVYDGKQKESSVTVNNPDKTPYLIQSWITDAGKEQAAPEFVITPPLFRLDGEKKNALRVVLTKDTLAQDRETLYWLNVKAIPASDPNAKDSLLISINSRIKLFYRPAGLKDSDAESAYKEVTFSVQGNQLTAKNPTPFYINLAELKIGNKEIEDAGVIAPFSTENWTLSGHATSGTVTWKAINDFGGKTESKNAAL

Flanking regions ( +/- flanking 50bp)

AGGGGGCTAATCACCATTAGCCTCATCCTTTCTCTCATAAGGCGAAGACAATGCGTAAATTATTTCCTGTTTTACTGACGGCTATGTTCTCATTTATTTCAGTGTCATCTCACGCAGGCGTAACACTGAGCGGTACCCGTATGGTGTATGACGGCAAACAAAAAGAATCTTCTGTCACAGTGAATAACCCGGATAAAACACCGTATCTGATTCAGTCATGGATTACGGATGCCGGTAAAGAGCAGGCAGCTCCGGAGTTTGTTATCACGCCGCCGTTATTTCGCCTCGATGGTGAGAAAAAAAATGCATTGCGGGTTGTGCTGACGAAAGACACATTAGCGCAGGATCGCGAAACACTGTATTGGTTAAATGTAAAAGCCATTCCGGCATCTGATCCCAATGCCAAAGATTCATTATTAATTTCAATTAACAGCCGGATTAAACTGTTTTACCGTCCTGCGGGATTAAAGGATTCAGATGCAGAAAGTGCCTATAAAGAGGTTACATTTTCTGTTCAGGGTAATCAGCTGACAGCAAAAAACCCAACGCCTTTTTATATTAATCTGGCAGAGCTTAAAATCGGAAATAAAGAGATTGAAGATGCCGGTGTTATTGCCCCTTTCAGTACTGAAAACTGGACATTATCCGGTCATGCAACATCGGGCACTGTAACCTGGAAAGCAATTAATGATTTCGGCGGAAAAACCGAATCAAAAAATGCGGCACTATAAATACAGTATTACCCCGGATAAATAAAAACATTAACCATACCACTACGTTA