Homologs in group_906

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04785 FBDBKF_04785 91.9 Morganella morganii S1 kbaY tagatose-bisphosphate aldolase subunit KbaY
EHELCC_06075 EHELCC_06075 91.9 Morganella morganii S2 kbaY tagatose-bisphosphate aldolase subunit KbaY
NLDBIP_06395 NLDBIP_06395 91.9 Morganella morganii S4 kbaY tagatose-bisphosphate aldolase subunit KbaY
LHKJJB_03275 LHKJJB_03275 91.9 Morganella morganii S3 kbaY tagatose-bisphosphate aldolase subunit KbaY
HKOGLL_06750 HKOGLL_06750 91.9 Morganella morganii S5 kbaY tagatose-bisphosphate aldolase subunit KbaY
PMI_RS10570 PMI_RS10570 63.0 Proteus mirabilis HI4320 - tagatose bisphosphate family class II aldolase

Distribution of the homologs in the orthogroup group_906

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_906

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A4WEV6 9.07e-175 486 79 0 285 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Enterobacter sp. (strain 638)
A8AQ28 1.27e-174 486 81 0 285 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7NKL0 4.75e-174 484 81 0 280 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LFP2 6.12e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain SMS-3-5 / SECEC)
B7NDC5 6.12e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1R6K0 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain UTI89 / UPEC)
B6I1L2 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain SE11)
P0AB74 9.8e-174 484 79 0 284 1 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain K12)
B1IRH9 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AB75 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCW8 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AG46 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O1:K1 / APEC
A8A4V3 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O9:H4 (strain HS)
B1XGU9 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain K12 / DH10B)
C4ZR47 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain K12 / MC4100 / BW2952)
B7M045 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O8 (strain IAI1)
B7N0S6 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O81 (strain ED1a)
B5YS30 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AB76 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O157:H7
B7LH72 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain 55989 / EAEC)
B7MB62 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZS33 9.8e-174 484 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O139:H28 (strain E24377A / ETEC)
A9MPP7 1.84e-173 483 80 0 285 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7UJ37 9.48e-173 481 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q9KIP8 1.68e-172 481 79 0 284 1 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli
B7LMU4 6.45e-172 479 79 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7CPQ7 7.38e-136 388 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGZ9 7.38e-136 388 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella typhi
A9N6Z8 1.08e-135 387 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BGG5 2.2e-134 384 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella paratyphi A (strain AKU_12601)
Q5PL86 2.2e-134 384 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A6TEF4 6.19e-131 375 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4T6B9 8.38e-126 362 61 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella newport (strain SL254)
Q8VS16 9.66e-126 362 61 0 284 1 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Klebsiella oxytoca
C0PZ24 2.95e-125 361 61 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella paratyphi C (strain RKS4594)
B4TIX9 2.95e-125 361 61 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella heidelberg (strain SL476)
B5REK6 2.95e-125 361 61 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZS8 2.95e-125 361 61 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella enteritidis PT4 (strain P125109)
Q57JK9 3.42e-124 358 60 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella choleraesuis (strain SC-B67)
B4TWB0 4.69e-124 358 60 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella schwarzengrund (strain CVM19633)
Q0TFZ6 3.2e-117 340 56 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NPN7 7.67e-117 340 56 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L9W7 2.26e-116 338 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain 55989 / EAEC)
B2TY92 2.58e-116 338 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7M477 2.58e-116 338 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O8 (strain IAI1)
B5YV43 5.31e-116 337 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4R2 5.31e-116 337 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O157:H7
Q8FFY7 6.6e-116 337 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0C8J7 1.47e-115 337 55 0 283 1 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli
Q323C6 1.57e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella boydii serotype 4 (strain Sb227)
P0C8J6 2.06e-115 336 55 0 283 1 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain K12)
B1IYY4 2.06e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A1W1 2.06e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O9:H4 (strain HS)
B1X7I7 2.06e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain K12 / DH10B)
C4ZSI0 2.06e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain K12 / MC4100 / BW2952)
Q1R9X7 2.37e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain UTI89 / UPEC)
A1ACW2 2.37e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O1:K1 / APEC
B7MEF1 2.37e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UFB3 3.19e-115 335 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LN92 4.99e-115 335 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain SMS-3-5 / SECEC)
B7NCC6 6.85e-115 335 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3Z0B4 1.2e-114 334 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella sonnei (strain Ss046)
Q83QY5 4.44e-114 333 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella flexneri
Q0T342 5.52e-114 332 54 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella flexneri serotype 5b (strain 8401)
A7ZNR5 5.52e-114 332 54 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32EA9 1.59e-113 331 54 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella dysenteriae serotype 1 (strain Sd197)
P94453 1.68e-74 232 43 3 286 3 fba Fructose-bisphosphate aldolase Geobacillus stearothermophilus
A0A2P6MHY1 3.15e-73 229 41 0 283 1 sqiA Sulfofructosephosphate aldolase Alkalicoccus urumqiensis
P13243 6.47e-73 228 41 3 286 1 fbaA Probable fructose-bisphosphate aldolase Bacillus subtilis (strain 168)
Q703I2 1.24e-71 225 41 3 304 1 fba Fructose-bisphosphate aldolase Thermus caldophilus
P67478 3.03e-70 221 41 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain MW2)
Q6G7I5 3.03e-70 221 41 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain MSSA476)
Q6GEV0 3.03e-70 221 41 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain MRSA252)
P99075 3.03e-70 221 41 3 282 1 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain N315)
P67477 3.03e-70 221 41 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HE75 3.03e-70 221 41 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain COL)
Q8CNI3 2.57e-69 219 40 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM97 2.57e-69 219 40 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q65D09 4.99e-68 216 40 3 286 3 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A8B2U2 1.99e-67 215 37 5 309 1 fba Fructose-bisphosphate aldolase Giardia intestinalis (strain ATCC 50803 / WB clone C6)
Q9ZMQ6 2.44e-64 207 37 5 310 3 fba Fructose-bisphosphate aldolase Helicobacter pylori (strain J99 / ATCC 700824)
A7ZAH2 2.78e-63 204 38 3 286 3 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P42420 7.43e-63 202 38 3 286 1 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Bacillus subtilis (strain 168)
P56109 1.17e-62 202 36 5 310 1 fba Fructose-bisphosphate aldolase Helicobacter pylori (strain ATCC 700392 / 26695)
Q5WKY5 6.4e-62 200 37 3 283 3 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Shouchella clausii (strain KSM-K16)
Q9KAH3 4.12e-57 187 38 3 279 3 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P0CZ59 8.81e-56 184 39 9 298 3 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ58 8.81e-56 184 39 9 298 3 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P68906 1.07e-55 184 39 9 298 3 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P68905 1.07e-55 184 39 9 298 3 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M1
Q5XA12 1.13e-55 184 39 9 298 1 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P75089 2.15e-55 183 35 7 288 3 fba Fructose-bisphosphate aldolase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P0A4S2 6.06e-55 182 39 8 298 1 fba Fructose-bisphosphate aldolase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4S1 6.06e-55 182 39 8 298 3 fba Fructose-bisphosphate aldolase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P77704 2e-52 175 35 3 278 1 ydjI Uncharacterized protein YdjI Escherichia coli (strain K12)
P47269 2.79e-52 175 34 7 288 3 fba Fructose-bisphosphate aldolase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
O83668 1.15e-51 175 33 8 327 3 fba Fructose-bisphosphate aldolase Treponema pallidum (strain Nichols)
Q8YNK2 4.95e-49 169 34 9 331 1 fda Fructose-bisphosphate aldolase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9I5Y1 6.51e-49 168 35 9 328 3 fba Fructose-bisphosphate aldolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O87796 2.04e-48 167 35 8 328 3 fba Fructose-bisphosphate aldolase Stutzerimonas stutzeri
Q9XDP3 7.32e-48 166 33 9 334 3 fba Fructose-bisphosphate aldolase Nostoc commune
Q59100 1.52e-45 159 33 8 329 3 cbbAC Fructose-bisphosphate aldolase, chromosomal Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q55664 2.42e-45 159 33 10 325 1 fbaA Fructose-bisphosphate aldolase class 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q59101 3.04e-45 159 33 8 329 3 cbbAP Fructose-bisphosphate aldolase, plasmid Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9PPP3 4.72e-45 157 34 7 281 3 fba Fructose-bisphosphate aldolase Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q56815 2.76e-44 156 33 10 331 1 cbbA Fructose-bisphosphate aldolase Xanthobacter flavus
P29271 1.94e-38 141 30 8 329 3 cfxB Fructose-bisphosphate aldolase 2 Cereibacter sphaeroides
P58336 4.33e-37 137 32 8 331 3 cbbA Fructose-bisphosphate aldolase Rhizobium meliloti (strain 1021)
P56888 4.24e-35 132 32 8 331 3 cbbA Fructose-bisphosphate aldolase Sinorhizobium medicae (strain WSM419)
P0CJ44 3.25e-34 129 35 9 259 1 CIMG_05755 Putative fructose-bisphosphate aldolase Coccidioides immitis (strain RS)
P27995 1.66e-33 128 30 11 336 3 cfxA Fructose-bisphosphate aldolase 1 Cereibacter sphaeroides
D4GYE0 2.06e-29 117 31 6 256 1 fba Fructose-bisphosphate aldolase class 2 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q0PAS0 3.16e-23 100 26 11 322 1 fba Fructose-bisphosphate aldolase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1VYV7 3.22e-23 100 26 11 319 3 fba Fructose-bisphosphate aldolase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9HGY9 1.64e-21 95 27 12 344 2 fbaA Fructose-bisphosphate aldolase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9C2U0 1.8e-19 90 26 13 342 3 FBA1 Fructose-bisphosphate aldolase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P19537 1.85e-19 90 26 9 313 1 fba Fructose-bisphosphate aldolase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q96UH7 1.23e-18 87 27 13 343 1 FBA1 Fructose-bisphosphate aldolase 1 Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01)
P36580 2.7e-18 87 29 13 324 1 fba1 Fructose-bisphosphate aldolase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8K9B2 3.35e-18 86 24 11 324 3 fbaA Fructose-bisphosphate aldolase class 2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P44429 3.56e-18 86 26 14 327 3 fba Fructose-bisphosphate aldolase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9URB4 3.81e-18 86 25 10 341 1 FBA1 Fructose-bisphosphate aldolase Candida albicans (strain SC5314 / ATCC MYA-2876)
P57526 4.04e-18 86 26 13 323 3 fbaA Fructose-bisphosphate aldolase class 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P53444 7.24e-18 85 27 12 340 3 fba Fructose-bisphosphate aldolase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P0AB73 1.65e-17 84 26 12 321 3 fbaA Fructose-bisphosphate aldolase class 2 Shigella flexneri
P0AB71 1.65e-17 84 26 12 321 1 fbaA Fructose-bisphosphate aldolase class 2 Escherichia coli (strain K12)
P0AB72 1.65e-17 84 26 12 321 3 fbaA Fructose-bisphosphate aldolase class 2 Escherichia coli O157:H7
O52402 8.58e-17 82 25 12 321 3 fba Fructose-bisphosphate aldolase Edwardsiella ictaluri (strain 93-146)
P14540 9.08e-17 82 27 14 333 1 FBA1 Fructose-bisphosphate aldolase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O69600 1.6e-16 81 25 10 313 3 fba Fructose-bisphosphate aldolase Mycobacterium leprae (strain TN)
Q9ZEM7 3.03e-16 80 24 8 316 1 fba Fructose-bisphosphate aldolase Streptomyces galbus
Q89AB6 6.99e-15 77 23 12 321 3 fbaA Fructose-bisphosphate aldolase class 2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P9WQA3 8.1e-15 77 25 12 324 1 fba Fructose-bisphosphate aldolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQA2 8.1e-15 77 25 12 324 3 fba Fructose-bisphosphate aldolase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67476 8.1e-15 77 25 12 324 3 fba Fructose-bisphosphate aldolase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9X8R6 1.42e-13 73 24 9 325 3 fba Fructose-bisphosphate aldolase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O51401 1.09e-10 65 23 12 329 1 fba Fructose-bisphosphate aldolase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P50923 3.55e-05 45 31 0 70 3 cbbA Fructose-bisphosphate aldolase 2 (Fragment) Rhodobacter capsulatus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09255
Feature type CDS
Gene kbaY
Product tagatose-bisphosphate aldolase subunit KbaY
Location 1938333 - 1939190 (strand: 1)
Length 858 (nucleotides) / 285 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_906
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01116 Fructose-bisphosphate aldolase class-II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0191 Carbohydrate transport and metabolism (G) G Fructose/tagatose bisphosphate aldolase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08302 tagatose 1,6-diphosphate aldolase GatY/KbaY [EC:4.1.2.40] Galactose metabolism
Metabolic pathways		 -

Protein Sequence

MAIISTKYLLTHAQTNGYAVPAFNIHNAETIQAILETCAEMRSPVILAGTPGTFKHIGFQEIYALCQAYSHSFAMPVALHLDHHETLDDIRTKVGEGVRSAMIDGSHFPFEENIALVKSVVSFCHAHDCSVEAELGRLGGVEDDMDVDAESAFLTSPEEARRFAQLTGIDSLAVAIGTAHGLYTHRPKIDFARLEKIRSIVDIPLVLHGASDVPDADVRRTIELGVCKVNVATELKIAFAGAVREWFAANPEGNDPRYYMRTGMDAMKAVVRDKIRVCGADGQLL

Flanking regions ( +/- flanking 50bp)

CAGGGCGTTATTGTTCATCCGTGGACAGACCAACACACAGGAGCGTAATCATGGCTATCATCTCAACAAAATATTTACTGACCCACGCACAAACCAATGGCTATGCCGTTCCTGCCTTTAACATTCATAACGCCGAAACGATTCAGGCCATTCTGGAAACCTGCGCGGAAATGCGTTCGCCGGTGATTCTGGCAGGGACACCGGGTACATTTAAACATATCGGATTTCAGGAAATTTATGCATTGTGTCAGGCCTATTCGCACTCTTTTGCCATGCCTGTCGCACTGCATCTTGATCACCATGAAACCCTTGATGATATCCGGACCAAAGTCGGTGAAGGCGTGCGCAGTGCAATGATCGACGGCAGTCATTTTCCGTTTGAGGAAAATATTGCCCTGGTGAAATCTGTTGTCAGCTTCTGTCACGCACACGATTGCAGCGTGGAAGCCGAGCTTGGTCGCCTGGGTGGCGTGGAAGATGATATGGACGTTGATGCGGAAAGTGCATTTCTGACCTCCCCGGAAGAAGCCCGGCGCTTTGCACAACTGACCGGTATTGACAGCCTGGCGGTTGCCATCGGTACCGCGCACGGACTGTATACCCACCGCCCGAAAATTGATTTCGCCCGGCTGGAAAAAATCCGCAGTATTGTGGATATCCCGCTGGTACTGCATGGTGCAAGCGATGTGCCTGATGCCGATGTGCGCCGCACCATCGAACTTGGGGTATGCAAAGTCAACGTCGCCACTGAGCTGAAGATTGCCTTTGCCGGTGCCGTCAGAGAATGGTTTGCTGCAAACCCTGAGGGTAATGATCCGCGCTACTACATGCGCACAGGAATGGATGCCATGAAAGCCGTTGTCCGCGACAAAATCCGCGTATGCGGCGCGGACGGTCAGCTTTTGTAGCCGGTCAGACGGCTCCGGTTCCCCCGCCGGAGCTGTCACCACCAGAGACA