Homologs in group_906

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04785 FBDBKF_04785 100.0 Morganella morganii S1 kbaY tagatose-bisphosphate aldolase subunit KbaY
NLDBIP_06395 NLDBIP_06395 100.0 Morganella morganii S4 kbaY tagatose-bisphosphate aldolase subunit KbaY
LHKJJB_03275 LHKJJB_03275 100.0 Morganella morganii S3 kbaY tagatose-bisphosphate aldolase subunit KbaY
HKOGLL_06750 HKOGLL_06750 100.0 Morganella morganii S5 kbaY tagatose-bisphosphate aldolase subunit KbaY
F4V73_RS09255 F4V73_RS09255 91.9 Morganella psychrotolerans kbaY tagatose-bisphosphate aldolase subunit KbaY
PMI_RS10570 PMI_RS10570 61.3 Proteus mirabilis HI4320 - tagatose bisphosphate family class II aldolase

Distribution of the homologs in the orthogroup group_906

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_906

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1LFP2 3e-177 493 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain SMS-3-5 / SECEC)
B7NDC5 3e-177 493 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NKL0 4.36e-177 492 82 0 280 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q1R6K0 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain UTI89 / UPEC)
B6I1L2 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain SE11)
P0AB74 4.76e-177 492 81 0 284 1 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain K12)
B1IRH9 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AB75 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCW8 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AG46 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O1:K1 / APEC
A8A4V3 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O9:H4 (strain HS)
B1XGU9 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain K12 / DH10B)
C4ZR47 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain K12 / MC4100 / BW2952)
B7M045 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O8 (strain IAI1)
B7N0S6 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O81 (strain ED1a)
B5YS30 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AB76 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O157:H7
B7LH72 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli (strain 55989 / EAEC)
B7MB62 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZS33 4.76e-177 492 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UJ37 5.43e-176 489 81 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q9KIP8 9.08e-176 489 81 0 284 1 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia coli
A9MPP7 2.7e-175 488 81 0 285 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7LMU4 7.06e-175 487 80 0 284 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8AQ28 1.76e-174 486 81 0 285 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WEV6 1.98e-174 486 80 0 285 3 kbaY D-tagatose-1,6-bisphosphate aldolase subunit KbaY Enterobacter sp. (strain 638)
Q7CPQ7 2.01e-134 384 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGZ9 2.01e-134 384 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella typhi
A9N6Z8 2.73e-134 384 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BGG5 5.13e-133 380 62 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella paratyphi A (strain AKU_12601)
Q5PL86 5.13e-133 380 62 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A6TEF4 2.18e-130 374 63 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8VS16 8.9e-125 360 61 0 284 1 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Klebsiella oxytoca
C0PZ24 1.01e-123 357 59 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella paratyphi C (strain RKS4594)
B4TIX9 1.01e-123 357 59 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella heidelberg (strain SL476)
B5REK6 1.01e-123 357 59 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZS8 1.01e-123 357 59 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella enteritidis PT4 (strain P125109)
B4T6B9 4.37e-123 355 59 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella newport (strain SL254)
Q57JK9 8.15e-123 355 59 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella choleraesuis (strain SC-B67)
B4TWB0 1.36e-122 354 59 0 284 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Salmonella schwarzengrund (strain CVM19633)
B2TY92 2.1e-116 338 56 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7M477 2.1e-116 338 56 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O8 (strain IAI1)
B7L9W7 2.72e-116 338 56 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain 55989 / EAEC)
B5YV43 3.78e-116 338 56 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4R2 3.78e-116 338 56 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O157:H7
B7NPN7 5.14e-116 338 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q323C6 5.79e-116 337 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella boydii serotype 4 (strain Sb227)
Q0TFZ6 9.68e-116 337 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0C8J6 1.83e-115 336 55 0 283 1 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain K12)
B1IYY4 1.83e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A1W1 1.83e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O9:H4 (strain HS)
B1X7I7 1.83e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain K12 / DH10B)
C4ZSI0 1.83e-115 336 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain K12 / MC4100 / BW2952)
B7NCC6 4.88e-115 335 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3Z0B4 8.62e-115 334 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella sonnei (strain Ss046)
Q1R9X7 1.07e-114 334 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain UTI89 / UPEC)
A1ACW2 1.07e-114 334 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O1:K1 / APEC
B7MEF1 1.07e-114 334 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FFY7 2e-114 333 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1LN92 2.41e-114 333 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli (strain SMS-3-5 / SECEC)
Q83QY5 3.53e-114 333 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella flexneri
A7ZNR5 3.65e-114 333 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T342 4.49e-114 333 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella flexneri serotype 5b (strain 8401)
P0C8J7 4.9e-114 333 55 0 283 1 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli
Q32EA9 9.23e-114 332 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Shigella dysenteriae serotype 1 (strain Sd197)
B7UFB3 1.01e-113 332 55 0 283 3 gatY D-tagatose-1,6-bisphosphate aldolase subunit GatY Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A0A2P6MHY1 4.37e-74 231 40 0 283 1 sqiA Sulfofructosephosphate aldolase Alkalicoccus urumqiensis
P94453 1.93e-73 229 42 3 286 3 fba Fructose-bisphosphate aldolase Geobacillus stearothermophilus
P13243 1.32e-70 222 41 3 286 1 fbaA Probable fructose-bisphosphate aldolase Bacillus subtilis (strain 168)
P67478 1.62e-70 222 42 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain MW2)
Q6G7I5 1.62e-70 222 42 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain MSSA476)
Q6GEV0 1.62e-70 222 42 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain MRSA252)
P99075 1.62e-70 222 42 3 282 1 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain N315)
P67477 1.62e-70 222 42 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HE75 1.62e-70 222 42 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus aureus (strain COL)
Q8CNI3 2.58e-70 221 41 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM97 2.58e-70 221 41 3 282 3 fba Fructose-bisphosphate aldolase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q703I2 2.03e-68 217 40 3 304 1 fba Fructose-bisphosphate aldolase Thermus caldophilus
A8B2U2 2.69e-68 218 38 5 310 1 fba Fructose-bisphosphate aldolase Giardia intestinalis (strain ATCC 50803 / WB clone C6)
Q65D09 6.07e-68 216 40 3 286 3 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9ZMQ6 3.34e-63 204 37 5 310 3 fba Fructose-bisphosphate aldolase Helicobacter pylori (strain J99 / ATCC 700824)
P42420 4.15e-63 203 38 3 286 1 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Bacillus subtilis (strain 168)
A7ZAH2 7.93e-63 202 38 3 286 3 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P56109 1.04e-61 200 36 5 310 1 fba Fructose-bisphosphate aldolase Helicobacter pylori (strain ATCC 700392 / 26695)
Q5WKY5 1.27e-59 194 36 3 283 3 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Shouchella clausii (strain KSM-K16)
Q9KAH3 6.4e-59 192 39 3 279 3 iolJ 6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P75089 6.14e-57 187 36 7 290 3 fba Fructose-bisphosphate aldolase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47269 1.07e-54 181 35 7 293 3 fba Fructose-bisphosphate aldolase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P77704 3.24e-54 180 37 4 278 1 ydjI Uncharacterized protein YdjI Escherichia coli (strain K12)
P0A4S2 6.54e-54 179 38 7 298 1 fba Fructose-bisphosphate aldolase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4S1 6.54e-54 179 38 7 298 3 fba Fructose-bisphosphate aldolase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O83668 1.02e-52 177 34 8 327 3 fba Fructose-bisphosphate aldolase Treponema pallidum (strain Nichols)
P0CZ59 1.14e-52 176 38 8 298 3 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ58 1.14e-52 176 38 8 298 3 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P68906 1.4e-52 176 38 8 298 3 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P68905 1.4e-52 176 38 8 298 3 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M1
Q5XA12 1.7e-52 176 38 8 298 1 fba Fructose-bisphosphate aldolase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q9I5Y1 9.43e-48 166 34 9 328 3 fba Fructose-bisphosphate aldolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8YNK2 3.73e-47 164 33 9 331 1 fda Fructose-bisphosphate aldolase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O87796 2.32e-46 162 34 8 328 3 fba Fructose-bisphosphate aldolase Stutzerimonas stutzeri
Q9XDP3 1.9e-45 159 32 11 338 3 fba Fructose-bisphosphate aldolase Nostoc commune
Q56815 4.26e-45 159 33 10 331 1 cbbA Fructose-bisphosphate aldolase Xanthobacter flavus
Q9PPP3 9.26e-45 156 34 7 281 3 fba Fructose-bisphosphate aldolase Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q59101 1.91e-44 157 32 7 328 3 cbbAP Fructose-bisphosphate aldolase, plasmid Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q59100 2.86e-44 156 32 7 328 3 cbbAC Fructose-bisphosphate aldolase, chromosomal Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q55664 1.84e-42 152 32 9 324 1 fbaA Fructose-bisphosphate aldolase class 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P29271 2.43e-40 146 31 8 329 3 cfxB Fructose-bisphosphate aldolase 2 Cereibacter sphaeroides
P58336 4.74e-38 140 33 8 331 3 cbbA Fructose-bisphosphate aldolase Rhizobium meliloti (strain 1021)
P56888 1.86e-36 136 32 8 331 3 cbbA Fructose-bisphosphate aldolase Sinorhizobium medicae (strain WSM419)
P27995 2.32e-36 135 32 10 337 3 cfxA Fructose-bisphosphate aldolase 1 Cereibacter sphaeroides
P0CJ44 9.51e-32 122 34 8 249 1 CIMG_05755 Putative fructose-bisphosphate aldolase Coccidioides immitis (strain RS)
D4GYE0 1.4e-27 112 29 6 252 1 fba Fructose-bisphosphate aldolase class 2 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q0PAS0 2.36e-21 95 26 13 329 1 fba Fructose-bisphosphate aldolase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1VYV7 2.49e-21 95 26 13 329 3 fba Fructose-bisphosphate aldolase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9HGY9 2.35e-19 90 26 12 340 2 fbaA Fructose-bisphosphate aldolase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P19537 6.56e-19 88 25 8 313 1 fba Fructose-bisphosphate aldolase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P57526 1.36e-18 87 26 12 318 3 fbaA Fructose-bisphosphate aldolase class 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9URB4 3.59e-18 86 25 10 341 1 FBA1 Fructose-bisphosphate aldolase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8K9B2 8.5e-18 85 25 12 319 3 fbaA Fructose-bisphosphate aldolase class 2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P0AB73 3.05e-17 84 25 11 320 3 fbaA Fructose-bisphosphate aldolase class 2 Shigella flexneri
P0AB71 3.05e-17 84 25 11 320 1 fbaA Fructose-bisphosphate aldolase class 2 Escherichia coli (strain K12)
P0AB72 3.05e-17 84 25 11 320 3 fbaA Fructose-bisphosphate aldolase class 2 Escherichia coli O157:H7
P53444 3.65e-17 84 27 13 340 3 fba Fructose-bisphosphate aldolase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q89AB6 4.97e-17 83 25 9 287 3 fbaA Fructose-bisphosphate aldolase class 2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q96UH7 6.57e-17 83 27 12 343 1 FBA1 Fructose-bisphosphate aldolase 1 Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01)
O52402 1.52e-16 82 25 12 317 3 fba Fructose-bisphosphate aldolase Edwardsiella ictaluri (strain 93-146)
P36580 1.88e-16 81 28 13 322 1 fba1 Fructose-bisphosphate aldolase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9ZEM7 2.64e-16 81 24 8 316 1 fba Fructose-bisphosphate aldolase Streptomyces galbus
Q9C2U0 2.68e-16 81 24 12 341 3 FBA1 Fructose-bisphosphate aldolase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
O69600 2.22e-15 78 24 8 307 3 fba Fructose-bisphosphate aldolase Mycobacterium leprae (strain TN)
P44429 2.92e-15 78 26 15 328 3 fba Fructose-bisphosphate aldolase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P14540 2.1e-14 75 26 15 333 1 FBA1 Fructose-bisphosphate aldolase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P9WQA3 1.33e-13 73 24 9 307 1 fba Fructose-bisphosphate aldolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQA2 1.33e-13 73 24 9 307 3 fba Fructose-bisphosphate aldolase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67476 1.33e-13 73 24 9 307 3 fba Fructose-bisphosphate aldolase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9X8R6 4.08e-13 72 24 9 325 3 fba Fructose-bisphosphate aldolase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O51401 4.46e-13 72 23 11 330 1 fba Fructose-bisphosphate aldolase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P50923 3.13e-05 45 31 0 70 3 cbbA Fructose-bisphosphate aldolase 2 (Fragment) Rhodobacter capsulatus

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_06075
Feature type CDS
Gene kbaY
Product tagatose-bisphosphate aldolase subunit KbaY
Location 218171 - 219028 (strand: 1)
Length 858 (nucleotides) / 285 (amino acids)

Contig

Accession ZDB_215
Length 284267 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_906
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01116 Fructose-bisphosphate aldolase class-II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0191 Carbohydrate transport and metabolism (G) G Fructose/tagatose bisphosphate aldolase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08302 tagatose 1,6-diphosphate aldolase GatY/KbaY [EC:4.1.2.40] Galactose metabolism
Metabolic pathways
-

Protein Sequence

MGIISTKYLLTHAQANGYAVPAFNIHNAETIQAILEACAELRAPVILAGTPGTFKHISFPEIYALCDAYSRSFSMPVALHLDHHETLDDIRTKVGQGVRSAMIDGSHFPFEENVALVKSVVDFCHSQDCSVEAELGRLGGVEDDMDVDAESAFLTSPDEARRFAQLTGIDSLAVAIGTAHGLYTSRPKIDFARLEKIRSITDIPLVLHGASDVPDADVRRTIELGVCKVNVATELKIAFAGAVRAWFAENPDGNDPRYYMRVGMDAMKAVVRDKIRVCGAEGQLL

Flanking regions ( +/- flanking 50bp)

CAGGGCGTGATTATTCACCCCTTCAATAACCAGAACACAGGAGCGTAATCATGGGGATCATCTCAACCAAATATCTGCTCACACATGCACAGGCCAATGGCTATGCGGTTCCGGCGTTTAATATCCATAACGCCGAAACTATTCAGGCCATTCTGGAAGCCTGTGCGGAACTGCGTGCACCGGTGATTCTGGCGGGCACGCCGGGCACCTTTAAACACATCAGCTTCCCGGAAATTTATGCACTGTGTGACGCCTATTCCCGCTCGTTTTCCATGCCGGTCGCGCTGCATCTTGACCACCACGAAACTCTTGACGATATCCGCACCAAAGTCGGCCAGGGCGTGCGCAGTGCCATGATCGACGGCAGTCATTTTCCGTTTGAGGAGAATGTCGCGCTGGTCAAATCCGTGGTGGATTTCTGTCACAGTCAGGATTGCAGTGTGGAAGCGGAACTCGGCCGTCTCGGCGGCGTTGAGGATGATATGGATGTGGATGCGGAAAGTGCCTTTCTGACCTCCCCGGATGAAGCGCGCCGTTTTGCACAACTGACCGGCATCGACAGCCTGGCAGTGGCTATCGGTACCGCTCACGGCCTGTATACCAGCCGTCCGAAAATTGATTTTGCCCGGCTGGAAAAAATCCGCAGTATTACGGATATCCCGCTGGTGCTGCACGGCGCGAGTGATGTGCCGGATGCGGATGTCCGCCGCACCATTGAGCTGGGGGTGTGCAAAGTCAATGTCGCCACCGAGCTGAAAATCGCCTTTGCCGGGGCGGTCCGTGCCTGGTTTGCGGAAAATCCGGACGGCAATGATCCGCGCTATTACATGCGGGTCGGTATGGATGCCATGAAAGCGGTGGTCCGCGATAAAATCAGGGTCTGTGGTGCGGAAGGTCAGCTTCTGTAACCCGTCAGGCGGCACTGTGTTCCCCCGCAGTGCCGCCTTTTTCATCTGCG