Homologs in group_817

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04100 FBDBKF_04100 92.4 Morganella morganii S1 xerD site-specific tyrosine recombinase XerD
EHELCC_05390 EHELCC_05390 92.4 Morganella morganii S2 xerD site-specific tyrosine recombinase XerD
NLDBIP_05710 NLDBIP_05710 92.4 Morganella morganii S4 xerD site-specific tyrosine recombinase XerD
LHKJJB_02590 LHKJJB_02590 92.4 Morganella morganii S3 xerD site-specific tyrosine recombinase XerD
HKOGLL_06065 HKOGLL_06065 92.4 Morganella morganii S5 xerD site-specific tyrosine recombinase XerD
PMI_RS09920 PMI_RS09920 76.2 Proteus mirabilis HI4320 xerD site-specific tyrosine recombinase XerD

Distribution of the homologs in the orthogroup group_817

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_817

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O31206 2.38e-173 484 77 0 296 1 xerD Tyrosine recombinase XerD Proteus mirabilis
Q8ZHK1 3.86e-162 456 73 0 297 3 xerD Tyrosine recombinase XerD Yersinia pestis
Q7ZAM0 2.12e-157 444 73 0 293 3 xerD Tyrosine recombinase XerD Shigella flexneri
P0A8P8 2.92e-157 443 73 0 293 1 xerD Tyrosine recombinase XerD Escherichia coli (strain K12)
P0A8P9 2.92e-157 443 73 0 293 3 xerD Tyrosine recombinase XerD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X574 3.28e-156 441 73 0 293 3 xerD Tyrosine recombinase XerD Escherichia coli O157:H7
P0A2P6 9.29e-156 439 73 0 293 1 xerD Tyrosine recombinase XerD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P7 9.29e-156 439 73 0 293 3 xerD Tyrosine recombinase XerD Salmonella typhi
P44630 4.13e-147 417 66 0 293 3 xerD Tyrosine recombinase XerD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CPF0 1.98e-146 416 64 0 296 3 xerD Tyrosine recombinase XerD Pasteurella multocida (strain Pm70)
Q7MNQ0 6.12e-142 405 66 2 293 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain YJ016)
Q7ZAJ0 6.12e-142 405 66 2 293 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain CMCP6)
Q9KPE9 4.5e-141 402 66 3 296 3 xerD Tyrosine recombinase XerD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7VPN8 4.97e-139 397 64 1 297 3 xerD Tyrosine recombinase XerD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7ZAJ8 6.21e-124 359 61 1 296 3 xerD Tyrosine recombinase XerD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q88MV0 5.5e-123 357 63 1 292 3 xerD Tyrosine recombinase XerD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HXQ6 6.92e-123 356 60 1 292 3 xerD Tyrosine recombinase XerD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PCQ9 2.62e-102 305 52 2 304 3 xerD Tyrosine recombinase XerD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8XWD0 1.45e-101 303 55 3 289 3 xerD Tyrosine recombinase XerD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8PGR5 1.53e-98 295 51 2 301 3 xerD Tyrosine recombinase XerD Xanthomonas axonopodis pv. citri (strain 306)
Q9PDF4 9.27e-97 291 51 2 295 3 xerD Tyrosine recombinase XerD Xylella fastidiosa (strain 9a5c)
Q87DN0 3.22e-93 282 51 2 294 3 xerD Tyrosine recombinase XerD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P46352 6.93e-87 265 44 2 290 3 xerD Tyrosine recombinase XerD Bacillus subtilis (strain 168)
Q49XU5 1.88e-83 256 43 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HP53 2.36e-83 256 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7ZAJ2 3.31e-83 255 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q4L6J7 8.71e-83 254 42 3 297 3 xerD Tyrosine recombinase XerD Staphylococcus haemolyticus (strain JCSC1435)
Q9K068 3.83e-82 253 45 3 293 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JV76 5.55e-82 252 45 3 293 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P0A0P1 8e-82 252 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MW2)
P0A0P2 8e-82 252 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus
Q6G967 8e-82 252 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MSSA476)
Q6GGK1 8e-82 252 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MRSA252)
P0A0P0 8e-82 252 42 2 295 1 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain N315)
P0A0N9 8e-82 252 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFS5 8e-82 252 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain COL)
Q7ZAM3 4.54e-81 250 41 4 293 3 xerD Tyrosine recombinase XerD Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q71Y59 2.79e-80 248 46 3 294 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serotype 4b (strain F2365)
Q9KCP0 6.14e-80 247 44 2 290 3 xerD Tyrosine recombinase XerD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8Y5V0 2.78e-79 245 45 3 295 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92A53 2.36e-78 243 45 3 295 3 xerD Tyrosine recombinase XerD Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q93C64 9.71e-73 229 40 2 288 3 xerD Tyrosine recombinase XerD Lacticaseibacillus casei
Q8KET0 1.41e-71 226 40 2 293 3 xerD Tyrosine recombinase XerD Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q7ZAM7 1.02e-68 218 36 2 298 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SA5 1.02e-68 218 36 2 298 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q92ME3 6.7e-68 217 44 6 304 3 xerD Tyrosine recombinase XerD Rhizobium meliloti (strain 1021)
Q0VM16 1.48e-67 216 43 4 289 3 xerC Tyrosine recombinase XerC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q89XW5 1.04e-66 214 44 6 310 3 xerD Tyrosine recombinase XerD Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A5URM3 2.57e-66 213 41 4 278 3 xerC Tyrosine recombinase XerC Roseiflexus sp. (strain RS-1)
A7NFG3 4.35e-66 212 41 4 294 3 xerC Tyrosine recombinase XerC Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q7ZAN4 1.73e-65 210 41 5 300 3 xerD Tyrosine recombinase XerD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B2A335 1.89e-65 210 41 5 295 3 xerC Tyrosine recombinase XerC Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q97HE5 3.39e-65 209 38 5 295 3 CA_C2066 Putative tyrosine recombinase CA_C2066 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9KA25 1.2e-64 208 38 4 302 3 xerC Tyrosine recombinase XerC Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A9B1E0 3.04e-64 207 43 3 280 3 xerC Tyrosine recombinase XerC Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q98FX8 7.64e-64 206 43 5 304 3 xerD Tyrosine recombinase XerD Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8U9U6 1.09e-63 207 41 5 310 3 xerD Tyrosine recombinase XerD Agrobacterium fabrum (strain C58 / ATCC 33970)
A5D2W6 1.84e-62 202 40 5 304 3 xerC Tyrosine recombinase XerC Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q7ZAP1 2.49e-62 202 39 4 300 3 xerD Tyrosine recombinase XerD Bifidobacterium longum (strain NCC 2705)
P39776 5.04e-62 201 36 3 295 1 xerC Tyrosine recombinase XerC Bacillus subtilis (strain 168)
Q7ZAM5 1.04e-60 198 39 5 300 3 xerC Tyrosine recombinase XerC Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8NQL5 1.08e-60 198 38 6 300 3 xerD Tyrosine recombinase XerD Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q9CKC2 4.29e-60 196 39 5 292 3 xerC Tyrosine recombinase XerC Pasteurella multocida (strain Pm70)
A5UE41 1.74e-59 194 39 6 289 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain PittEE)
Q4UM01 3.4e-59 194 39 7 298 3 xerD Tyrosine recombinase XerD Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P44818 1.09e-58 192 39 6 289 1 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92IC9 1.66e-58 192 39 6 290 3 xerD Tyrosine recombinase XerD Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9A437 1.89e-58 192 40 5 301 3 xerD Tyrosine recombinase XerD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B5YFZ8 2.8e-58 192 37 4 291 3 xerC Tyrosine recombinase XerC Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q4QMP0 3.56e-58 191 39 6 289 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain 86-028NP)
Q7ZAJ4 4.08e-58 191 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPU0 4.08e-58 191 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
C1DJ58 8.29e-58 191 40 4 293 3 xerC Tyrosine recombinase XerC Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q65V80 1.57e-57 189 39 4 282 3 xerC Tyrosine recombinase XerC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65JN5 2.99e-57 189 36 4 296 3 xerC Tyrosine recombinase XerC Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B7UNC8 4.09e-57 189 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5YY58 4.27e-57 189 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4T6 4.27e-57 189 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7
Q8D1K0 4.37e-57 189 36 5 292 3 xerC Tyrosine recombinase XerC Yersinia pestis
Q8NWZ8 4.81e-57 188 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MW2)
Q6G9W1 4.81e-57 188 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MSSA476)
A3PXY1 4.93e-57 189 39 4 300 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain JLS)
Q0SZ02 5.78e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Shigella flexneri serotype 5b (strain 8401)
B7M613 6.16e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O8 (strain IAI1)
A7ZU16 6.16e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q6GHI3 6.23e-57 188 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MRSA252)
Q3YVF5 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Shigella sonnei (strain Ss046)
Q31UH7 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 4 (strain Sb227)
B2TUW7 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LU45 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLY2 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SMS-3-5 / SECEC)
B6I4F2 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SE11)
B7NFB3 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8P6 6.5e-57 188 37 4 291 1 xerC Tyrosine recombinase XerC Escherichia coli (strain K12)
B1IW93 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8P7 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A6R9 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O9:H4 (strain HS)
B1XAH7 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / DH10B)
C4ZZ74 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / MC4100 / BW2952)
B7N2A1 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O81 (strain ED1a)
B7NTD1 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L968 6.5e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain 55989 / EAEC)
P67631 6.64e-57 188 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain N315)
P67630 6.64e-57 188 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X1M7 6.64e-57 188 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q1BAI5 6.66e-57 188 39 4 300 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain MCS)
A1UEH7 6.66e-57 188 39 4 300 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain KMS)
Q7MQB9 6.91e-57 189 38 5 288 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain YJ016)
Q7ZAI9 6.91e-57 189 38 5 288 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain CMCP6)
A5ISD6 7.01e-57 188 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH9)
A6U170 7.01e-57 188 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH1)
A0QVB4 7.03e-57 188 40 5 301 3 xerC Tyrosine recombinase XerC Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7ZAL9 7.24e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Shigella flexneri
Q329Y7 7.24e-57 188 37 4 291 3 xerC Tyrosine recombinase XerC Shigella dysenteriae serotype 1 (strain Sd197)
A8Z3T2 7.98e-57 188 36 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300 / TCH1516)
A6QGF2 7.98e-57 188 36 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Newman)
Q5HGI0 7.98e-57 188 36 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain COL)
Q2FZ30 7.98e-57 188 36 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHI6 7.98e-57 188 36 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300)
Q2YXL6 8.06e-57 188 36 4 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9ZDG8 8.77e-57 188 37 8 298 3 xerD Tyrosine recombinase XerD Rickettsia prowazekii (strain Madrid E)
B3E1H7 1.33e-56 188 39 6 303 3 xerC Tyrosine recombinase XerC Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q87KJ6 1.43e-56 187 39 5 290 3 xerC Tyrosine recombinase XerC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1D804 1.49e-56 187 38 5 297 3 xerC Tyrosine recombinase XerC Myxococcus xanthus (strain DK1622)
P59818 1.49e-56 187 38 5 297 3 xerC Tyrosine recombinase XerC Myxococcus xanthus
B7VMD2 1.73e-56 187 39 6 289 3 xerC Tyrosine recombinase XerC Vibrio atlanticus (strain LGP32)
Q8VS06 1.76e-56 187 39 4 291 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens
Q7ZAM8 1.82e-56 187 35 5 299 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RY9 1.82e-56 187 35 5 299 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q1R4C3 2.01e-56 187 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain UTI89 / UPEC)
A1AHX9 2.01e-56 187 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O1:K1 / APEC
B7MH75 2.01e-56 187 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O45:K1 (strain S88 / ExPEC)
Q48C04 2.95e-56 186 40 4 281 3 xerC Tyrosine recombinase XerC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B7GGC7 4.06e-56 186 36 3 292 3 xerC Tyrosine recombinase XerC Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B0UWL5 5.14e-56 186 37 4 293 3 xerC Tyrosine recombinase XerC Histophilus somni (strain 2336)
Q1RHT1 6.95e-56 186 38 7 298 3 xerD Tyrosine recombinase XerD Rickettsia bellii (strain RML369-C)
Q49X37 7.3e-56 185 37 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A7N0V8 8.21e-56 186 39 5 290 3 xerC Tyrosine recombinase XerC Vibrio campbellii (strain ATCC BAA-1116)
Q0TAR4 1.34e-55 185 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q02E82 1.46e-55 185 39 4 291 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V5H1 1.46e-55 185 39 4 291 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain LESB58)
A1AKP9 1.98e-55 184 39 4 283 3 xerC Tyrosine recombinase XerC Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A6VE54 2.03e-55 184 39 4 291 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain PA7)
Q500B4 2.59e-55 184 40 4 281 3 xerC Tyrosine recombinase XerC Pseudomonas syringae pv. syringae (strain B728a)
Q04A03 3.41e-55 184 37 6 296 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9V2 3.41e-55 184 37 6 296 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q8YJP2 3.53e-55 184 43 5 299 3 xerD Tyrosine recombinase XerD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q92C75 5.84e-55 183 36 5 296 3 xerC Tyrosine recombinase XerC Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O31207 6.3e-55 183 35 4 289 1 xerC Tyrosine recombinase XerC Proteus mirabilis
Q51566 6.77e-55 183 38 4 291 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8P550 6.87e-55 184 37 4 291 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RNK3 6.87e-55 184 37 4 291 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain B100)
Q4UYY0 6.87e-55 184 37 4 291 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain 8004)
A8FD78 7.15e-55 183 35 4 297 3 xerC Tyrosine recombinase XerC Bacillus pumilus (strain SAFR-032)
Q7ZAN6 7.25e-55 183 43 5 299 3 xerD Tyrosine recombinase XerD Brucella suis biovar 1 (strain 1330)
Q3K4R6 7.67e-55 183 39 5 290 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain Pf0-1)
Q48733 1.39e-54 182 37 6 296 3 xerC Tyrosine recombinase XerC Lactobacillus leichmannii
Q88B11 1.53e-54 182 39 5 283 3 xerC Tyrosine recombinase XerC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5L6G3 2.18e-54 182 32 3 305 3 xerC Tyrosine recombinase XerC Chlamydia abortus (strain DSM 27085 / S26/3)
A6VQS4 2.34e-54 181 38 5 289 3 xerC Tyrosine recombinase XerC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B8DG54 3.12e-54 181 36 5 296 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4a (strain HCC23)
B4SDZ2 4.28e-54 182 35 6 313 3 xerC Tyrosine recombinase XerC Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q8Z3A8 4.64e-54 181 37 4 288 3 xerC Tyrosine recombinase XerC Salmonella typhi
P0C122 4.8e-54 181 43 5 299 3 xerD Tyrosine recombinase XerD Brucella abortus biovar 1 (strain 9-941)
Q2YR40 4.8e-54 181 43 5 299 2 xerD Tyrosine recombinase XerD Brucella abortus (strain 2308)
Q8Y7K0 5.06e-54 181 36 5 296 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q720E4 5.23e-54 181 36 5 296 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain F2365)
C1L2I5 5.23e-54 181 36 5 296 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain CLIP80459)
P55888 5.45e-54 181 37 4 288 3 xerC Tyrosine recombinase XerC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KJF6 8.28e-54 180 36 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus aureus
B3GZ58 8.78e-54 180 35 5 295 3 xerC Tyrosine recombinase XerC Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q4L5V4 1.06e-53 180 36 3 292 3 xerC Tyrosine recombinase XerC Staphylococcus haemolyticus (strain JCSC1435)
A4TEB1 2.51e-53 179 38 3 299 3 xerC Tyrosine recombinase XerC Mycolicibacterium gilvum (strain PYR-GCK)
Q823T9 2.57e-53 179 32 3 305 3 xerC Tyrosine recombinase XerC Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B9DPG4 4.46e-53 178 36 3 298 3 xerC Tyrosine recombinase XerC Staphylococcus carnosus (strain TM300)
P9WF33 4.67e-53 179 38 6 300 1 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WF32 4.67e-53 179 38 6 300 3 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67637 4.67e-53 179 38 6 300 3 xerD Tyrosine recombinase XerD Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B1J1V8 5.69e-53 178 36 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain W619)
Q2NB52 6.46e-53 178 39 6 304 3 xerC Tyrosine recombinase XerC Erythrobacter litoralis (strain HTCC2594)
Q87DI2 8.13e-53 177 35 4 292 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA18 8.13e-53 177 35 4 292 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain M23)
A0AI80 8.61e-53 177 35 4 295 3 xerC Tyrosine recombinase XerC Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8PPP9 9.15e-53 177 36 5 300 3 xerC Tyrosine recombinase XerC Xanthomonas axonopodis pv. citri (strain 306)
Q9PD96 9.24e-53 177 35 4 292 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain 9a5c)
Q9Z9F7 1.02e-52 178 31 4 305 3 xerC Tyrosine recombinase XerC Chlamydia pneumoniae
Q2LT92 2.84e-52 176 34 4 306 3 xerC Tyrosine recombinase XerC Syntrophus aciditrophicus (strain SB)
Q8NNZ9 2.93e-52 176 38 6 294 3 xerC Tyrosine recombinase XerC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P9WF35 3.25e-52 176 38 4 298 1 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WF34 3.25e-52 176 38 4 298 3 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6P9 3.25e-52 176 38 4 298 3 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AG09 3.25e-52 176 38 4 298 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KMN8 3.25e-52 176 38 4 298 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67629 3.25e-52 176 38 4 298 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4K3W0 3.74e-52 176 38 3 281 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9PK47 4.48e-52 176 31 4 305 3 xerC Tyrosine recombinase XerC Chlamydia muridarum (strain MoPn / Nigg)
Q7ZAK0 8.56e-52 175 37 5 290 3 xerC Tyrosine recombinase XerC Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q253S9 9.13e-52 175 31 3 307 3 xerC Tyrosine recombinase XerC Chlamydia felis (strain Fe/C-56)
A1SQX0 1.36e-51 174 35 6 295 3 xerC Tyrosine recombinase XerC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
O31087 1.65e-51 174 35 4 292 3 xerC Tyrosine recombinase XerC Serratia marcescens
C3LPX0 1.92e-51 174 36 5 291 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain M66-2)
Q9KVL4 1.92e-51 174 36 5 291 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4I4 1.92e-51 174 36 5 291 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B3QM22 1.99e-51 175 34 6 316 3 xerC Tyrosine recombinase XerC Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q7VKG8 5.29e-51 173 36 6 292 3 xerC Tyrosine recombinase XerC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A4VGW3 8.43e-51 172 36 3 288 3 xerC Tyrosine recombinase XerC Stutzerimonas stutzeri (strain A1501)
Q1I301 1.03e-50 172 35 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas entomophila (strain L48)
A1SAP3 1.19e-50 172 36 6 290 3 xerC Tyrosine recombinase XerC Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7NVH1 1.39e-50 172 37 4 276 3 xerC Tyrosine recombinase XerC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9CBU0 2.28e-50 171 39 5 299 3 xerC Tyrosine recombinase XerC Mycobacterium leprae (strain TN)
B0KQ43 3.05e-50 171 36 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain GB-1)
O84872 3.16e-50 171 43 5 233 3 xerD Tyrosine recombinase XerD Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
O84351 3.38e-50 171 30 3 307 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BBY1 3.38e-50 171 30 3 307 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q3KM11 3.38e-50 171 30 3 307 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B7R6 3.38e-50 171 30 3 307 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q039E1 4.6e-50 171 34 4 291 3 xerC Tyrosine recombinase XerC Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEA7 4.6e-50 171 34 4 291 3 xerC Tyrosine recombinase XerC Lacticaseibacillus casei (strain BL23)
Q1QSU9 1.34e-49 169 36 6 295 3 xerC Tyrosine recombinase XerC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8RAB1 2.78e-49 168 31 4 296 3 TTE1313 Putative tyrosine recombinase TTE1313 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A5WAU7 3.61e-49 168 36 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q03FK2 4.43e-49 168 35 4 297 3 xerC Tyrosine recombinase XerC Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q9PL53 5.48e-49 168 36 6 297 3 xerD Tyrosine recombinase XerD Chlamydia muridarum (strain MoPn / Nigg)
Q88CF1 1.69e-48 166 36 4 292 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B7GQE1 2.08e-48 168 33 6 352 3 xerC Tyrosine recombinase XerC Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
B3DQV1 2.1e-48 168 33 6 352 3 xerC Tyrosine recombinase XerC Bifidobacterium longum (strain DJO10A)
Q9Z6N5 1.34e-47 164 36 8 300 3 xerD Tyrosine recombinase XerD Chlamydia pneumoniae
Q8KBZ5 2.45e-47 164 34 6 316 3 xerC Tyrosine recombinase XerC Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8Y3C8 3.58e-47 164 35 8 308 3 xerC1 Tyrosine recombinase XerC 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XTL6 4.35e-47 164 41 5 224 3 xerC2 Tyrosine recombinase XerC 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
C3K438 6.05e-47 162 37 3 281 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain SBW25)
Q0HQJ4 6.45e-47 162 34 5 281 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain MR-7)
Q0HN93 7.5e-47 162 34 5 281 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain MR-4)
A0KS67 7.5e-47 162 34 5 281 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain ANA-3)
A0LEB8 7.59e-47 163 36 7 301 3 xerC Tyrosine recombinase XerC Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2U7W2 8.91e-47 163 35 6 305 3 xerC Tyrosine recombinase XerC Ralstonia pickettii (strain 12J)
Q9JW14 3.74e-46 160 34 6 300 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1RPD0 7.62e-46 160 34 5 283 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain W3-18-1)
A4YBF5 7.62e-46 160 34 5 283 3 xerC Tyrosine recombinase XerC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1KS31 1.95e-45 159 34 6 300 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M1G2 2.1e-45 159 34 6 295 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C (strain 053442)
B4RNW5 2.19e-45 159 33 6 303 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain NCCP11945)
Q5FAI3 2.19e-45 159 33 6 303 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q49890 4.43e-45 158 35 8 306 3 xerD Tyrosine recombinase XerD Mycobacterium leprae (strain TN)
Q7ZAJ5 1.15e-44 157 34 4 281 3 xerC Tyrosine recombinase XerC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q92LK1 1.58e-44 157 34 6 314 3 xerC Tyrosine recombinase XerC Rhizobium meliloti (strain 1021)
A8F7B4 5.5e-44 154 32 7 279 3 Tlet_1492 Tyrosine recombinase Tlet_1492 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q73NE4 1.82e-43 154 32 4 290 3 xerC Tyrosine recombinase XerC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q9JXV6 1.94e-42 150 34 5 294 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8UC70 2.14e-42 151 34 6 306 3 xerC Tyrosine recombinase XerC Agrobacterium fabrum (strain C58 / ATCC 33970)
C4ZGY6 2.95e-42 150 30 9 315 3 EUBREC_2677 Tyrosine recombinase EUBREC_2677 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B7IFN3 2.56e-41 147 32 7 288 3 THA_404 Tyrosine recombinase THA_404 Thermosipho africanus (strain TCF52B)
O26979 5.09e-41 147 36 4 246 3 xerA Tyrosine recombinase XerA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O59490 3e-40 144 34 10 290 3 xerA Tyrosine recombinase XerA Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A8GXV3 1.91e-39 143 33 7 293 3 xerC Tyrosine recombinase XerC Rickettsia bellii (strain OSU 85-389)
Q1RK56 2.2e-39 143 33 7 293 3 xerC Tyrosine recombinase XerC Rickettsia bellii (strain RML369-C)
Q8YJD9 2.37e-39 143 34 8 304 3 xerC Tyrosine recombinase XerC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q5JHA3 5.15e-39 141 38 7 239 3 xerA Tyrosine recombinase XerA Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8RA66 5.16e-39 143 32 8 304 3 xerC Tyrosine recombinase XerC Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q68VT2 6.06e-39 142 33 10 293 3 xerC Tyrosine recombinase XerC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7ZAN7 6.26e-39 142 34 8 304 3 xerC Tyrosine recombinase XerC Brucella suis biovar 1 (strain 1330)
Q9ZCE0 1.86e-38 140 32 9 293 3 xerC Tyrosine recombinase XerC Rickettsia prowazekii (strain Madrid E)
Q9V1P5 2.96e-38 139 34 9 293 1 xerA Tyrosine recombinase XerA Pyrococcus abyssi (strain GE5 / Orsay)
A8F033 1.98e-37 138 31 9 292 3 xerC Tyrosine recombinase XerC Rickettsia canadensis (strain McKiel)
B6YWN8 2.79e-37 137 35 7 240 3 xerA Tyrosine recombinase XerA Thermococcus onnurineus (strain NA1)
Q89X68 1.42e-36 136 32 6 301 3 xerC Tyrosine recombinase XerC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8TZV9 1.79e-36 135 33 10 280 3 xerA Tyrosine recombinase XerA Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
C3PLU8 6.6e-36 134 31 8 292 3 xerC Tyrosine recombinase XerC Rickettsia africae (strain ESF-5)
C4K256 7.03e-36 134 31 8 292 3 xerC Tyrosine recombinase XerC Rickettsia peacockii (strain Rustic)
A8F2V6 7.03e-36 134 30 8 292 3 xerC Tyrosine recombinase XerC Rickettsia massiliae (strain Mtu5)
B6IPE2 8.38e-36 134 36 8 295 3 xerC Tyrosine recombinase XerC Rhodospirillum centenum (strain ATCC 51521 / SW)
A8GTV8 1e-35 133 31 8 292 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Sheila Smith)
B0BVE6 1e-35 133 31 8 292 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Iowa)
Q92G55 1.47e-35 133 31 8 292 3 xerC Tyrosine recombinase XerC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UJZ3 2.53e-35 132 30 8 292 3 xerC Tyrosine recombinase XerC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8GQ15 5.81e-35 131 30 8 292 3 xerC Tyrosine recombinase XerC Rickettsia akari (strain Hartford)
Q3SVJ8 3.49e-34 130 32 7 293 3 xerC Tyrosine recombinase XerC Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q98ED9 4.61e-34 129 34 6 308 3 xerC Tyrosine recombinase XerC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B8I9N8 5.79e-32 124 32 6 299 3 xerC Tyrosine recombinase XerC Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B0UNY7 2.02e-31 122 32 5 291 3 xerC Tyrosine recombinase XerC Methylobacterium sp. (strain 4-46)
P55632 1.38e-23 101 33 6 214 3 NGR_a01870 Putative integrase/recombinase y4qK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q980D9 1.51e-23 100 29 9 298 1 xerA Tyrosine recombinase XerA Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P55429 8.19e-23 97 34 7 221 3 NGR_a03870 Putative integrase/recombinase y4eF Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P62592 8.85e-21 94 31 7 271 3 int Integrase/recombinase Salmonella typhi
P62591 8.85e-21 94 31 7 271 3 int Integrase/recombinase Pseudomonas aeruginosa
P62590 8.85e-21 94 31 7 271 3 int Integrase/recombinase Escherichia coli
P55636 1.57e-20 93 28 8 290 3 NGR_a01840 Putative integrase/recombinase y4rC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O25386 9.95e-20 91 30 5 208 1 xerH Tyrosine recombinase XerH Helicobacter pylori (strain ATCC 700392 / 26695)
Q0PA27 5.13e-19 89 31 4 190 1 xerH Tyrosine recombinase XerH Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P55634 3.67e-17 84 32 7 224 3 NGR_a01860 Putative integrase/recombinase y4rA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55639 1.73e-14 76 27 10 290 3 NGR_a01810 Putative integrase/recombinase y4rF Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55459 2.64e-14 73 31 4 185 3 NGR_a03610 Putative integrase/recombinase y4gC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1JLL7 1.99e-13 73 31 3 160 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M12 (strain MGAS9429)
A2RED8 3.92e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M5 (strain Manfredo)
Q5XC26 4.07e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8P0Y8 5.35e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M18 (strain MGAS8232)
B5XLN3 5.71e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M49 (strain NZ131)
Q48TG2 5.77e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M28 (strain MGAS6180)
P10020 5.82e-13 71 24 10 273 3 tnpI TnP I resolvase Bacillus thuringiensis
P0DH45 5.88e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1J6H1 5.88e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JBN4 5.88e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DH44 5.88e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P67634 5.88e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M1
P0ADH5 6.1e-13 69 30 6 170 3 fimB Type 1 fimbriae regulatory protein FimB Escherichia coli (strain K12)
P0ADH6 6.1e-13 69 30 6 170 3 fimB Type 1 fimbriae regulatory protein FimB Escherichia coli O157:H7
Q1JGQ2 6.16e-13 72 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M2 (strain MGAS10270)
P0ADH9 1.31e-12 68 31 3 148 3 fimE Type 1 fimbriae regulatory protein FimE Shigella flexneri
P0ADH7 1.31e-12 68 31 3 148 3 fimE Type 1 fimbriae regulatory protein FimE Escherichia coli (strain K12)
P0ADH8 1.31e-12 68 31 3 148 3 fimE Type 1 fimbriae regulatory protein FimE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P37375 4.93e-12 69 25 6 254 3 tnpB Transposase B from transposon PsiTn554 Staphylococcus aureus
Q5LZT9 1.46e-11 67 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain CNRZ 1066)
Q5M4E9 1.5e-11 67 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
A2RKP9 2.18e-11 67 28 2 153 1 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. cremoris (strain MG1363)
Q02YZ4 2.4e-11 67 28 2 153 3 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. cremoris (strain SK11)
Q03KP9 2.97e-11 67 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
C0MFD9 5.53e-11 66 30 3 156 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. zooepidemicus (strain H70)
B4U2Z3 5.85e-11 65 30 3 156 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0MBC3 6.07e-11 65 30 3 156 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. equi (strain 4047)
B8ZQ39 6.66e-11 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C7D0 6.66e-11 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain 70585)
O69155 8.56e-11 65 29 2 155 3 xerS Tyrosine recombinase XerS Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A8AXA5 8.8e-11 65 28 3 160 3 xerS Tyrosine recombinase XerS Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
C1CRN6 9.21e-11 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain Taiwan19F-14)
C1CEC5 9.21e-11 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain JJA)
Q7ZAK7 9.21e-11 65 30 3 155 1 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IPW6 9.21e-11 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain CGSP14)
Q04KF1 9.21e-11 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CKQ9 9.3e-11 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain P1031)
P0A055 9.93e-11 65 24 6 254 3 tnpB Transposase B from transposon Tn554 Staphylococcus aureus
P0A054 9.93e-11 65 24 6 254 3 tnpB1 Transposase B from transposon Tn554 Staphylococcus aureus (strain N315)
P0A053 9.93e-11 65 24 6 254 3 tnpB1 Transposase B from transposon Tn554 Staphylococcus aureus (strain Mu50 / ATCC 700699)
B5E4Q4 1.01e-10 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 19F (strain G54)
Q97QP2 1.06e-10 65 30 3 155 1 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A3CN22 1.11e-10 65 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus sanguinis (strain SK36)
Q9CG78 1.19e-10 65 29 2 153 3 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. lactis (strain IL1403)
B9DUD2 1.23e-10 65 29 4 160 3 xerS Tyrosine recombinase XerS Streptococcus uberis (strain ATCC BAA-854 / 0140J)
P67633 5.06e-10 63 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67632 5.06e-10 63 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype III (strain NEM316)
Q3K1A9 5.06e-10 63 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B1IBW3 5.65e-10 63 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain Hungary19A-6)
Q8KUV2 7.85e-10 62 27 10 286 3 Synpcc7942_B2651 Tyrosine recombinase Synpcc7942_B2651 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A4VUQ8 6.06e-09 60 29 2 155 3 xerS Tyrosine recombinase XerS Streptococcus suis (strain 05ZYH33)
A4W104 6.06e-09 60 29 2 155 3 xerS Tyrosine recombinase XerS Streptococcus suis (strain 98HAH33)
Q8R890 7.53e-09 59 25 8 251 3 TTE2127 Tyrosine recombinase XerC-like Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P42540 1.08e-08 58 25 5 156 3 None Probable integrase/recombinase Acholeplasma phage L2
P62905 3.55e-08 57 25 9 251 3 int Transposase from transposon Tn1545 Streptococcus pneumoniae
P62904 3.55e-08 57 25 9 251 3 int Transposase from transposon Tn1545 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P22886 3.96e-08 57 25 9 251 1 Int-Tn Transposase from transposon Tn916 Enterococcus faecalis
P06723 4.1e-08 57 28 7 177 3 int Integrase Escherichia phage 186
P55638 4.58e-08 57 28 11 269 3 NGR_a01820 Putative integrase/recombinase y4rE Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q57813 4.68e-08 57 26 6 165 3 MJ0367 Probable integrase/recombinase protein MJ0367 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P0A052 6.94e-08 56 28 5 171 3 tnpA Transposase A from transposon Tn554 Staphylococcus aureus
P0A051 6.94e-08 56 28 5 171 3 tnpA1 Transposase A from transposon Tn554 Staphylococcus aureus (strain N315)
P0A050 6.94e-08 56 28 5 171 3 tnpA1 Transposase A from transposon Tn554 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P55637 1.72e-07 55 23 9 265 3 NGR_a01830 Putative integrase/recombinase y4rD Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9PQS0 2.11e-07 54 26 7 188 3 xerC Tyrosine recombinase UU222 Ureaplasma parvum serovar 3 (strain ATCC 700970)
P18021 2.91e-06 51 26 8 201 3 resD Resolvase Escherichia coli
P06615 3.6e-06 51 26 8 201 3 resD Resolvase Escherichia coli (strain K12)
P36932 4.91e-06 50 24 7 243 1 int Integrase Escherichia phage P2
P20709 2.38e-05 48 20 8 291 3 int Integrase Staphylococcus phage L54a
Q38067 3.33e-05 48 38 0 54 3 None Putative integrase Pseudomonas phage Pf1
P72680 3.64e-05 48 26 3 148 3 xerC Tyrosine recombinase slr0733 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A3CPQ8 5.08e-05 47 23 9 263 3 SSA_1780 Tyrosine recombinase XerD-like Streptococcus sanguinis (strain SK36)
Q8KRZ2 7e-05 47 23 4 149 3 xerC Putative tyrosine recombinase XerC Pseudomonas syringae
P21442 0.000103 47 41 0 46 1 int Integrase Haemophilus phage HP1 (strain HP1c1)
Q9F771 0.000518 45 24 4 162 3 xerC Putative tyrosine recombinase XerC Pseudomonas aeruginosa

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS08540
Feature type CDS
Gene xerD
Product site-specific tyrosine recombinase XerD
Location 1763791 - 1764705 (strand: -1)
Length 915 (nucleotides) / 304 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_817
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00589 Phage integrase family
PF02899 Phage integrase, N-terminal SAM-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4974 Replication, recombination and repair (L) L Site-specific recombinase XerD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04763 integrase/recombinase XerD - -

Protein Sequence

MNDAGQHRESDALTELFLDTIWLEQNLSENTLAAYRLDLQALADWLAPQNLDWLSLTTMDLQAFLAVRMDGGYKATSSARLLSSLRRFFQYCYREKLRPDDPTIQLAAPKLPARLPKDLSESQVDDLLSAPNLSDPIELRDKAMLEVLYACGLRVTELVSLSLPDISLRQGVIRVIGKGNKERLVPMGEEAVYWVEVYLAQARPALLNGQTQDVLFPSKLGRQMTRQTFWHRIKRYAVVAGIATEKLSPHVLRHAFATHLLNHGADLRVVQMLLGHSDLSTTQIYTHVATERLRTLHQQHHPRG

Flanking regions ( +/- flanking 50bp)

ACAGAAGATAAGTGAGTTCTGACACGGGTAATTCAAACGGGAGGGCGGTCGTGAACGACGCCGGACAACACAGAGAAAGTGATGCACTGACAGAGTTGTTTCTTGATACTATCTGGCTCGAACAGAATTTATCAGAAAATACTCTGGCAGCTTACCGCCTGGATCTTCAGGCACTGGCGGACTGGCTTGCGCCACAAAATCTGGACTGGTTATCGCTGACCACAATGGATTTACAGGCATTTCTCGCCGTCCGGATGGACGGCGGCTATAAAGCAACCAGTTCTGCCCGGCTGCTGAGTTCCCTGCGACGCTTTTTCCAGTACTGCTACCGGGAAAAGCTGCGCCCGGATGACCCGACCATTCAGCTTGCTGCCCCGAAATTACCGGCGCGGTTGCCGAAAGATTTAAGTGAAAGCCAGGTGGATGACCTGCTCAGCGCACCGAATCTGTCTGATCCGATTGAACTGCGTGATAAAGCGATGCTGGAAGTATTGTATGCATGCGGTTTGCGTGTCACGGAGCTGGTATCGCTTTCGCTGCCGGATATCAGCCTGCGTCAGGGCGTTATCCGCGTTATCGGTAAAGGCAATAAAGAACGGTTGGTGCCGATGGGTGAAGAAGCTGTTTACTGGGTCGAGGTGTATCTGGCACAGGCGCGTCCGGCGTTATTAAACGGACAGACGCAGGACGTGCTTTTCCCGAGTAAACTCGGGCGGCAGATGACCCGCCAGACATTCTGGCACCGGATCAAACGCTATGCGGTTGTCGCGGGGATCGCGACTGAAAAATTATCTCCCCATGTTCTGCGCCATGCATTTGCCACACATCTGCTTAATCACGGCGCAGATTTGCGCGTGGTACAGATGTTGCTGGGACACAGTGATTTATCCACCACACAAATTTATACTCATGTGGCAACCGAACGGTTACGCACACTGCATCAACAGCACCACCCGCGGGGCTGATAAGGAATAACGGAACAGTATTATGATGAAAAAATTATTATCCGTGCTGG