Homologs in group_885

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_05390 EHELCC_05390 100.0 Morganella morganii S2 xerD site-specific tyrosine recombinase XerD
NLDBIP_05710 NLDBIP_05710 100.0 Morganella morganii S4 xerD site-specific tyrosine recombinase XerD
LHKJJB_02590 LHKJJB_02590 100.0 Morganella morganii S3 xerD site-specific tyrosine recombinase XerD
HKOGLL_06065 HKOGLL_06065 100.0 Morganella morganii S5 xerD site-specific tyrosine recombinase XerD
F4V73_RS08540 F4V73_RS08540 92.4 Morganella psychrotolerans xerD site-specific tyrosine recombinase XerD
PMI_RS09920 PMI_RS09920 75.6 Proteus mirabilis HI4320 xerD site-specific tyrosine recombinase XerD

Distribution of the homologs in the orthogroup group_885

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_885

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O31206 2.87e-173 484 76 0 296 1 xerD Tyrosine recombinase XerD Proteus mirabilis
Q8ZHK1 3e-162 456 74 0 296 3 xerD Tyrosine recombinase XerD Yersinia pestis
P0A8P8 1.59e-158 447 74 0 293 1 xerD Tyrosine recombinase XerD Escherichia coli (strain K12)
P0A8P9 1.59e-158 447 74 0 293 3 xerD Tyrosine recombinase XerD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7ZAM0 1.6e-158 447 74 0 293 3 xerD Tyrosine recombinase XerD Shigella flexneri
Q8X574 2.4e-157 444 73 0 293 3 xerD Tyrosine recombinase XerD Escherichia coli O157:H7
P0A2P6 1.84e-156 441 73 0 293 1 xerD Tyrosine recombinase XerD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P7 1.84e-156 441 73 0 293 3 xerD Tyrosine recombinase XerD Salmonella typhi
Q9CPF0 6.99e-150 425 66 0 296 3 xerD Tyrosine recombinase XerD Pasteurella multocida (strain Pm70)
P44630 1.41e-149 424 67 0 293 3 xerD Tyrosine recombinase XerD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KPE9 4.11e-145 413 67 3 300 3 xerD Tyrosine recombinase XerD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MNQ0 8.12e-144 410 67 2 293 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain YJ016)
Q7ZAJ0 8.12e-144 410 67 2 293 3 xerD Tyrosine recombinase XerD Vibrio vulnificus (strain CMCP6)
Q7VPN8 4.03e-141 402 65 1 294 3 xerD Tyrosine recombinase XerD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9HXQ6 3.86e-127 367 63 1 292 3 xerD Tyrosine recombinase XerD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88MV0 9.57e-127 366 65 1 292 3 xerD Tyrosine recombinase XerD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7ZAJ8 9.64e-123 356 61 1 296 3 xerD Tyrosine recombinase XerD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8PCQ9 4.21e-104 310 53 3 306 3 xerD Tyrosine recombinase XerD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8XWD0 1.46e-102 305 55 4 298 3 xerD Tyrosine recombinase XerD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9PDF4 7.6e-101 301 52 3 302 3 xerD Tyrosine recombinase XerD Xylella fastidiosa (strain 9a5c)
Q8PGR5 4.82e-99 296 52 2 301 3 xerD Tyrosine recombinase XerD Xanthomonas axonopodis pv. citri (strain 306)
Q87DN0 3.56e-97 292 52 2 294 3 xerD Tyrosine recombinase XerD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P46352 7.32e-87 265 45 2 290 3 xerD Tyrosine recombinase XerD Bacillus subtilis (strain 168)
Q4L6J7 2.13e-85 261 43 3 297 3 xerD Tyrosine recombinase XerD Staphylococcus haemolyticus (strain JCSC1435)
Q5HP53 6.4e-85 259 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7ZAJ2 1.15e-84 259 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9K068 4.96e-84 257 46 3 295 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JV76 8.63e-84 257 45 3 295 3 xerD Tyrosine recombinase XerD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P0A0P1 3.46e-83 255 43 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MW2)
P0A0P2 3.46e-83 255 43 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus
Q6G967 3.46e-83 255 43 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MSSA476)
Q6GGK1 3.46e-83 255 43 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain MRSA252)
P0A0P0 3.46e-83 255 43 2 295 1 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain N315)
P0A0N9 3.46e-83 255 43 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFS5 3.46e-83 255 43 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus aureus (strain COL)
Q7ZAM3 7.23e-83 254 43 4 293 3 xerD Tyrosine recombinase XerD Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q49XU5 1.23e-82 254 42 2 295 3 xerD Tyrosine recombinase XerD Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q71Y59 1.13e-80 249 46 3 294 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serotype 4b (strain F2365)
Q9KCP0 1.67e-80 249 43 2 292 3 xerD Tyrosine recombinase XerD Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8Y5V0 1.23e-79 246 45 3 294 3 xerD Tyrosine recombinase XerD Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92A53 1.39e-78 244 45 3 295 3 xerD Tyrosine recombinase XerD Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q93C64 1.29e-75 236 42 2 293 3 xerD Tyrosine recombinase XerD Lacticaseibacillus casei
Q7ZAM7 6.73e-73 229 37 1 297 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SA5 6.73e-73 229 37 1 297 3 xerD Tyrosine recombinase XerD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8KET0 1.94e-72 228 41 2 293 3 xerD Tyrosine recombinase XerD Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q92ME3 1.57e-69 221 45 6 304 3 xerD Tyrosine recombinase XerD Rhizobium meliloti (strain 1021)
Q98FX8 1.6e-67 216 44 5 305 3 xerD Tyrosine recombinase XerD Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A7NFG3 3.99e-67 215 41 4 294 3 xerC Tyrosine recombinase XerC Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q97HE5 4.48e-67 214 38 5 295 3 CA_C2066 Putative tyrosine recombinase CA_C2066 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q89XW5 2.2e-66 213 44 7 310 3 xerD Tyrosine recombinase XerD Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A9B1E0 4.65e-66 212 44 3 280 3 xerC Tyrosine recombinase XerC Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A5D2W6 6.64e-66 211 41 5 306 3 xerC Tyrosine recombinase XerC Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q0VM16 2.37e-65 210 42 4 289 3 xerC Tyrosine recombinase XerC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q9KA25 3.39e-65 209 39 4 301 3 xerC Tyrosine recombinase XerC Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A5URM3 5.7e-65 209 40 4 278 3 xerC Tyrosine recombinase XerC Roseiflexus sp. (strain RS-1)
B2A335 7.71e-65 209 41 5 295 3 xerC Tyrosine recombinase XerC Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q8U9U6 4.23e-64 207 43 7 309 3 xerD Tyrosine recombinase XerD Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7ZAN4 4.28e-64 207 41 6 301 3 xerD Tyrosine recombinase XerD Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q7ZAP1 1.31e-63 206 40 4 300 3 xerD Tyrosine recombinase XerD Bifidobacterium longum (strain NCC 2705)
P39776 5.71e-63 204 37 3 291 1 xerC Tyrosine recombinase XerC Bacillus subtilis (strain 168)
Q7ZAM5 2.72e-62 202 39 4 293 3 xerC Tyrosine recombinase XerC Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A5UE41 2.61e-60 197 38 4 291 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain PittEE)
Q9CKC2 5.55e-60 196 39 5 292 3 xerC Tyrosine recombinase XerC Pasteurella multocida (strain Pm70)
Q9A437 1.25e-59 195 40 5 302 3 xerD Tyrosine recombinase XerD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q4UM01 1.26e-59 195 39 7 306 3 xerD Tyrosine recombinase XerD Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P44818 1.7e-59 195 38 4 291 1 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8NQL5 2.09e-59 195 38 6 301 3 xerD Tyrosine recombinase XerD Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1D804 3.12e-59 194 40 5 296 3 xerC Tyrosine recombinase XerC Myxococcus xanthus (strain DK1622)
P59818 3.12e-59 194 40 5 296 3 xerC Tyrosine recombinase XerC Myxococcus xanthus
Q4QMP0 3.86e-59 194 37 4 291 3 xerC Tyrosine recombinase XerC Haemophilus influenzae (strain 86-028NP)
Q92IC9 4.26e-59 194 39 6 295 3 xerD Tyrosine recombinase XerD Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B7UNC8 1.08e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5YY58 1.31e-58 192 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X4T6 1.31e-58 192 37 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O157:H7
Q1RHT1 1.45e-58 192 39 7 299 3 xerD Tyrosine recombinase XerD Rickettsia bellii (strain RML369-C)
Q0SZ02 1.6e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Shigella flexneri serotype 5b (strain 8401)
B7M613 1.78e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O8 (strain IAI1)
A7ZU16 1.78e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YVF5 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Shigella sonnei (strain Ss046)
Q31UH7 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 4 (strain Sb227)
B2TUW7 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LU45 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LLY2 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SMS-3-5 / SECEC)
B6I4F2 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain SE11)
B7NFB3 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8P6 1.94e-58 192 38 4 291 1 xerC Tyrosine recombinase XerC Escherichia coli (strain K12)
B1IW93 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8P7 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A6R9 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O9:H4 (strain HS)
B1XAH7 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / DH10B)
C4ZZ74 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain K12 / MC4100 / BW2952)
B7N2A1 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O81 (strain ED1a)
B7NTD1 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L968 1.94e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain 55989 / EAEC)
Q7ZAL9 1.99e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Shigella flexneri
Q329Y7 1.99e-58 192 38 4 291 3 xerC Tyrosine recombinase XerC Shigella dysenteriae serotype 1 (strain Sd197)
Q1R4C3 6.29e-58 191 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli (strain UTI89 / UPEC)
A1AHX9 6.29e-58 191 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O1:K1 / APEC
B7MH75 6.29e-58 191 38 4 291 3 xerC Tyrosine recombinase XerC Escherichia coli O45:K1 (strain S88 / ExPEC)
B5YFZ8 6.35e-58 191 37 4 292 3 xerC Tyrosine recombinase XerC Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A0QVB4 7.74e-58 191 39 5 302 3 xerC Tyrosine recombinase XerC Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7ZAM8 1.28e-57 190 35 6 303 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RY9 1.28e-57 190 35 6 303 3 xerC Tyrosine recombinase XerC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q65JN5 1.36e-57 190 37 3 290 3 xerC Tyrosine recombinase XerC Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9ZDG8 1.41e-57 190 38 8 300 3 xerD Tyrosine recombinase XerD Rickettsia prowazekii (strain Madrid E)
Q7MQB9 1.73e-57 190 38 5 290 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain YJ016)
Q7ZAI9 1.73e-57 190 38 5 290 3 xerC Tyrosine recombinase XerC Vibrio vulnificus (strain CMCP6)
Q0TAR4 2.78e-57 189 38 5 293 3 xerC Tyrosine recombinase XerC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7GGC7 2.79e-57 189 36 3 291 3 xerC Tyrosine recombinase XerC Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q7ZAJ4 3.33e-57 189 36 2 294 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPU0 3.33e-57 189 36 2 294 3 xerC Tyrosine recombinase XerC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B3E1H7 3.65e-57 189 40 7 304 3 xerC Tyrosine recombinase XerC Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q87KJ6 6.88e-57 188 38 4 290 3 xerC Tyrosine recombinase XerC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B0UWL5 7.33e-57 188 36 4 293 3 xerC Tyrosine recombinase XerC Histophilus somni (strain 2336)
Q65V80 1.26e-56 187 37 4 291 3 xerC Tyrosine recombinase XerC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A3PXY1 1.74e-56 187 39 4 300 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain JLS)
Q8YJP2 1.88e-56 187 44 5 299 3 xerD Tyrosine recombinase XerD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q04A03 1.97e-56 187 38 6 296 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9V2 1.97e-56 187 38 6 296 3 xerC Tyrosine recombinase XerC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q48C04 2.28e-56 187 40 5 294 3 xerC Tyrosine recombinase XerC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1BAI5 2.37e-56 187 39 4 300 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain MCS)
A1UEH7 2.37e-56 187 39 4 300 3 xerC Tyrosine recombinase XerC Mycobacterium sp. (strain KMS)
C1DJ58 2.46e-56 187 39 4 293 3 xerC Tyrosine recombinase XerC Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q8NWZ8 3.09e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MW2)
Q6G9W1 3.09e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MSSA476)
Q7ZAN6 3.15e-56 187 44 5 299 3 xerD Tyrosine recombinase XerD Brucella suis biovar 1 (strain 1330)
Q8D1K0 3.6e-56 186 37 5 291 3 xerC Tyrosine recombinase XerC Yersinia pestis
P67631 3.84e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain N315)
P67630 3.84e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X1M7 3.84e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Mu3 / ATCC 700698)
A1AKP9 4.07e-56 186 39 4 283 3 xerC Tyrosine recombinase XerC Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A5ISD6 4.56e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH9)
A6U170 4.56e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain JH1)
Q6GHI3 4.61e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain MRSA252)
Q2YXL6 5.08e-56 186 36 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q49X37 5.58e-56 186 36 2 294 3 xerC Tyrosine recombinase XerC Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A7N0V8 5.76e-56 186 38 4 290 3 xerC Tyrosine recombinase XerC Vibrio campbellii (strain ATCC BAA-1116)
B7VMD2 5.91e-56 186 39 6 290 3 xerC Tyrosine recombinase XerC Vibrio atlanticus (strain LGP32)
A8Z3T2 6.43e-56 186 35 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300 / TCH1516)
A6QGF2 6.43e-56 186 35 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain Newman)
Q5HGI0 6.43e-56 186 35 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain COL)
Q2FZ30 6.43e-56 186 35 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHI6 6.43e-56 186 35 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus (strain USA300)
Q720E4 9.39e-56 185 37 5 296 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain F2365)
C1L2I5 9.39e-56 185 37 5 296 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4b (strain CLIP80459)
Q48733 1.06e-55 185 38 6 296 3 xerC Tyrosine recombinase XerC Lactobacillus leichmannii
Q8Y7K0 1.18e-55 185 37 5 296 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A8FD78 1.25e-55 185 35 3 292 3 xerC Tyrosine recombinase XerC Bacillus pumilus (strain SAFR-032)
O31207 1.3e-55 185 35 4 291 1 xerC Tyrosine recombinase XerC Proteus mirabilis
Q8P550 1.4e-55 186 38 5 292 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RNK3 1.4e-55 186 38 5 292 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain B100)
Q4UYY0 1.4e-55 186 38 5 292 3 xerC Tyrosine recombinase XerC Xanthomonas campestris pv. campestris (strain 8004)
Q92C75 1.44e-55 185 36 5 301 3 xerC Tyrosine recombinase XerC Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DG54 1.56e-55 184 36 5 301 3 xerC Tyrosine recombinase XerC Listeria monocytogenes serotype 4a (strain HCC23)
P0C122 1.74e-55 185 44 5 299 3 xerD Tyrosine recombinase XerD Brucella abortus biovar 1 (strain 9-941)
Q2YR40 1.74e-55 185 44 5 299 2 xerD Tyrosine recombinase XerD Brucella abortus (strain 2308)
Q8VS06 2.07e-55 184 38 3 288 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens
Q500B4 4.58e-55 183 40 5 294 3 xerC Tyrosine recombinase XerC Pseudomonas syringae pv. syringae (strain B728a)
B3GZ58 5.68e-55 183 36 5 294 3 xerC Tyrosine recombinase XerC Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q8PPP9 6.63e-55 183 37 6 304 3 xerC Tyrosine recombinase XerC Xanthomonas axonopodis pv. citri (strain 306)
Q2LT92 8.57e-55 183 34 4 306 3 xerC Tyrosine recombinase XerC Syntrophus aciditrophicus (strain SB)
A4TEB1 1.25e-54 182 40 4 300 3 xerC Tyrosine recombinase XerC Mycolicibacterium gilvum (strain PYR-GCK)
Q2NB52 1.43e-54 182 40 6 305 3 xerC Tyrosine recombinase XerC Erythrobacter litoralis (strain HTCC2594)
Q88B11 1.63e-54 182 39 6 296 3 xerC Tyrosine recombinase XerC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8Z3A8 1.71e-54 182 37 5 294 3 xerC Tyrosine recombinase XerC Salmonella typhi
Q9PD96 2.06e-54 181 37 4 292 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain 9a5c)
P55888 2.14e-54 182 37 5 294 3 xerC Tyrosine recombinase XerC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WF33 2.24e-54 182 39 7 302 1 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WF32 2.24e-54 182 39 7 302 3 xerD Tyrosine recombinase XerD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67637 2.24e-54 182 39 7 302 3 xerD Tyrosine recombinase XerD Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5L6G3 2.62e-54 182 32 4 306 3 xerC Tyrosine recombinase XerC Chlamydia abortus (strain DSM 27085 / S26/3)
A6VQS4 2.63e-54 181 37 6 295 3 xerC Tyrosine recombinase XerC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q02E82 2.98e-54 181 38 4 293 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V5H1 2.98e-54 181 38 4 293 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain LESB58)
A6VE54 3.86e-54 181 38 4 293 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain PA7)
Q87DI2 4.02e-54 181 36 4 292 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA18 4.02e-54 181 36 4 292 3 xerC Tyrosine recombinase XerC Xylella fastidiosa (strain M23)
A0AI80 4.69e-54 181 35 5 301 3 xerC Tyrosine recombinase XerC Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q51566 7.58e-54 180 38 4 293 3 xerC Tyrosine recombinase XerC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9Z9F7 7.74e-54 181 31 4 305 3 xerC Tyrosine recombinase XerC Chlamydia pneumoniae
Q4L5V4 1.25e-53 179 35 2 288 3 xerC Tyrosine recombinase XerC Staphylococcus haemolyticus (strain JCSC1435)
Q823T9 1.35e-53 180 31 3 305 3 xerC Tyrosine recombinase XerC Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B4SDZ2 2.27e-53 180 34 7 313 3 xerC Tyrosine recombinase XerC Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q7ZAK0 2.31e-53 179 38 6 305 3 xerC Tyrosine recombinase XerC Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q3K4R6 2.36e-53 179 38 4 290 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain Pf0-1)
C3LPX0 2.85e-53 179 37 4 291 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain M66-2)
Q9KVL4 2.85e-53 179 37 4 291 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4I4 2.85e-53 179 37 4 291 3 xerC Tyrosine recombinase XerC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B9DPG4 2.97e-53 179 35 2 294 3 xerC Tyrosine recombinase XerC Staphylococcus carnosus (strain TM300)
B3QM22 7.38e-53 179 34 6 316 3 xerC Tyrosine recombinase XerC Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
O31087 9.97e-53 177 38 6 293 3 xerC Tyrosine recombinase XerC Serratia marcescens
P9WF35 1.03e-52 177 38 3 297 1 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WF34 1.03e-52 177 38 3 297 3 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6P9 1.03e-52 177 38 3 297 3 xerC Tyrosine recombinase XerC Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AG09 1.03e-52 177 38 3 297 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KMN8 1.03e-52 177 38 3 297 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67629 1.03e-52 177 38 3 297 3 xerC Tyrosine recombinase XerC Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9KJF6 1.12e-52 177 35 3 295 3 xerC Tyrosine recombinase XerC Staphylococcus aureus
Q8NNZ9 3.13e-52 176 39 6 292 3 xerC Tyrosine recombinase XerC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q4K3W0 3.86e-52 176 39 3 281 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7VKG8 3.87e-52 176 37 6 292 3 xerC Tyrosine recombinase XerC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1SQX0 6.79e-52 175 35 6 295 3 xerC Tyrosine recombinase XerC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q9CBU0 1.74e-51 174 40 5 299 3 xerC Tyrosine recombinase XerC Mycobacterium leprae (strain TN)
Q253S9 3.79e-51 174 37 3 227 3 xerC Tyrosine recombinase XerC Chlamydia felis (strain Fe/C-56)
Q039E1 5.7e-51 173 35 3 291 3 xerC Tyrosine recombinase XerC Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEA7 5.7e-51 173 35 3 291 3 xerC Tyrosine recombinase XerC Lacticaseibacillus casei (strain BL23)
B1J1V8 7.33e-51 172 35 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain W619)
Q8RAB1 8.63e-51 172 32 5 296 3 TTE1313 Putative tyrosine recombinase TTE1313 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A1SAP3 1.09e-50 172 37 7 293 3 xerC Tyrosine recombinase XerC Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7NVH1 2.41e-50 171 37 3 276 3 xerC Tyrosine recombinase XerC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9PK47 7.78e-50 170 30 4 305 3 xerC Tyrosine recombinase XerC Chlamydia muridarum (strain MoPn / Nigg)
B3DQV1 8.92e-50 171 34 7 354 3 xerC Tyrosine recombinase XerC Bifidobacterium longum (strain DJO10A)
A4VGW3 1.35e-49 169 36 3 288 3 xerC Tyrosine recombinase XerC Stutzerimonas stutzeri (strain A1501)
Q9Z6N5 2.59e-49 169 37 8 301 3 xerD Tyrosine recombinase XerD Chlamydia pneumoniae
Q1QSU9 2.61e-49 169 37 6 295 3 xerC Tyrosine recombinase XerC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1I301 2.95e-49 168 35 4 293 3 xerC Tyrosine recombinase XerC Pseudomonas entomophila (strain L48)
B0KQ43 1.04e-48 167 35 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain GB-1)
O84351 1.69e-48 167 30 4 308 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BBY1 1.69e-48 167 30 4 308 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q3KM11 1.69e-48 167 30 4 308 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B7R6 1.69e-48 167 30 4 308 3 xerC Tyrosine recombinase XerC Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q0HN93 1.78e-48 166 35 5 290 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain MR-4)
A0KS67 1.78e-48 166 35 5 290 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain ANA-3)
Q9JW14 2e-48 166 36 7 295 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0HQJ4 2.05e-48 166 35 5 290 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain MR-7)
A1RPD0 2.34e-48 166 37 5 281 3 xerC Tyrosine recombinase XerC Shewanella sp. (strain W3-18-1)
A4YBF5 2.34e-48 166 37 5 281 3 xerC Tyrosine recombinase XerC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B4RNW5 2.72e-48 166 36 7 303 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain NCCP11945)
Q5FAI3 2.72e-48 166 36 7 303 3 xerC Tyrosine recombinase XerC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KS31 2.81e-48 166 37 7 300 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
O84872 3.95e-48 166 36 6 296 3 xerD Tyrosine recombinase XerD Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B7GQE1 5.84e-48 167 33 8 354 3 xerC Tyrosine recombinase XerC Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8XTL6 6.99e-48 166 43 5 224 3 xerC2 Tyrosine recombinase XerC 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q03FK2 8.2e-48 165 35 4 293 3 xerC Tyrosine recombinase XerC Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A9M1G2 8.82e-48 165 37 7 293 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup C (strain 053442)
A5WAU7 9.53e-48 164 35 3 290 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q49890 3.37e-47 164 36 7 308 3 xerD Tyrosine recombinase XerD Mycobacterium leprae (strain TN)
Q9PL53 3.9e-47 163 36 6 297 3 xerD Tyrosine recombinase XerD Chlamydia muridarum (strain MoPn / Nigg)
Q88CF1 5.56e-47 162 35 4 292 3 xerC Tyrosine recombinase XerC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8Y3C8 5.84e-47 163 36 7 307 3 xerC1 Tyrosine recombinase XerC 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2U7W2 7.59e-47 163 35 6 306 3 xerC Tyrosine recombinase XerC Ralstonia pickettii (strain 12J)
Q7ZAJ5 1.96e-46 161 35 4 290 3 xerC Tyrosine recombinase XerC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0LEB8 4.4e-46 161 35 7 306 3 xerC Tyrosine recombinase XerC Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
C3K438 8.36e-46 159 37 3 281 3 xerC Tyrosine recombinase XerC Pseudomonas fluorescens (strain SBW25)
Q8KBZ5 1.12e-45 160 33 8 317 3 xerC Tyrosine recombinase XerC Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A8F7B4 6.44e-45 157 33 6 284 3 Tlet_1492 Tyrosine recombinase Tlet_1492 Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q73NE4 7.01e-45 157 34 4 290 3 xerC Tyrosine recombinase XerC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q9JXV6 1.32e-44 156 36 6 294 3 xerC Tyrosine recombinase XerC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
O26979 2.48e-43 153 35 7 297 3 xerA Tyrosine recombinase XerA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q92LK1 2.81e-42 151 33 5 309 3 xerC Tyrosine recombinase XerC Rhizobium meliloti (strain 1021)
Q8UC70 3.1e-42 150 34 9 316 3 xerC Tyrosine recombinase XerC Agrobacterium fabrum (strain C58 / ATCC 33970)
O59490 2.99e-41 147 34 10 298 3 xerA Tyrosine recombinase XerA Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
C4ZGY6 1.85e-40 145 30 8 299 3 EUBREC_2677 Tyrosine recombinase EUBREC_2677 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B7IFN3 7.41e-40 144 32 10 289 3 THA_404 Tyrosine recombinase THA_404 Thermosipho africanus (strain TCF52B)
Q68VT2 8.41e-39 141 32 9 303 3 xerC Tyrosine recombinase XerC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8RA66 9.29e-39 142 33 9 304 3 xerC Tyrosine recombinase XerC Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9V1P5 1.52e-38 140 35 9 288 1 xerA Tyrosine recombinase XerA Pyrococcus abyssi (strain GE5 / Orsay)
Q8YJD9 1.6e-38 141 33 8 304 3 xerC Tyrosine recombinase XerC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q5JHA3 1.67e-38 140 35 10 295 3 xerA Tyrosine recombinase XerA Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9ZCE0 1.84e-38 140 30 9 309 3 xerC Tyrosine recombinase XerC Rickettsia prowazekii (strain Madrid E)
Q7ZAN7 3.49e-38 140 33 8 304 3 xerC Tyrosine recombinase XerC Brucella suis biovar 1 (strain 1330)
Q8TZV9 5.71e-38 139 33 10 298 3 xerA Tyrosine recombinase XerA Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A8GXV3 2.13e-37 137 31 6 290 3 xerC Tyrosine recombinase XerC Rickettsia bellii (strain OSU 85-389)
B6IPE2 2.16e-37 139 36 8 295 3 xerC Tyrosine recombinase XerC Rhodospirillum centenum (strain ATCC 51521 / SW)
Q1RK56 2.44e-37 137 31 6 290 3 xerC Tyrosine recombinase XerC Rickettsia bellii (strain RML369-C)
B6YWN8 5.32e-37 136 35 7 240 3 xerA Tyrosine recombinase XerA Thermococcus onnurineus (strain NA1)
A8F033 1.43e-36 135 30 11 301 3 xerC Tyrosine recombinase XerC Rickettsia canadensis (strain McKiel)
C4K256 2.03e-36 135 30 10 310 3 xerC Tyrosine recombinase XerC Rickettsia peacockii (strain Rustic)
A8F2V6 7.56e-36 134 29 10 310 3 xerC Tyrosine recombinase XerC Rickettsia massiliae (strain Mtu5)
C3PLU8 1.02e-35 133 29 10 310 3 xerC Tyrosine recombinase XerC Rickettsia africae (strain ESF-5)
A8GTV8 1.42e-35 133 29 10 310 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Sheila Smith)
B0BVE6 1.42e-35 133 29 10 310 3 xerC Tyrosine recombinase XerC Rickettsia rickettsii (strain Iowa)
Q92G55 1.97e-35 132 29 10 310 3 xerC Tyrosine recombinase XerC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UJZ3 4.56e-35 132 29 11 307 3 xerC Tyrosine recombinase XerC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8GQ15 4.56e-35 132 30 11 313 3 xerC Tyrosine recombinase XerC Rickettsia akari (strain Hartford)
Q89X68 5.13e-34 129 32 7 305 3 xerC Tyrosine recombinase XerC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q98ED9 1.55e-33 127 33 6 308 3 xerC Tyrosine recombinase XerC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B8I9N8 5.73e-33 126 32 6 299 3 xerC Tyrosine recombinase XerC Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B0UNY7 5.79e-33 126 34 6 291 3 xerC Tyrosine recombinase XerC Methylobacterium sp. (strain 4-46)
Q3SVJ8 2.6e-32 125 31 6 301 3 xerC Tyrosine recombinase XerC Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P55632 6.19e-24 102 32 9 273 3 NGR_a01870 Putative integrase/recombinase y4qK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q980D9 1.39e-23 100 30 6 260 1 xerA Tyrosine recombinase XerA Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P62592 3.87e-22 97 32 7 271 3 int Integrase/recombinase Salmonella typhi
P62591 3.87e-22 97 32 7 271 3 int Integrase/recombinase Pseudomonas aeruginosa
P62590 3.87e-22 97 32 7 271 3 int Integrase/recombinase Escherichia coli
P55429 7.9e-22 95 35 8 222 3 NGR_a03870 Putative integrase/recombinase y4eF Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55636 4.8e-21 94 30 10 288 3 NGR_a01840 Putative integrase/recombinase y4rC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q0PA27 3.14e-19 90 31 4 189 1 xerH Tyrosine recombinase XerH Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O25386 4.48e-18 86 29 4 206 1 xerH Tyrosine recombinase XerH Helicobacter pylori (strain ATCC 700392 / 26695)
P55634 1.22e-16 83 28 9 281 3 NGR_a01860 Putative integrase/recombinase y4rA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55639 6.6e-15 78 27 10 303 3 NGR_a01810 Putative integrase/recombinase y4rF Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P10020 8.35e-14 73 24 8 270 3 tnpI TnP I resolvase Bacillus thuringiensis
P55459 4.25e-13 70 32 7 192 3 NGR_a03610 Putative integrase/recombinase y4gC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0ADH5 5.01e-13 70 30 6 170 3 fimB Type 1 fimbriae regulatory protein FimB Escherichia coli (strain K12)
P0ADH6 5.01e-13 70 30 6 170 3 fimB Type 1 fimbriae regulatory protein FimB Escherichia coli O157:H7
Q1JLL7 7.44e-13 71 31 3 160 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q5XC26 1.59e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0ADH9 1.63e-12 68 31 3 148 3 fimE Type 1 fimbriae regulatory protein FimE Shigella flexneri
P0ADH7 1.63e-12 68 31 3 148 3 fimE Type 1 fimbriae regulatory protein FimE Escherichia coli (strain K12)
P0ADH8 1.63e-12 68 31 3 148 3 fimE Type 1 fimbriae regulatory protein FimE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A2RED8 1.68e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M5 (strain Manfredo)
Q48TG2 2.13e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q8P0Y8 2.19e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DH45 2.21e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1J6H1 2.21e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JBN4 2.21e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DH44 2.21e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P67634 2.21e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M1
B5XLN3 2.3e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JGQ2 2.38e-12 70 32 3 156 3 xerS Tyrosine recombinase XerS Streptococcus pyogenes serotype M2 (strain MGAS10270)
P37375 3.67e-12 70 25 6 254 3 tnpB Transposase B from transposon PsiTn554 Staphylococcus aureus
Q02YZ4 1.85e-11 67 29 2 153 3 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. cremoris (strain SK11)
A2RKP9 1.86e-11 67 29 2 153 1 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. cremoris (strain MG1363)
A8AXA5 3.85e-11 66 28 3 160 3 xerS Tyrosine recombinase XerS Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A3CN22 6.24e-11 65 28 3 160 3 xerS Tyrosine recombinase XerS Streptococcus sanguinis (strain SK36)
P0A055 8.58e-11 66 24 6 254 3 tnpB Transposase B from transposon Tn554 Staphylococcus aureus
P0A054 8.58e-11 66 24 6 254 3 tnpB1 Transposase B from transposon Tn554 Staphylococcus aureus (strain N315)
P0A053 8.58e-11 66 24 6 254 3 tnpB1 Transposase B from transposon Tn554 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9CG78 9.21e-11 65 30 2 153 3 xerS Tyrosine recombinase XerS Lactococcus lactis subsp. lactis (strain IL1403)
Q5M4E9 1.55e-10 64 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LZT9 1.56e-10 64 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain CNRZ 1066)
B4U2Z3 1.64e-10 64 30 3 156 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0MFD9 1.7e-10 64 30 3 156 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. zooepidemicus (strain H70)
C0MBC3 1.73e-10 64 30 3 156 3 xerS Tyrosine recombinase XerS Streptococcus equi subsp. equi (strain 4047)
B9DUD2 2.06e-10 64 28 3 160 3 xerS Tyrosine recombinase XerS Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B8ZQ39 2.22e-10 64 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1C7D0 2.22e-10 64 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain 70585)
Q03KP9 2.93e-10 63 30 4 156 3 xerS Tyrosine recombinase XerS Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
C1CRN6 2.96e-10 63 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain Taiwan19F-14)
C1CEC5 2.96e-10 63 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain JJA)
Q7ZAK7 2.96e-10 63 28 2 159 1 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IPW6 2.96e-10 63 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain CGSP14)
Q04KF1 2.96e-10 63 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CKQ9 2.99e-10 63 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain P1031)
O69155 3.13e-10 63 29 2 155 3 xerS Tyrosine recombinase XerS Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B5E4Q4 3.22e-10 63 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 19F (strain G54)
Q97QP2 3.53e-10 63 28 2 159 1 xerS Tyrosine recombinase XerS Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1IBW3 4.05e-10 63 28 2 159 3 xerS Tyrosine recombinase XerS Streptococcus pneumoniae (strain Hungary19A-6)
P67633 3.02e-09 60 31 2 153 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67632 3.02e-09 60 31 2 153 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype III (strain NEM316)
Q3K1A9 3.02e-09 60 31 2 153 3 xerS Tyrosine recombinase XerS Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8KUV2 3.43e-09 60 26 10 290 3 Synpcc7942_B2651 Tyrosine recombinase Synpcc7942_B2651 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8R890 1.07e-08 59 25 9 251 3 TTE2127 Tyrosine recombinase XerC-like Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q57813 1.17e-08 58 26 6 164 3 MJ0367 Probable integrase/recombinase protein MJ0367 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A4VUQ8 1.62e-08 58 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus suis (strain 05ZYH33)
A4W104 1.62e-08 58 30 3 155 3 xerS Tyrosine recombinase XerS Streptococcus suis (strain 98HAH33)
P42540 9.01e-08 55 25 5 156 3 None Probable integrase/recombinase Acholeplasma phage L2
P62905 2.35e-07 55 25 6 195 3 int Transposase from transposon Tn1545 Streptococcus pneumoniae
P62904 2.35e-07 55 25 6 195 3 int Transposase from transposon Tn1545 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q9PQS0 2.52e-07 54 23 6 205 3 xerC Tyrosine recombinase UU222 Ureaplasma parvum serovar 3 (strain ATCC 700970)
P22886 2.59e-07 55 25 6 195 1 Int-Tn Transposase from transposon Tn916 Enterococcus faecalis
P55638 5.08e-07 53 29 9 234 3 NGR_a01820 Putative integrase/recombinase y4rE Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P18021 5.76e-07 53 27 9 210 3 resD Resolvase Escherichia coli
P0A052 1.02e-06 53 26 6 175 3 tnpA Transposase A from transposon Tn554 Staphylococcus aureus
P0A051 1.02e-06 53 26 6 175 3 tnpA1 Transposase A from transposon Tn554 Staphylococcus aureus (strain N315)
P0A050 1.02e-06 53 26 6 175 3 tnpA1 Transposase A from transposon Tn554 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P06723 1.16e-06 52 27 7 177 3 int Integrase Escherichia phage 186
P55635 2.79e-06 51 28 3 156 3 NGR_a01850 Putative integrase/recombinase y4rB Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P36932 4.28e-06 51 25 7 236 1 int Integrase Escherichia phage P2
P06615 4.37e-06 50 27 9 210 3 resD Resolvase Escherichia coli (strain K12)
P55637 5.83e-06 50 24 10 266 3 NGR_a01830 Putative integrase/recombinase y4rD Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q38067 3.07e-05 48 38 0 54 3 None Putative integrase Pseudomonas phage Pf1
P72680 3.23e-05 48 26 3 148 3 xerC Tyrosine recombinase slr0733 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8KRZ2 5.8e-05 48 24 4 150 3 xerC Putative tyrosine recombinase XerC Pseudomonas syringae
P21442 0.0001 47 41 0 46 1 int Integrase Haemophilus phage HP1 (strain HP1c1)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_04100
Feature type CDS
Gene xerD
Product site-specific tyrosine recombinase XerD
Location 5787 - 6701 (strand: -1)
Length 915 (nucleotides) / 304 (amino acids)
In genomic island GI38

Contig

Accession contig_4
Length 199551 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_885
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00589 Phage integrase family
PF02899 Phage integrase, N-terminal SAM-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4974 Replication, recombination and repair (L) L Site-specific recombinase XerD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04763 integrase/recombinase XerD - -

Protein Sequence

MKDAVQHSESDALTEQFLDTIWLEQNLSENTLASYRLDLQALADWLAPQDLDWLSLTTLDLQAFLAGRLDRGYKATSSARMLSSLRRFFQYCYREKLRTDDPTIQLAAPKLPARLPKDLSESQVDDLLAAPDVTDPLELRDKAMLEVLYACGLRVTELVSLSLPDVSLRQGVIRVIGKGNKERLVPMGEEAVYWLEVYLAQARPSLLNGQAADVLFPSKLGRQMTRQTFWHRIKHYAVVAGIATEKLSPHVLRHAFATHLLNHGADLRVVQMLLGHSDLSTTQIYTHVATERLRTLHQQHHPRG

Flanking regions ( +/- flanking 50bp)

AACAGAAGATAAGTTAATTCTGACACGGGAATTCAAACGGGAGGTCAGCGGTGAAGGACGCCGTACAACACAGCGAAAGTGATGCACTGACAGAGCAGTTTCTTGATACTATCTGGCTGGAACAGAATTTATCGGAAAACACCCTGGCATCCTACCGCCTGGATTTACAGGCACTGGCGGACTGGCTGGCGCCGCAGGATCTGGATTGGTTATCGCTGACCACCCTTGATTTGCAGGCTTTTCTGGCCGGCCGGCTGGATCGCGGTTACAAAGCTACCAGTTCGGCGCGGATGCTCAGCTCGCTGCGCCGGTTTTTCCAGTATTGCTACCGTGAAAAACTGCGGACGGATGACCCGACTATTCAGCTGGCGGCACCCAAACTGCCCGCCCGGCTGCCGAAAGATTTGAGCGAAAGCCAGGTGGATGACCTGCTTGCGGCTCCGGATGTTACCGATCCGCTTGAACTGCGCGATAAAGCCATGCTGGAAGTGCTTTATGCCTGCGGACTGCGCGTGACAGAGCTGGTGTCACTGTCGCTGCCGGATGTCAGTCTGCGCCAGGGCGTGATCCGCGTGATCGGTAAAGGTAATAAAGAGCGTCTGGTGCCGATGGGGGAAGAAGCGGTGTACTGGCTGGAGGTTTATCTGGCACAGGCCAGACCGTCACTGCTGAACGGACAGGCTGCGGACGTGCTGTTCCCGAGCAAACTCGGGCGGCAGATGACGCGGCAGACATTCTGGCACCGCATCAAACACTATGCGGTCGTAGCCGGGATTGCGACTGAAAAACTCTCGCCCCATGTGCTGCGCCATGCCTTTGCCACGCATCTGCTCAATCACGGGGCGGATCTGCGGGTGGTGCAGATGCTGCTGGGGCACAGTGATTTATCCACCACTCAAATTTATACCCATGTCGCGACGGAGCGGTTACGCACGCTGCACCAGCAGCACCATCCGCGCGGCTGATAAGGAAACAGTATGCTGAAAATTGTATCATCCGCACTGGCGCTTCTGCT