Homologs in group_1973

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14800 FBDBKF_14800 88.9 Morganella morganii S1 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
EHELCC_15605 EHELCC_15605 88.9 Morganella morganii S2 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
NLDBIP_16135 NLDBIP_16135 88.9 Morganella morganii S4 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
LHKJJB_15705 LHKJJB_15705 88.9 Morganella morganii S3 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
HKOGLL_14825 HKOGLL_14825 88.9 Morganella morganii S5 fepC ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
PMI_RS01115 PMI_RS01115 66.9 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1973

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1973

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q57554 1.06e-45 157 37 8 261 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P07821 4.24e-41 145 36 5 255 1 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Escherichia coli (strain K12)
P49938 1.2e-39 141 35 5 244 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
O32188 5.45e-39 140 36 5 234 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
Q81LM1 5.92e-38 137 35 3 237 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q81V82 3.09e-37 135 35 5 245 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
P23878 1.04e-36 134 31 5 254 1 fepC Ferric enterobactin transport ATP-binding protein FepC Escherichia coli (strain K12)
Q47087 2.45e-36 133 34 3 233 3 cbrD Achromobactin transport ATP-binding protein CbrD Dickeya dadantii (strain 3937)
P94420 2.78e-35 130 32 4 234 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
P15031 4.63e-35 129 35 6 242 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q7AH43 5.11e-35 131 35 4 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q5YVL8 2.57e-34 128 36 4 239 3 hmuV Hemin import ATP-binding protein HmuV Nocardia farcinica (strain IFM 10152)
Q93SS1 5.05e-34 127 33 5 246 3 hmuV Hemin import ATP-binding protein HmuV Plesiomonas shigelloides
P10091 1.08e-33 128 39 3 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q1R597 4.05e-33 124 33 4 228 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q3ICT8 4.1e-33 124 35 8 261 3 hmuV Hemin import ATP-binding protein HmuV Pseudoalteromonas translucida (strain TAC 125)
Q32AY3 4.27e-33 124 33 4 228 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q8FCJ1 5.86e-33 124 33 4 228 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 5.86e-33 124 33 4 228 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O70014 6.31e-33 124 33 4 228 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q6D734 1.33e-32 125 35 4 206 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2T3B8 1.4e-32 123 34 5 257 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SB47 1.46e-32 123 35 8 250 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
P37009 2.41e-32 124 33 4 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q8EB59 3.46e-32 122 35 5 229 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q12R52 7.79e-32 120 33 5 255 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
P45092 9.34e-32 120 33 4 230 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57293 1.05e-31 122 32 4 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q8X5N2 1.2e-31 120 32 4 228 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q6LKD4 1.93e-31 122 31 8 266 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q7NN36 2.25e-31 120 33 5 231 3 hmuV Hemin import ATP-binding protein HmuV Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q0I2Z4 2.44e-31 122 33 6 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q2NSR0 2.5e-31 119 33 4 245 3 hmuV Hemin import ATP-binding protein HmuV Sodalis glossinidius (strain morsitans)
Q8L1U3 3.26e-31 119 32 6 275 1 hmuV Hemin import ATP-binding protein HmuV Bordetella avium
Q2KUC0 3.26e-31 119 32 6 275 3 hmuV Hemin import ATP-binding protein HmuV Bordetella avium (strain 197N)
Q6D645 4.05e-31 119 34 4 231 3 hmuV Hemin import ATP-binding protein HmuV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O34510 8.85e-31 118 31 4 264 3 yfmF Fe(3+)-citrate import ATP-binding protein YfmF Bacillus subtilis (strain 168)
Q98L75 1.13e-30 118 31 6 236 3 hmuV Hemin import ATP-binding protein HmuV Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q160G4 2.8e-30 117 33 4 233 3 hmuV Hemin import ATP-binding protein HmuV Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q9KLQ5 3.39e-30 119 32 5 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7N8B9 3.57e-30 119 33 5 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q39B28 4.06e-30 117 31 5 258 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q81GU1 4.29e-30 119 35 3 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8E8K8 6.91e-30 118 35 3 224 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9CM80 7.89e-30 117 32 5 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q28QF9 9.69e-30 115 31 4 241 3 hmuV Hemin import ATP-binding protein HmuV Jannaschia sp. (strain CCS1)
Q3KCC5 9.98e-30 117 32 5 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q63NR0 1.04e-29 115 32 5 271 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia pseudomallei (strain K96243)
Q3JHM1 1.04e-29 115 32 5 271 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia pseudomallei (strain 1710b)
Q62A98 1.04e-29 115 32 5 271 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia mallei (strain ATCC 23344)
Q6F0V4 1.17e-29 117 30 6 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q87J32 1.25e-29 115 30 5 253 3 hmuV Hemin import ATP-binding protein HmuV Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O31339 1.32e-29 117 34 3 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9CP06 1.35e-29 117 32 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
P44531 1.76e-29 116 31 5 229 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57243 2.45e-29 114 30 4 243 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6G475 3.03e-29 114 29 7 262 3 hmuV Hemin import ATP-binding protein HmuV Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q65UE1 3.69e-29 116 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9G4F5 4.03e-29 116 34 3 229 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q63TY1 4.14e-29 116 33 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q62K82 4.49e-29 115 33 4 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q88DY1 6.52e-29 113 33 5 239 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9JUX4 8.92e-29 115 33 7 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q6MIP7 9.79e-29 113 32 8 249 3 phnC Phosphonates import ATP-binding protein PhnC Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q8CUY0 1.04e-28 112 30 7 249 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q84EY8 1.06e-28 113 34 5 229 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
Q92WJ0 1.24e-28 114 36 5 211 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q7W9U5 1.39e-28 114 34 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P48243 1.46e-28 112 33 3 217 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q38VW6 1.5e-28 114 32 10 270 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q66FK0 1.7e-28 112 33 4 231 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 1.7e-28 112 33 4 231 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 1.7e-28 112 33 4 231 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 1.7e-28 112 33 4 231 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q9JZW0 1.72e-28 114 33 7 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9KS33 1.9e-28 114 32 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8F6Z1 2.13e-28 114 31 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 2.13e-28 114 31 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q73GK9 2.13e-28 111 27 7 247 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q7WGW1 2.41e-28 114 34 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7N6Z2 2.49e-28 114 29 5 247 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q88YN5 2.56e-28 112 31 4 215 3 phnC Phosphonates import ATP-binding protein PhnC Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7VZE5 2.56e-28 114 34 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7N3S7 2.58e-28 112 32 8 251 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q659V4 2.58e-28 112 31 7 253 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q8XZP8 3.11e-28 114 32 5 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6F9A8 3.23e-28 113 34 3 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q16BC5 3.45e-28 111 30 4 220 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5E5I1 3.55e-28 111 32 6 263 3 hmuV Hemin import ATP-binding protein HmuV Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q2RZ08 3.57e-28 112 32 8 250 3 hmuV Hemin import ATP-binding protein HmuV Salinibacter ruber (strain DSM 13855 / M31)
E0SCY1 4.83e-28 114 35 3 201 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
Q2JLH7 5.49e-28 111 30 4 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q93DX8 7.66e-28 110 32 4 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q6LR20 7.9e-28 113 36 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q92N13 8.15e-28 110 31 5 230 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
Q5X627 9.45e-28 112 32 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q70GD4 1.23e-27 110 30 7 253 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
P56344 1.26e-27 109 33 5 223 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q3K6R9 1.37e-27 110 34 6 241 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain Pf0-1)
Q0B697 1.39e-27 110 29 4 257 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q138A9 1.45e-27 110 31 6 244 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB5)
Q9RZU5 1.54e-27 110 31 5 244 3 hmuV Hemin import ATP-binding protein HmuV Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q0I3Y9 1.55e-27 112 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q668K6 1.59e-27 112 31 6 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q4QK57 1.63e-27 112 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
O05732 1.78e-27 109 33 3 236 3 HP_0888 Probable iron chelatin transport ATP-binding protein HP_0888 Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZKW3 1.78e-27 109 33 3 236 3 jhp_0821 Probable iron chelatin transport ATP-binding protein jhp_0821 Helicobacter pylori (strain J99 / ATCC 700824)
Q65S66 1.89e-27 111 30 5 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9TKX3 2.07e-27 111 31 5 265 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q8RQL7 2.09e-27 108 32 3 217 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8D0W8 2.13e-27 111 31 6 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q1BJA5 2.22e-27 109 31 5 260 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia orbicola (strain AU 1054)
A0B3E2 2.22e-27 109 31 5 260 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia cenocepacia (strain HI2424)
Q9HQ18 2.54e-27 112 29 5 242 1 btuD Cobalamin import ATP-binding protein BtuD Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G4 2.54e-27 112 29 5 242 3 btuD Cobalamin import ATP-binding protein BtuD Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P10346 2.66e-27 108 32 4 208 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q88ZJ6 2.7e-27 111 33 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q5ZWE4 2.77e-27 111 32 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q0SML1 2.88e-27 111 32 4 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q1LC89 2.95e-27 109 31 4 260 3 hmuV Hemin import ATP-binding protein HmuV Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
O84071 3.14e-27 108 29 7 247 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9PDN2 3.21e-27 110 35 4 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q70YG7 3.53e-27 108 29 7 268 1 hmuV Hemin import ATP-binding protein HmuV Vibrio anguillarum (strain ATCC 68554 / 775)
Q5WXF0 3.61e-27 111 32 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
O34631 3.93e-27 112 33 4 236 3 yvrA Uncharacterized ABC transporter ATP-binding protein YvrA Bacillus subtilis (strain 168)
Q2SSS4 4.17e-27 110 30 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q6D4E2 4.48e-27 111 31 4 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P74548 4.86e-27 110 30 4 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8D3S8 4.88e-27 108 29 5 257 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain CMCP6)
Q5E586 4.97e-27 110 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MFA1 5.89e-27 108 29 5 257 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain YJ016)
Q7NX01 6.18e-27 110 33 3 216 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q6MU19 6.22e-27 110 30 4 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q03AH0 6.23e-27 110 33 4 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P27675 6.44e-27 107 28 6 235 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q1I4Q5 6.8e-27 108 37 4 213 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas entomophila (strain L48)
Q4K5Z7 7.16e-27 108 33 8 257 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P45171 7.18e-27 110 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8REG7 7.19e-27 107 30 6 243 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q0T5R2 8.73e-27 110 34 4 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
O85818 1.07e-26 110 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q1H0W2 1.22e-26 107 33 4 206 3 hmuV Hemin import ATP-binding protein HmuV Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q8DPC2 1.4e-26 109 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.4e-26 109 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.4e-26 109 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q87PH3 1.4e-26 109 30 5 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87DT9 1.42e-26 109 35 4 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P69877 1.62e-26 109 33 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.62e-26 109 33 4 231 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.62e-26 109 33 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.62e-26 109 33 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.62e-26 109 33 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q1DCP5 1.67e-26 107 32 6 240 3 hmuV Hemin import ATP-binding protein HmuV Myxococcus xanthus (strain DK1622)
Q1RD28 1.73e-26 109 33 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.73e-26 109 33 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q2K8C8 1.79e-26 108 32 4 225 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q32EY4 2.05e-26 109 32 4 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q8NQU4 2.08e-26 106 30 4 226 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q83MG3 2.43e-26 105 32 5 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
C3LLU1 2.48e-26 106 31 5 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain M66-2)
Q9KSL1 2.48e-26 106 31 5 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6D201 2.53e-26 108 30 4 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q14Q07 2.6e-26 108 32 5 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8D653 2.96e-26 108 32 3 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q6G098 3.62e-26 106 29 7 264 3 hmuV Hemin import ATP-binding protein HmuV Bartonella quintana (strain Toulouse)
Q85A69 3.77e-26 108 36 3 192 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q660M8 3.9e-26 108 31 4 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q7MKU3 3.92e-26 108 30 5 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 3.92e-26 108 30 5 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q9PKX1 4.07e-26 106 31 6 217 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
A1VZQ5 4.38e-26 105 29 4 237 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q03JH1 4.43e-26 108 35 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q7CN92 4.61e-26 108 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 4.61e-26 108 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
P14175 4.82e-26 108 31 6 228 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q5LYN4 4.85e-26 108 35 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q1QE80 5.24e-26 108 33 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q5M397 5.26e-26 108 35 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q1GB17 5.54e-26 107 34 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q0P9X7 5.63e-26 105 29 4 237 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P17328 5.83e-26 108 31 6 229 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O51587 5.93e-26 107 31 4 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8DUF7 6.06e-26 108 35 6 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q3Z2Z3 7.23e-26 107 32 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 7.23e-26 107 32 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q1J6Q6 9.66e-26 107 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 9.66e-26 107 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 9.66e-26 107 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 9.66e-26 107 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
A3CMQ7 1.22e-25 107 34 4 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q8Z8W8 1.26e-25 107 33 6 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
P96063 1.32e-25 107 33 6 243 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PFQ7 1.39e-25 107 33 6 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6D2F6 1.48e-25 106 30 5 225 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q04BG2 1.49e-25 106 34 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8U6M1 1.58e-25 106 34 4 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q89AJ0 1.7e-25 103 29 6 237 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P0CZ35 1.7e-25 107 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 1.7e-25 107 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q5XCA4 1.7e-25 107 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ34 1.7e-25 107 33 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q7WEH6 1.9e-25 104 35 3 229 3 hmuV Hemin import ATP-binding protein HmuV Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9KL34 1.94e-25 104 29 5 248 3 hmuV Hemin import ATP-binding protein HmuV Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q578K3 1.97e-25 106 33 5 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.97e-25 106 33 5 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
O68877 2.05e-25 104 35 6 239 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FW7 2.05e-25 104 35 6 239 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain UCBPP-PA14)
Q73P71 2.13e-25 104 27 5 233 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8PNN4 2.49e-25 105 29 5 258 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q93SH7 2.51e-25 104 32 6 233 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q65T42 2.62e-25 105 30 4 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P16676 2.91e-25 105 29 6 244 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q0K1N8 2.92e-25 104 29 6 237 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q57SD6 2.98e-25 105 33 6 243 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q74K65 3.01e-25 105 33 7 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
P9WQM1 3.26e-25 105 33 4 234 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 3.26e-25 105 33 4 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 3.26e-25 105 33 4 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B5BA33 3.34e-25 103 34 5 235 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain AKU_12601)
Q5PH81 3.34e-25 103 34 5 235 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5QVV9 3.34e-25 103 34 5 235 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella enteritidis PT4 (strain P125109)
Q5L222 3.38e-25 105 33 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
P63351 3.41e-25 103 34 5 235 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63352 3.41e-25 103 34 5 235 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhi
B4TGI0 3.41e-25 103 34 5 235 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella heidelberg (strain SL476)
B5FJ99 3.41e-25 103 34 5 235 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella dublin (strain CT_02021853)
Q57PU4 3.41e-25 103 34 5 235 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella choleraesuis (strain SC-B67)
Q8FFB3 3.61e-25 105 29 6 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8AHA1 3.83e-25 103 34 4 217 3 btuD Vitamin B12 import ATP-binding protein BtuD Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q03EE4 3.89e-25 103 28 5 232 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q4FL37 4.02e-25 105 33 3 190 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q830W6 4.06e-25 105 30 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q8XBJ8 4.24e-25 105 29 6 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q5YZY9 4.8e-25 104 31 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q8ELR4 5.33e-25 105 32 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q32K28 6.12e-25 102 32 5 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
P46920 6.21e-25 105 35 6 205 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
Q52666 6.35e-25 103 29 4 222 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q6MCV4 6.51e-25 105 35 4 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q9KD30 6.51e-25 102 31 7 237 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q31J97 6.71e-25 102 30 5 243 3 hmuV Hemin import ATP-binding protein HmuV Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q46TK4 6.87e-25 103 29 6 237 3 phnC Phosphonates import ATP-binding protein PhnC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7VNG4 7.46e-25 105 30 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5FL41 8.29e-25 104 32 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q92UV5 9.08e-25 105 34 2 196 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q7UC29 9.75e-25 104 29 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
P39456 9.88e-25 102 28 5 247 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
Q72AQ6 1.03e-24 102 30 5 216 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q6D4A8 1.18e-24 102 32 8 237 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7W025 1.26e-24 102 35 3 229 3 hmuV Hemin import ATP-binding protein HmuV Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8PP41 1.28e-24 102 33 5 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q326G9 1.28e-24 101 32 5 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q10V16 1.37e-24 102 30 6 213 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Trichodesmium erythraeum (strain IMS101)
Q0T8D1 1.43e-24 101 32 5 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
P74981 1.44e-24 102 32 6 245 1 hmuV Hemin import ATP-binding protein HmuV Yersinia enterocolitica
O34392 1.57e-24 101 33 4 179 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q89UD2 1.6e-24 103 32 4 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q0BUR6 1.64e-24 101 34 5 198 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q58283 1.65e-24 102 29 6 241 3 MJ0873 Uncharacterized ABC transporter ATP-binding protein MJ0873 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q3A9G5 1.72e-24 103 32 6 223 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A5F1V0 1.81e-24 101 31 5 232 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6N7Y6 2.13e-24 101 30 6 249 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q30W28 2.15e-24 102 32 5 218 3 phnC Phosphonates import ATP-binding protein PhnC Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q04G50 2.37e-24 103 30 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8Z4V6 2.47e-24 103 28 5 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
P40860 2.6e-24 103 28 5 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8PC11 2.62e-24 103 31 6 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q2K4V4 2.71e-24 103 29 4 222 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q88ZZ2 2.71e-24 105 29 3 229 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 2.26e-15 79 28 9 258 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9ZCC4 2.76e-24 100 30 5 202 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q9KFL0 3.11e-24 100 28 6 231 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P31134 3.11e-24 103 31 6 226 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q1MCN6 3.12e-24 103 29 5 227 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q24XJ2 3.18e-24 102 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q82WT5 3.33e-24 103 33 4 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8DZJ0 3.7e-24 103 33 4 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 3.7e-24 103 33 4 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 3.7e-24 103 33 4 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q73XU8 3.72e-24 102 33 4 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8U4K3 3.84e-24 102 31 5 216 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q1CJG3 3.94e-24 100 30 7 236 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 3.94e-24 100 30 7 236 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 3.94e-24 100 30 7 236 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1RGL1 3.97e-24 100 32 6 202 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q11ID5 4.05e-24 100 30 5 251 3 hmuV Hemin import ATP-binding protein HmuV Chelativorans sp. (strain BNC1)
Q7W359 4.08e-24 100 35 3 229 3 hmuV Hemin import ATP-binding protein HmuV Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q3KBH4 4.36e-24 102 36 3 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
P40790 4.4e-24 102 30 4 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 4.4e-24 102 30 4 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q217B2 4.43e-24 100 31 5 244 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q8Z0H0 4.5e-24 102 31 4 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8UCM5 4.58e-24 100 28 7 252 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5PMK1 4.62e-24 102 30 4 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q24QI5 4.73e-24 102 30 7 239 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q8RGC8 4.8e-24 102 33 5 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q81CT8 5.07e-24 104 31 7 222 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 8.94e-14 74 26 4 236 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8Z7H7 5.22e-24 102 30 4 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q3SQ65 5.4e-24 100 30 4 228 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q87RE5 5.56e-24 100 29 5 227 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q98G42 5.58e-24 102 28 5 232 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8FVV5 5.83e-24 102 33 5 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q6WB63 5.91e-24 100 31 8 246 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
A1TXH7 6.39e-24 102 32 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q03ZQ0 6.52e-24 102 33 3 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9AE30 6.83e-24 100 28 3 238 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium leguminosarum
Q042G7 7.05e-24 102 32 7 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q9I6L0 7.13e-24 101 30 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q66AT7 7.27e-24 100 30 7 236 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q4JTG9 8.06e-24 102 31 4 215 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q58664 8.17e-24 99 30 6 233 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5YRK2 8.52e-24 99 33 7 224 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Nocardia farcinica (strain IFM 10152)
O34338 8.69e-24 99 29 7 240 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q8EBC3 8.69e-24 102 32 6 235 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7MMN0 8.79e-24 100 30 5 227 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 8.79e-24 100 30 5 227 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8D385 9.73e-24 99 29 3 235 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
A1B9H9 9.76e-24 99 32 5 225 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
Q31DV4 1.06e-23 100 31 8 244 3 phnC Phosphonates import ATP-binding protein PhnC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9X196 1.08e-23 101 31 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1GJU0 1.08e-23 99 30 7 236 3 hmuV Hemin import ATP-binding protein HmuV Ruegeria sp. (strain TM1040)
Q82MV1 1.09e-23 99 31 5 220 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q3SGJ8 1.21e-23 99 31 5 217 3 phnC Phosphonates import ATP-binding protein PhnC Thiobacillus denitrificans (strain ATCC 25259)
Q609Q1 1.36e-23 101 32 5 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q57TF5 1.37e-23 99 32 4 214 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q89LP2 1.41e-23 100 29 6 244 3 metN Methionine import ATP-binding protein MetN Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9RR46 1.41e-23 101 33 6 208 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q5GRS1 1.43e-23 99 25 7 247 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q2K551 1.44e-23 99 29 5 237 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A0PY57 1.44e-23 100 28 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q8NR42 1.53e-23 99 32 6 209 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P31548 1.54e-23 98 33 3 192 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
Q4KC87 1.61e-23 100 30 5 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q21PQ7 1.71e-23 99 27 4 237 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9Z8J5 1.75e-23 99 29 8 251 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q9A7X1 1.78e-23 100 34 3 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7CS28 1.8e-23 100 33 3 202 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
P54954 1.91e-23 99 31 5 207 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
Q8YCG3 1.95e-23 100 33 5 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q1MCZ1 2.05e-23 99 28 3 238 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q665B6 2.06e-23 99 32 5 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q21GS5 2.16e-23 100 32 7 232 3 modC Molybdenum import ATP-binding protein ModC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5WIL7 2.24e-23 99 31 8 247 3 phnC Phosphonates import ATP-binding protein PhnC Shouchella clausii (strain KSM-K16)
Q4UJW5 2.24e-23 98 30 5 202 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q0S0X2 2.28e-23 99 35 5 188 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q5QXD0 2.29e-23 99 29 6 239 3 hmuV Hemin import ATP-binding protein HmuV Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
P44513 2.33e-23 100 29 6 242 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HT70 2.34e-23 100 32 4 204 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 2.34e-23 100 32 4 204 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q5PDF8 2.34e-23 98 32 4 214 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q92G36 2.43e-23 98 30 5 202 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q7NWX3 2.43e-23 100 34 4 200 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q52815 2.62e-23 98 28 5 233 3 aapP General L-amino acid transport ATP-binding protein AapP Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8Z9I6 2.7e-23 98 32 4 214 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhi
Q6NBT1 2.76e-23 100 30 4 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6LQC0 2.86e-23 99 29 5 227 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium profundum (strain SS9)
Q57213 2.97e-23 97 35 3 190 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1JRI2 3.56e-23 98 29 7 236 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1WXT0 3.79e-23 98 28 4 234 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q132E8 4.13e-23 98 31 8 244 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q8EPK1 4.34e-23 99 30 7 251 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q88AS5 4.45e-23 99 30 4 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0SIB7 4.47e-23 98 32 7 242 3 hmuV Hemin import ATP-binding protein HmuV Rhodococcus jostii (strain RHA1)
Q1BG75 4.77e-23 98 35 5 199 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 4.77e-23 98 35 5 199 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q9KQB8 4.79e-23 98 28 6 239 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q11D92 5.03e-23 97 30 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Chelativorans sp. (strain BNC1)
P33982 5.25e-23 98 30 6 240 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B7VPD0 5.27e-23 97 30 3 219 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio atlanticus (strain LGP32)
Q1WSB8 5.29e-23 98 31 4 229 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q6F0P3 5.29e-23 97 27 7 240 3 phnC Phosphonates import ATP-binding protein PhnC Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q110U3 5.44e-23 100 31 4 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q13ZK7 5.69e-23 99 33 8 239 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q48J29 6.04e-23 99 32 4 213 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8ZRV2 6.14e-23 97 32 4 214 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2J3T0 6.27e-23 97 27 5 243 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q97KS6 6.47e-23 99 30 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q321G6 6.57e-23 97 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 4 (strain Sb227)
Q032D0 6.94e-23 97 29 6 247 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. cremoris (strain SK11)
Q5PB72 7.31e-23 97 28 7 228 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q68Y13 7.96e-23 96 29 5 202 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q2SJY7 8.38e-23 99 29 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q1CDR0 9.39e-23 97 32 5 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 9.39e-23 97 32 5 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 9.39e-23 97 32 5 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q8UA73 9.67e-23 98 32 2 196 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5X2Z8 9.78e-23 96 31 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q07LU3 1.07e-22 97 30 6 233 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q3Z5U5 1.09e-22 96 31 5 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
P45073 1.11e-22 96 27 5 235 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4L8L7 1.13e-22 95 29 6 212 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q65M34 1.13e-22 98 30 5 226 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q7MPC5 1.13e-22 96 35 3 191 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 1.13e-22 96 35 3 191 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q4QP85 1.17e-22 98 29 5 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q6LTB1 1.17e-22 97 28 7 232 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q8DIA0 1.18e-22 98 31 4 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9I2N4 1.27e-22 98 31 6 223 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q01937 1.34e-22 98 31 5 229 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q8XA06 1.35e-22 96 33 3 192 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
P0C0E2 1.42e-22 95 31 7 221 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 1.42e-22 95 31 7 221 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
P14788 1.43e-22 98 30 4 226 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q39HM4 1.52e-22 97 29 6 237 3 pstB Phosphate import ATP-binding protein PstB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q18AM3 1.55e-22 98 28 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q89C51 1.56e-22 96 29 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8RLB6 1.61e-22 96 32 7 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Delftia acidovorans
Q21UI2 1.65e-22 98 32 6 250 3 modC Molybdenum import ATP-binding protein ModC Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P54537 1.66e-22 96 28 5 230 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q722B1 1.73e-22 98 34 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q2IYS5 1.73e-22 97 32 6 219 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q7M8M4 1.74e-22 96 29 7 251 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P9WQK9 1.81e-22 96 28 6 233 1 pstB2 Phosphate import ATP-binding protein PstB 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK8 1.81e-22 96 28 6 233 3 pstB2 Phosphate import ATP-binding protein PstB 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7U0Z9 1.81e-22 96 28 6 233 3 pstB2 Phosphate import ATP-binding protein PstB 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8XDV7 1.91e-22 96 30 4 209 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
Q8UCD5 2.09e-22 98 30 5 214 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4ZSS5 2.17e-22 98 31 4 214 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas syringae pv. syringae (strain B728a)
Q0ASQ1 2.24e-22 96 28 6 253 3 phnC Phosphonates import ATP-binding protein PhnC Maricaulis maris (strain MCS10)
Q1BXC3 2.27e-22 96 29 6 237 3 pstB Phosphate import ATP-binding protein PstB Burkholderia orbicola (strain AU 1054)
Q5WUF8 2.29e-22 95 31 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q3M5J9 2.33e-22 95 30 7 226 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8TYV9 2.34e-22 96 32 2 209 3 MK0182 Putative ABC transporter ATP-binding protein MK0182 Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P55662 2.35e-22 95 29 7 237 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q5WCI1 2.4e-22 95 32 5 214 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q18KE1 2.47e-22 97 33 6 202 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q8FL82 2.83e-22 95 31 4 212 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q81XB3 2.88e-22 95 30 3 236 1 fatE Petrobactin import ATP-binding protein FatE Bacillus anthracis
Q5LT05 2.89e-22 97 31 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q6LV32 3.13e-22 95 33 3 198 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q21Y06 3.14e-22 96 31 7 222 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
D4GP39 3.17e-22 97 33 2 193 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q8YM92 3.26e-22 97 32 3 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7N545 3.3e-22 95 28 4 235 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1RGD0 3.34e-22 95 31 4 212 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q9MUN1 3.35e-22 97 28 3 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q2GJA5 3.61e-22 95 25 6 232 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q92DL6 3.75e-22 97 33 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0TLS2 3.78e-22 95 31 4 212 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q88CL2 4.03e-22 96 32 4 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7N8V0 4.28e-22 94 31 5 232 3 thiQ Thiamine import ATP-binding protein ThiQ Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7M816 4.31e-22 96 33 5 213 3 metN Methionine import ATP-binding protein MetN Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q13VD7 4.35e-22 97 30 7 226 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q329I3 4.45e-22 95 28 4 233 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
Q83CV2 4.46e-22 94 30 4 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q07PZ0 4.47e-22 95 32 6 217 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q2JPW6 4.49e-22 95 28 6 243 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q737I0 4.55e-22 98 28 8 237 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 2.33e-16 82 27 4 237 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8U648 5.17e-22 95 29 7 228 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3K506 5.23e-22 95 29 5 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q3MAR5 5.43e-22 97 31 3 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O57896 5.85e-22 96 30 4 216 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q4K681 6.16e-22 97 34 4 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8Y8T6 6.37e-22 96 33 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3YUN6 6.38e-22 95 29 5 233 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q6FAN3 6.68e-22 96 31 4 207 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q49588 6.81e-22 95 30 6 222 3 pstB Phosphate import ATP-binding protein PstB Mycobacterium intracellulare
P96117 7.08e-22 95 28 8 249 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q8PAG0 7.13e-22 95 31 6 233 3 pstB Phosphate import ATP-binding protein PstB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UT63 7.13e-22 95 31 6 233 3 pstB Phosphate import ATP-binding protein PstB Xanthomonas campestris pv. campestris (strain 8004)
Q9KUI0 7.17e-22 96 35 4 191 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q60AI1 7.62e-22 96 37 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1WVI7 7.99e-22 96 30 3 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q1J255 8.25e-22 95 30 6 248 3 hmuV Hemin import ATP-binding protein HmuV Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q64SQ6 8.58e-22 97 32 3 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q160Y9 8.91e-22 94 30 7 227 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5LBT4 8.93e-22 97 32 3 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q98HF7 9.21e-22 96 34 3 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1B8V9 9.29e-22 96 35 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 9.29e-22 96 35 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q7N986 9.44e-22 96 30 4 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Z5W6 9.54e-22 94 28 4 235 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q3YSK9 9.55e-22 94 25 4 232 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
P16677 9.73e-22 94 28 4 235 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
Q92VJ2 9.81e-22 96 29 4 240 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q1LQB5 9.88e-22 95 29 6 237 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q6LQ77 1.01e-21 94 29 3 221 3 btuD Vitamin B12 import ATP-binding protein BtuD Photobacterium profundum (strain SS9)
Q3Z257 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella sonnei (strain Ss046)
Q7C1M3 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri
Q0T4R9 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri serotype 5b (strain 8401)
Q32FJ0 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella dysenteriae serotype 1 (strain Sd197)
B1LE21 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SMS-3-5 / SECEC)
B6I8R4 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SE11)
B7N547 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IPL8 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q1 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O9:H4 (strain HS)
B7M1B8 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O8 (strain IAI1)
B7NTS2 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L6I2 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain 55989 / EAEC)
A7ZMH7 1.02e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O139:H28 (strain E24377A / ETEC)
Q4ZQE3 1.02e-21 94 31 8 219 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. syringae (strain B728a)
Q3BV68 1.07e-21 94 31 6 233 3 pstB Phosphate import ATP-binding protein PstB Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q1RB86 1.07e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain UTI89 / UPEC)
Q8FH28 1.07e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0THB9 1.07e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABP5 1.07e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O1:K1 / APEC
B7MV91 1.07e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O81 (strain ED1a)
B7MAS0 1.07e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O45:K1 (strain S88 / ExPEC)
B7US48 1.07e-21 94 31 7 238 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q58206 1.08e-21 94 33 7 206 1 MJ0796 Uncharacterized ABC transporter ATP-binding protein MJ0796 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9RKQ4 1.08e-21 94 32 9 268 3 hmuV Hemin import ATP-binding protein HmuV Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07600
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 1590012 - 1590827 (strand: -1)
Length 816 (nucleotides) / 271 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1973
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1120 Inorganic ion transport and metabolism (P)
Coenzyme transport and metabolism (H)		 PH ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02013 iron complex transport system ATP-binding protein [EC:7.2.2.-] - -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG044281 ABC transporter ATP-binding protein VF1252 Nutritional/Metabolic factor

Protein Sequence

MDINTLSANGLKINNFYAGYPKRKIIENLNVAPLPRGKITVLLGPNGSGKSTLLRALAGLNKASGELLLDGHDLTMMNFAQRAKQVVYLPQTLPAGVHLHVLESVIVAQRASGGVSDSDSENDVMSLLSQLGIEHLALHYLDQLSGGQKQLVGLAQSLIRKPSLLLLDEPLSALDLNYQYHVMDLVKRETQRRNIITVVVVHDINIALRHGDHILMLKDGNLIAEGEPEAVITPDSLARVYGVRGRIEHCTQAVPHVVIDGLVPRTEASLL

Flanking regions ( +/- flanking 50bp)

TGTGCCGTTTTTCCTGAGCATGATCCTGCGTCATAAAGGGAATATGTAAGATGGATATCAACACACTGTCTGCCAATGGATTAAAAATTAATAATTTTTACGCGGGTTATCCGAAACGTAAAATCATTGAAAACCTGAATGTGGCTCCCTTGCCGCGCGGAAAAATCACCGTGCTGCTCGGACCGAACGGCAGTGGTAAATCCACACTGCTGCGTGCGCTCGCCGGGCTGAATAAAGCCAGCGGTGAATTGCTGCTGGACGGGCATGACCTGACCATGATGAATTTTGCACAGCGTGCAAAGCAGGTGGTTTATCTGCCGCAGACATTACCGGCAGGTGTGCATCTGCATGTGCTGGAGTCCGTGATTGTGGCACAGCGCGCATCCGGCGGAGTATCGGACAGTGACAGTGAAAATGATGTCATGTCTTTGCTGTCACAATTAGGTATTGAACATCTGGCGTTGCATTATCTGGATCAATTATCCGGCGGACAAAAGCAATTAGTCGGGTTGGCTCAATCCTTAATTCGCAAGCCGTCATTATTATTACTGGATGAACCACTGAGTGCGCTGGATTTAAATTATCAATATCATGTGATGGATTTAGTTAAACGTGAAACGCAGCGCCGGAATATTATAACCGTTGTTGTTGTTCATGATATTAATATCGCGCTGCGTCATGGCGACCATATATTAATGCTGAAAGACGGTAATTTAATTGCGGAAGGTGAACCGGAAGCAGTTATTACCCCGGACAGTCTGGCACGGGTTTATGGTGTGCGCGGGCGCATAGAGCACTGCACGCAGGCTGTCCCGCATGTGGTGATTGATGGTCTGGTGCCGAGAACAGAGGCATCTCTGTTATAATAAACCGAATGGTAATGTGATTTTTTCTTTTTTCCTGCGAAAATTATTTT