Homologs in group_98

Help

11 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14705 FBDBKF_14705 93.2 Morganella morganii S1 fabF beta-ketoacyl-ACP synthase II
EHELCC_15510 EHELCC_15510 93.2 Morganella morganii S2 fabF beta-ketoacyl-ACP synthase II
NLDBIP_16040 NLDBIP_16040 93.2 Morganella morganii S4 fabF beta-ketoacyl-ACP synthase II
LHKJJB_15800 LHKJJB_15800 93.2 Morganella morganii S3 fabF beta-ketoacyl-ACP synthase II
HKOGLL_14920 HKOGLL_14920 93.2 Morganella morganii S5 fabF beta-ketoacyl-ACP synthase II
F4V73_RS12000 F4V73_RS12000 32.0 Morganella psychrotolerans - beta-ketoacyl-[acyl-carrier-protein] synthase family protein
F4V73_RS12015 F4V73_RS12015 39.1 Morganella psychrotolerans - beta-ketoacyl-ACP synthase
PMI_RS03710 PMI_RS03710 16.0 Proteus mirabilis HI4320 - 3-oxoacyl-ACP synthase
PMI_RS04235 PMI_RS04235 84.3 Proteus mirabilis HI4320 fabF beta-ketoacyl-ACP synthase II
PMI_RS14370 PMI_RS14370 19.2 Proteus mirabilis HI4320 - beta-ketoacyl synthase N-terminal-like domain-containing protein
PMI_RS14375 PMI_RS14375 34.8 Proteus mirabilis HI4320 - beta-ketoacyl-[acyl-carrier-protein] synthase family protein

Distribution of the homologs in the orthogroup group_98

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_98

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AAI8 0.0 647 83 3 415 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Shigella flexneri
P0AAI5 0.0 647 83 3 415 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli (strain K12)
P0AAI6 0.0 647 83 3 415 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAI7 0.0 647 83 3 415 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O157:H7
Q9KQH9 0.0 627 73 4 416 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P55338 0.0 619 73 4 416 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio harveyi
Q83E37 1.52e-173 494 56 4 415 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
O34340 3.14e-147 427 52 5 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Bacillus subtilis (strain 168)
P73283 4.27e-139 406 48 4 414 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8NXE1 1.65e-132 389 48 5 412 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MW2)
Q6GAU2 1.65e-132 389 48 5 412 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MSSA476)
Q5HHA1 1.65e-132 389 48 5 412 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain COL)
Q6GIA3 5.07e-132 388 48 5 411 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MRSA252)
Q7A6F8 5.97e-132 388 47 5 412 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain N315)
Q99VA6 5.97e-132 388 47 5 412 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5TKS0 1.86e-129 381 47 5 407 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 (Fragment) Staphylococcus aureus
P56902 1.69e-128 380 50 8 420 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Rhizobium meliloti (strain 1021)
Q9D404 1.95e-119 358 48 7 419 1 Oxsm 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Mus musculus
Q8L3X9 1.4e-118 356 47 8 434 1 KAS 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Arabidopsis thaliana
Q9NWU1 7.57e-116 348 47 7 416 1 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Homo sapiens
P52410 7.31e-115 347 43 4 412 1 KAS1 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Arabidopsis thaliana
P23902 2.31e-110 335 43 4 414 1 KAS12 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Hordeum vulgare
O94297 1.61e-109 331 43 8 424 3 SPBC887.13c Putative 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0VCA7 2.95e-106 324 45 7 417 2 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Bos taurus
Q9C9P4 1.25e-105 325 45 5 413 1 KAS2 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic Arabidopsis thaliana
P39525 1.07e-101 312 40 7 442 1 CEM1 3-oxoacyl-[acyl-carrier-protein] synthase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43710 1.14e-87 275 40 10 414 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQD9 3.26e-87 274 41 6 393 1 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD8 3.26e-87 274 41 6 393 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8ESN0 3.26e-87 274 41 6 393 2 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P63455 3.26e-87 274 41 6 393 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q05356 1.51e-86 272 37 7 419 3 sch1 Putative polyketide beta-ketoacyl synthase 1 Streptomyces halstedii
P16540 1.08e-83 265 36 5 417 3 gra-orf1 Granaticin polyketide putative beta-ketoacyl synthase 1 Streptomyces violaceoruber
P16538 1.73e-83 265 36 6 423 1 tcmK Tetracenomycin polyketide synthase ketoacyl synthase alpha subunit Streptomyces glaucescens
Q02578 2.09e-83 264 37 6 419 3 curA Putative polyketide beta-ketoacyl synthase 1 Streptomyces cyaneus
Q9CBS7 4.99e-83 263 39 6 393 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium leprae (strain TN)
P04684 4.32e-82 260 40 7 413 3 nodE Nodulation protein E Rhizobium leguminosarum bv. trifolii
P23155 1.13e-81 260 35 7 422 3 SCO5318 Putative polyketide beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P72331 2.28e-80 256 39 7 413 3 nodE Nodulation protein E Rhizobium sp. (strain N33)
Q02059 2.43e-79 255 36 6 421 1 SCO5087 Actinorhodin polyketide putative beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q02K94 1.62e-78 251 39 8 411 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
P9WQD7 3.5e-78 251 36 9 413 1 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD6 3.5e-78 251 36 9 413 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63457 3.5e-78 251 36 9 413 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P06230 2.55e-76 245 38 9 415 3 nodE Nodulation protein E Rhizobium meliloti (strain 1021)
O69473 1.05e-75 244 35 8 410 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium leprae (strain TN)
P06231 9.8e-75 241 38 9 414 3 nodE Nodulation protein E Rhizobium meliloti
P41175 1.64e-74 241 36 8 418 3 None Putative polyketide beta-ketoacyl synthase 1 Streptomyces virginiae
P04683 2.47e-74 240 38 7 413 3 nodE Nodulation protein E Rhizobium leguminosarum bv. viciae
Q89AY4 5.72e-74 239 36 9 419 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P0A953 8e-72 234 37 12 417 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli (strain K12)
P0A954 8e-72 234 37 12 417 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P57193 5.2e-69 226 36 12 419 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P43678 7.76e-68 224 35 8 420 3 None Oxytetracycline polyketide putative beta-ketoacyl synthase 1 Streptomyces rimosus
Q8KA28 1.91e-56 194 33 8 419 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P16539 8.07e-47 168 30 7 409 1 tcmL Tetracenomycin polyketide synthase ketoacyl synthase beta subunit Streptomyces glaucescens
I6X8D2 9.98e-39 152 27 6 421 1 pks13 Polyketide synthase Pks13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q02062 4.22e-38 145 28 9 412 1 SCO5088 Actinorhodin polyketide putative beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P40804 4.1e-34 134 29 9 357 1 pksF Polyketide biosynthesis malonyl-ACP decarboxylase PksF Bacillus subtilis (strain 168)
A0A0Y0M151 1.14e-31 131 28 8 368 1 cla2 Highly reducing polyketide synthase cla2 Cladosporium cladosporioides
A0A0B5KU17 1.73e-31 130 27 13 431 1 mpaC' Non-reducing polyketide synthase mapC' Penicillium brevicompactum
F1DBA9 1.83e-31 130 27 12 430 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
Q5KTM9 3.22e-31 130 28 5 375 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
Q7TXM0 1.29e-30 128 26 10 438 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE7 1.66e-30 127 26 10 438 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0U5GFS8 1.73e-30 127 26 14 438 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
P9WQE6 1.91e-30 127 26 10 438 3 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q02251 5.01e-30 126 27 11 428 1 mas Mycocerosic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5ATJ7 6.43e-30 126 25 10 433 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
I6XD69 1.63e-29 125 27 8 382 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 3.88e-26 115 25 12 448 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P41176 1.91e-29 121 27 9 410 3 None Putative polyketide beta-ketoacyl synthase 2 Streptomyces virginiae
Q869W9 1.99e-29 124 26 10 388 2 pks16 Probable polyketide synthase 16 Dictyostelium discoideum
Q5ATG8 2.15e-29 124 26 9 379 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q7TXL9 2.25e-29 124 27 13 438 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE5 2.38e-29 124 27 13 438 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE4 2.38e-29 124 27 13 438 3 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q84HC6 2.85e-29 124 27 12 416 1 ncsB Neocarzinostatin naphthoate synthase Streptomyces carzinostaticus
Q55E72 2.93e-29 124 25 10 457 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q9ZGI4 4.58e-29 124 26 9 375 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 1.29e-28 122 25 13 443 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI5 7.84e-29 123 25 7 378 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 2.02e-28 122 27 7 370 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 8.5e-25 110 25 13 443 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q0C8A4 8.33e-29 122 25 11 433 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q869X2 1.47e-28 122 26 11 388 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
P16541 2.33e-28 118 27 8 392 3 gra-orf2 Granaticin polyketide putative beta-ketoacyl synthase 2 Streptomyces violaceoruber
A0A1L7U4V5 4.73e-28 120 26 7 389 2 FMN1 Reducing polyketide synthase 8 Fusarium mangiferae
Q2UB00 7.72e-28 120 26 11 449 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q02579 1.07e-27 117 28 11 415 3 curB Putative polyketide beta-ketoacyl synthase 2 Streptomyces cyaneus
A0A097ZPE0 1.08e-27 119 24 12 434 1 andM Non-reducing polyketide synthase andM Emericella variicolor
P96202 1.68e-27 119 25 11 450 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXL8 1.68e-27 119 25 11 450 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A0A0RM07 1.97e-27 119 26 10 389 1 MLNS Mellein synthase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A0R8YWJ7 2.95e-27 118 24 11 426 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
P0CU67 3.22e-27 118 23 13 444 1 claG Atrochrysone carboxylic acid synthase Passalora fulva
P9WET6 3.23e-27 118 26 14 432 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
P96284 3.6e-27 116 26 13 439 1 pks15 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0F7U103 6.1e-27 117 26 12 434 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
G3Y419 6.14e-27 117 28 4 335 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
P23156 1e-26 114 27 9 413 3 SCO5317 Putative polyketide beta-ketoacyl synthase 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
G0REX6 1.24e-26 116 31 6 288 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
A0A1E1FFN8 1.42e-26 116 25 11 434 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
Q7TXK8 1.54e-26 116 26 13 439 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2T4N1 1.71e-26 116 25 9 384 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 1.75e-19 95 26 15 444 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 1.6e-18 92 23 12 439 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 2.68e-17 88 24 13 457 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A0A455R5P9 3.32e-26 115 26 13 434 1 ascC Non-reducing polyketide synthase ascC Acremonium egyptiacum
A0A411L027 4.05e-26 115 26 8 387 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
W6QL47 4.84e-26 114 28 10 368 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
Q05470 5.4e-26 114 25 11 422 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 2.57e-16 85 23 12 453 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 7e-16 84 22 10 446 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 7.68e-15 80 23 9 387 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q5BG07 5.71e-26 114 23 12 435 1 pkdA Non-reducing polyketide synthase pkdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUX7 5.97e-26 114 25 12 431 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A482N9V7 6.03e-26 114 29 5 282 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
M3A326 6.23e-26 114 24 14 454 2 PKS8-1 Non-reducing polyketide synthase PKS8-1 Pseudocercospora fijiensis (strain CIRAD86)
C8VJR7 7.88e-26 114 26 6 364 1 alnA Highly reducing polyketide synthase alnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0DO30 9.56e-26 114 25 6 385 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
Q54FI3 9.98e-26 114 25 6 367 1 StlB Polyketide synthase 37 Dictyostelium discoideum
A0A2I1BSV9 1.21e-25 113 24 11 435 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
Q54T36 1.33e-25 113 22 12 453 3 pks19 Probable polyketide synthase 19 Dictyostelium discoideum
M1WG96 1.52e-25 113 24 14 445 2 CPUR_05437 Non-reducing polyketide synthase CPUR_05437 Claviceps purpurea (strain 20.1)
S7Z800 1.86e-25 113 25 8 375 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A098D8A0 1.99e-25 112 27 8 368 2 ZEA2 Highly reducing polyketide synthase ZEA2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A089QRB9 2.02e-25 112 24 5 377 1 msl3 Mycolipanoate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9ZGI2 2.12e-25 112 24 13 436 1 pikAIV Narbonolide/10-deoxymethynolide synthase PikA4, module 6 Streptomyces venezuelae
A0A067XNI2 2.35e-25 112 25 11 396 2 ptaA Non-reducing polyketide synthase ptaA Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
B0G138 2.51e-25 112 22 11 454 3 pks21 Probable polyketide synthase 21 Dictyostelium discoideum
P9WQE3 2.58e-25 112 26 14 444 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit D Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE2 2.58e-25 112 26 14 444 3 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B6QK76 2.65e-25 112 22 7 436 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN5 2.65e-25 112 22 7 436 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
Q7TXL7 3.15e-25 112 26 14 444 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A193PS74 3.27e-25 112 26 14 438 1 stbA Non-reducing polyketide synthase stbA Stachybotrys bisbyi
B3FWU0 3.66e-25 112 26 10 376 1 rdc5 Reducing polyketide synthase rdc5 Metacordyceps chlamydosporia
A0A0S2CHA9 4.01e-25 112 23 9 433 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
G4MVZ2 4.03e-25 112 25 10 404 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
B6HV32 4.19e-25 112 25 14 435 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B1GVX7 4.67e-25 111 26 9 394 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
Q86JI5 4.73e-25 111 25 12 441 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
O31782 4.77e-25 111 26 13 450 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 5.41e-23 105 25 11 457 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 1.11e-20 98 27 15 440 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
Q07017 5.15e-25 111 25 7 393 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 1.53e-24 110 25 11 430 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
B6HNK3 5.2e-25 111 28 3 277 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A6F9DYX9 5.31e-25 111 24 13 446 1 men2 Non-reducing polyketide synthase men2 Menisporopsis theobromae
A0A0U5GK88 6.41e-25 111 25 7 380 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
Q5B7U4 6.52e-25 111 24 11 433 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A5C1RD96 8.35e-25 110 24 11 432 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
A0A7L9EYL1 8.97e-25 110 27 10 379 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
A0A0B4I1J8 9.56e-25 110 26 9 378 2 Pks2 Polyketide synthase 2 Metarhizium majus (strain ARSEF 297)
D7PHZ2 9.7e-25 110 25 12 443 1 vrtA Non-reducing polyketide synthase vrtA Penicillium aethiopicum
Q03131 1.13e-24 110 26 12 439 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 1.38e-22 104 27 9 384 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
A0A3T0QHT6 1.22e-24 110 25 13 452 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
B8NYX0 1.27e-24 110 28 9 380 2 fluP Cluster 41 polyketide synthase Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q9ZGI3 1.32e-24 110 24 7 372 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
B6F209 1.34e-24 110 25 9 398 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
A0A2P1DP91 1.5e-24 110 26 5 372 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
A0A1B3PEI6 1.98e-24 109 26 12 416 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
J4UHQ6 2.26e-24 109 23 12 437 1 OpS1 Orsellinic acid synthase Beauveria bassiana (strain ARSEF 2860)
A2QTE9 2.42e-24 109 24 11 433 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
B6HN77 2.45e-24 109 24 7 385 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A167LUQ4 3.14e-24 109 27 8 347 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
D4AU31 3.25e-24 109 26 6 376 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
A0R1E8 3.62e-24 108 24 9 424 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q05357 3.97e-24 106 28 9 415 3 sch2 Putative polyketide beta-ketoacyl synthase 2 Streptomyces halstedii
P40806 4.28e-24 108 25 7 414 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 1.82e-19 95 25 11 435 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 3.63e-18 90 24 9 396 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
B8MV59 4.68e-24 108 24 13 441 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
Q4WA61 4.75e-24 108 23 12 447 3 nscA Non-reducing polyketide synthase nscA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
G3XMC4 4.78e-24 108 24 11 433 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q5SBL6 5.01e-24 108 26 10 400 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
B8MYS6 5.29e-24 108 23 12 446 1 pks27 Non-reducing polyketide synthase pks27 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q0CJ59 5.41e-24 108 27 10 384 1 atX 6-methylsalicylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A1Y0BRF1 5.61e-24 108 24 11 437 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
Q03133 7.2e-24 108 25 10 410 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 4.36e-14 78 23 8 391 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
E9F8M3 7.66e-24 108 26 9 398 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
G0R6S9 8.24e-24 108 24 6 377 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
A0A5C1RDA3 8.8e-24 107 25 8 411 3 orf7 Highly reducing polyketide synthase Didymella fabae
A0A1L7U3D7 9.29e-24 107 30 7 289 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
A0A0B4FLB2 9.52e-24 107 25 8 378 2 Pks2 Polyketide synthase 2 Metarhizium anisopliae (strain ARSEF 549)
Q54KU3 1.16e-23 107 24 12 442 3 pks25 Probable polyketide synthase 25 Dictyostelium discoideum
D7PI15 1.22e-23 107 24 12 445 1 gsfA Non-reducing polyketide synthase gsfA Penicillium aethiopicum
P9WET9 1.23e-23 107 23 12 449 1 PvBS090_009107 Non-reducing polyketide synthase PvBS090_009107 Byssochlamys spectabilis
E9ET39 1.28e-23 107 25 8 378 2 Pks2 Polyketide synthase 2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A0B4I1L1 1.81e-23 107 26 7 320 2 Pks2 Polyketide synthase 2 Metarhizium guizhouense (strain ARSEF 977)
A0A481WNP4 1.87e-23 107 27 8 374 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
Q4WQZ5 2.14e-23 106 23 12 399 2 tpcC Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A6J4B487 2.21e-23 106 22 8 431 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
A5PHD6 3.19e-23 106 22 9 437 1 aspks1 3-methylorcinaldehyde synthase Sarocladium schorii
S3D9F1 3.49e-23 106 24 9 436 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
A0A481WQB6 3.5e-23 106 24 11 443 1 claF Clavatol synthase claF Penicillium crustosum
Q4WZA8 3.6e-23 105 23 14 448 1 alb1 Conidial pigment polyketide synthase alb1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0CRQ5 3.91e-23 105 25 13 428 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
C5FM57 4.22e-23 105 24 13 447 3 nscA Non-reducing polyketide synthase nscA Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
M2XHZ5 4.96e-23 105 25 14 438 2 pksA Norsolorinic acid synthase Dothistroma septosporum (strain NZE10 / CBS 128990)
Q30DW5 4.96e-23 105 25 14 438 2 pksA Norsolorinic acid synthase Dothistroma septosporum
A0JJU1 5.13e-23 105 24 7 394 1 tenS Tenellin synthetase Beauveria bassiana
A1D8I9 5.66e-23 105 23 12 447 3 nscA Non-reducing polyketide synthase nscA Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P12276 6.1e-23 105 25 12 425 1 FASN Fatty acid synthase Gallus gallus
J4KMC1 6.16e-23 105 24 7 401 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
A2QUI2 6.72e-23 105 24 9 376 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A284RE13 7.6e-23 105 25 12 441 1 armB Orsellinic acid synthase ArmB Armillaria ostoyae
B2HIL7 8.49e-23 105 24 13 443 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q2ABP6 9.76e-23 104 26 8 366 1 pksF Reducing polyketide synthase pksF Alternaria solani
M2YKT6 9.77e-23 104 26 11 393 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
A0A2I2F262 9.82e-23 104 26 8 382 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
E5A7D9 9.95e-23 104 24 7 406 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
G3XLL5 1.02e-22 104 24 9 376 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
P9WEZ4 1.18e-22 104 26 6 368 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
S0DZM7 1.24e-22 104 22 11 447 1 bik1 Bikaverin polyketide synthase bik1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EEY3 1.25e-22 104 23 9 435 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
E4V2N2 1.32e-22 104 24 14 448 3 nscA Non-reducing polyketide synthase nscA Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893)
O53901 1.46e-22 104 25 10 428 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B0G100 1.53e-22 104 24 10 441 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
A1CLY8 1.58e-22 104 28 6 302 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A0A1B4XBH3 1.62e-22 103 29 5 283 3 sdnO Highly reducing polyketide synthase sdnO Sordaria araneosa
A0A1L9UCG2 1.66e-22 103 25 10 376 3 albA Non-reducing polyketide synthase albA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
E9F646 1.68e-22 103 24 12 450 1 Pks1 Polyketide synthase 1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A161CEU9 1.86e-22 103 24 10 440 1 citS Citrinin polyketide synthase Monascus ruber
Q65Z23 1.86e-22 103 24 10 440 1 pksCT Citrinin polyketide synthase Monascus purpureus
Q03132 2.37e-22 103 25 9 422 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q03132 2.09e-21 100 23 9 415 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
P9WET5 2.51e-22 103 23 15 446 1 Preu4 Non-reducing polyketide synthase Preu4 Preussia isomera
B0G101 2.74e-22 103 24 11 446 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
W7MLD7 3.09e-22 103 24 11 437 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A084API3 3.48e-22 103 24 11 424 3 SAT13 Highly reducing polyketide synthase SAT13 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
Q0CF73 3.68e-22 103 23 6 366 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A2Z5XAL7 3.68e-22 103 28 6 290 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
A0A2H3CTK0 3.7e-22 103 24 12 441 1 armB Orsellinic acid synthase armB Armillaria gallica
A0A0K0MCJ4 4.11e-22 102 24 9 382 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A0B4H8J1 4.27e-22 102 24 8 378 2 Pks2 Polyketide synthase 2 Metarhizium brunneum (strain ARSEF 3297)
Q0D1N9 4.52e-22 102 23 12 396 1 terA Non-reducing polyketide synthase terA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B8M9J9 5.05e-22 102 23 10 424 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
Q55DM7 5.22e-22 102 23 11 439 3 pks2 Probable polyketide synthase 2 Dictyostelium discoideum
Q5BEJ6 5.32e-22 102 23 6 366 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A8F4SKJ7 5.59e-22 102 24 9 434 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
K2QVI8 5.8e-22 102 24 8 366 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
B0G103 5.9e-22 102 22 10 452 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
I3ZNU9 6.12e-22 102 24 12 441 1 armB Orsellinic acid synthase armB Armillaria mellea
A0A7L8UVC9 6.32e-22 102 25 11 400 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
A0A0B4ESU9 6.68e-22 102 23 12 450 1 Pks1 Polyketide synthase 1 Metarhizium brunneum (strain ARSEF 3297)
A0A0B4FTU6 7.8e-22 102 23 12 450 1 Pks1 Polyketide synthase 1 Metarhizium anisopliae (strain ARSEF 549)
D9N1A1 8.48e-22 102 25 8 372 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
F2PWS5 9.73e-22 101 23 13 447 3 nscA Non-reducing polyketide synthase nscA Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
P9WQE9 1.01e-21 101 25 9 428 1 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE8 1.01e-21 101 25 9 428 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9F4 1.01e-21 101 25 9 428 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q7TVK8 1.01e-21 101 25 9 428 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9Y7D5 1.02e-21 101 23 5 367 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
A0A0B4G9F9 1.08e-21 101 23 12 450 1 Pks1 Polyketide synthase 1 Metarhizium guizhouense (strain ARSEF 977)
B8N8R0 1.12e-21 101 24 8 374 2 afvB Non-reducing polyketide synthase afvB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A8D5M692 1.14e-21 101 25 11 425 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
Q4W944 1.15e-21 101 23 8 369 1 encA Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
F2S6Z9 1.15e-21 101 23 13 447 3 nscA Non-reducing polyketide synthase nscA Trichophyton tonsurans (strain CBS 112818)
Q12053 1.15e-21 101 25 12 432 1 aflC Norsolorinic acid synthase Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
A1KQG0 1.24e-21 101 25 9 428 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A0A0E4AZP0 1.33e-21 101 28 7 289 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
B8NJG3 1.35e-21 101 24 9 400 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
P9WEX0 1.36e-21 101 25 11 421 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
A0A1W5T1T1 1.46e-21 101 23 12 401 2 poxF Highly reducing polyketide synthase poxF Penicillium oxalicum
W7MT31 1.55e-21 101 25 6 366 1 FUB1 Reducing polyketide synthase FUB1 Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A2I2F2N6 1.57e-21 101 28 7 285 1 cfoA Chalcone synthase cfoA Aspergillus candidus
Q86AE3 1.63e-21 101 24 10 445 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
Q4WLD4 1.68e-21 100 26 8 396 1 pyr2 Non-reducing polyketide synthase pyr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9R9J1 1.69e-21 101 24 11 381 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q0CCY3 1.95e-21 100 22 12 457 1 gedC Atrochrysone carboxylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B8MV60 1.95e-21 100 24 13 445 3 tpeB Non-reducing polyketide synthase tpeB Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A6F9DXA0 2.02e-21 100 23 13 446 1 men1 Partially reducing polyketide synthase men1 Menisporopsis theobromae
A5ABG0 2.12e-21 100 25 11 434 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
D4AWH3 2.43e-21 100 23 13 447 3 nscA Non-reducing polyketide synthase nscA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
A0A411PQP9 2.62e-21 100 23 14 453 3 Agnpks1 Atrochrysone carboxylic acid synthase Agnpks1 Paecilomyces divaricatus
D4CZZ2 2.62e-21 100 23 13 447 3 nscA Non-reducing polyketide synthase nscA Trichophyton verrucosum (strain HKI 0517)
S4W172 2.79e-21 100 28 7 289 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
A0A0B4H4F0 2.83e-21 100 22 10 450 1 Pks1 Polyketide synthase 1 Metarhizium majus (strain ARSEF 297)
A0A8F4S6Z6 2.94e-21 100 25 9 378 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
A0A1L9WQM9 3.01e-21 100 22 8 440 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A0D2YG10 3.04e-21 100 25 6 366 1 FUB1 Reducing polyketide synthase FUB1 Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936)
Q54TW0 3.33e-21 100 22 12 453 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
Q2HBN0 3.39e-21 100 25 8 384 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A2Z5TM64 3.54e-21 100 25 11 401 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
A0A067MTM1 3.63e-21 100 23 11 431 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
Q71SP7 4.2e-21 99 25 14 425 1 FASN Fatty acid synthase Bos taurus
A0A455LXK0 4.69e-21 99 25 6 325 2 ntnG Non-reducing polyketide synthase ntnG Nectria sp.
Q50LG3 5.11e-21 99 27 6 279 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
W3X8X8 5.24e-21 99 26 7 288 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A0A2L0P0K3 5.29e-21 99 29 6 285 1 TwmB Polyketide synthase-nonribosomal peptide synthetase TwmB Talaromyces wortmannii
Q54IX3 5.53e-21 99 25 11 349 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
A1CFL8 6.05e-21 99 25 7 368 1 patK 6-methylcalicylic acide synthase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
G2Q9A5 6.41e-21 99 26 7 308 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
A0A0H4ADX3 6.66e-21 99 23 13 447 2 None Non-reducing polyketide synthase PKS19 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
F2T0M0 7.06e-21 99 25 9 373 3 nscA Non-reducing polyketide synthase nscA Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
A0A2U8NEV6 7.16e-21 99 24 8 379 1 Pks1 Polyketide synthase 1 Metarhizium acridum (strain CQMa 102)
Q0D159 7.47e-21 99 26 11 399 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P40872 8.39e-21 99 22 9 411 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 1.34e-19 95 25 16 454 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 2.38e-16 85 22 13 446 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
G0R6S8 8.42e-21 99 24 6 363 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
Q4WKW9 9.2e-21 98 24 10 439 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P9WET1 1.02e-20 98 24 11 399 1 Preu7 Non-reducing polyketide synthase Preu7 Preussia isomera
B0G0Z9 1.24e-20 98 22 10 449 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
P49327 1.36e-20 98 25 14 427 1 FASN Fatty acid synthase Homo sapiens
A0A0N7D4P6 1.4e-20 98 26 8 365 2 Dhc3 Highly reducing polyketide synthase Dhc3 Alternaria cinerariae
Q7TXL6 1.42e-20 98 28 6 284 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE1 1.46e-20 98 28 6 284 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE0 1.46e-20 98 28 6 284 3 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A4P8GHJ1 1.6e-20 98 23 10 439 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
Q54KU5 1.97e-20 97 24 12 447 3 pks24 Probable polyketide synthase 24 Dictyostelium discoideum
A0A1V6NYI6 2e-20 97 27 11 398 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
Q3S2T9 2.18e-20 97 24 14 455 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
Q03149 2.54e-20 97 25 11 364 1 wA Conidial yellow pigment biosynthesis polyketide synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
E9F5E7 2.71e-20 97 25 9 370 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A1B5L6A0 2.72e-20 97 22 10 447 1 UVI_02036160 Non-reducing polyketide synthase ustP Ustilaginoidea virens
Q558Y6 2.75e-20 97 23 12 452 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
A0A3T0ZHJ0 3.17e-20 97 25 9 421 1 cle1 Triacetic acid lactone synthase cle1 Aspergillus versicolor
B6QK81 3.51e-20 97 24 13 440 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN6 3.51e-20 97 24 13 440 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei
P9WEX6 3.66e-20 97 26 10 370 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
Q0C8M3 3.93e-20 97 24 13 455 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9Y8A5 4e-20 97 24 13 455 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
A0A142C799 4.31e-20 96 24 7 339 1 phnA Non-reducing polyketide synthase phnA Penicillium herquei
P0CU84 4.59e-20 96 26 9 370 1 apmlA Highly reducing polyketide synthase apmlA Arthrinium phaeospermum
A0A4P8DJV2 4.83e-20 96 24 8 389 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
S0DRI1 5.54e-20 96 25 6 366 1 FUB1 Reducing polyketide synthase FUB1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A075TRC0 5.56e-20 96 25 8 370 1 patK 6-methylsalicylic acid synthase Penicillium expansum
A0A455M7S4 5.68e-20 96 25 9 375 1 atnG Non-reducing polyketide synthase atnG Arthrinium sp.
A0A2I1C3X5 6.27e-20 96 24 7 326 1 nsrB Atrochrysone carboxylic acid synthase nsrB Aspergillus novofumigatus (strain IBT 16806)
A0A1U8QN18 6.5e-20 96 24 8 399 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A3G9GQ29 7.02e-20 96 28 8 286 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
A0A1P8NTI3 7.47e-20 95 23 10 413 2 pks8 Non-reducing polyketide synthase 8 Pestalotiopsis microspora
A0A8F4S8Q3 8.33e-20 95 23 14 451 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
A2QX22 8.38e-20 95 23 14 450 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
L7X8J4 8.48e-20 95 26 10 367 1 curS1 Highly reducing polyketide synthase curS1 Aspergillus terreus
A0A7R7ZK98 8.52e-20 95 22 14 450 3 AcPKS Atrochrysone carboxylic acid synthase Aspergillus chevalieri
Q2HEW5 8.59e-20 95 30 8 293 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
G3KLH6 9.52e-20 95 23 14 450 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger
B6H999 9.67e-20 95 27 8 290 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q12397 9.87e-20 95 25 10 383 2 stcA Norsolorinic acid synthase stcA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
F9XMW3 1.26e-19 95 21 10 443 3 PKS1 Non-reducing polyketide synthase PKS1 Zymoseptoria tritici (strain CBS 115943 / IPO323)
S0EET5 1.32e-19 95 25 11 408 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q0C9L7 1.34e-19 95 27 6 292 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B3FWT3 1.37e-19 95 26 10 372 1 hpm8 Reducing polyketide synthase hmp8 Hypomyces subiculosus
Q5B0D0 1.41e-19 95 24 13 452 1 aptA Non-reducing polyketide synthase aptA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q559A9 1.44e-19 95 22 11 444 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
E9EHG2 1.48e-19 95 24 8 378 2 Pks2 Polyketide synthase 2 Metarhizium acridum (strain CQMa 102)
P0DUT7 1.59e-19 95 24 9 374 1 Ba17a Highly reducing polyketide synthase 17 Metarhizium anisopliae
G9N4B2 1.61e-19 95 26 5 281 1 virA Highly reducing polyketide synthase virA Hypocrea virens (strain Gv29-8 / FGSC 10586)
P12785 1.99e-19 94 24 13 425 1 Fasn Fatty acid synthase Rattus norvegicus
B8MKY6 2.08e-19 94 28 6 281 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
P19096 2.17e-19 94 24 13 425 1 Fasn Fatty acid synthase Mus musculus
P9WES9 2.45e-19 94 24 13 441 1 PFUR17_0229 Non-reducing polyketide synthase PFUR17_0229 Pseudevernia furfuracea
A0A9P5GG56 2.46e-19 94 27 8 290 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
Q8J0F7 2.67e-19 94 23 13 456 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
Q0CZH1 2.7e-19 93 25 6 340 2 pytA Hybrid PKS-NRPS synthetase pytA (Fragment) Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A6H0YV38 2.96e-19 94 23 13 441 2 crz7 Non-reducing polyketide synthase crz7 Cladonia metacorallifera
A0A084B9Z6 3.06e-19 94 22 6 370 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
A0A0G0AID6 3.31e-19 94 25 8 378 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A0C6E0I7 3.51e-19 94 27 7 293 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
Q54FQ2 3.63e-19 94 24 11 442 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
Q4WAZ9 3.69e-19 94 25 8 365 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A4P8WAE5 3.76e-19 94 25 11 396 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
V5Y0F7 3.88e-19 94 25 12 401 3 AFT16-1 Reducing polyketide synthase AFT16-1 Alternaria alternata
P9WET8 4.07e-19 94 22 8 436 2 Preu1 Highly reducing polyketide synthase Preu1 Preussia isomera
N4WHE3 4.37e-19 93 24 10 391 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
A0A4P8DJU2 4.82e-19 93 23 15 460 3 dmx-nrPKS Atrochrysone carboxylic acid synthase Cryptosporiopsis sp. (strain 8999)
Q54FN7 5.14e-19 93 24 12 447 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
Q3S2U6 5.25e-19 93 24 9 365 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
A0A0M4L8I7 6.45e-19 93 26 12 385 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
Q5BH30 7.14e-19 92 21 13 448 3 mdpG Atrochrysone carboxylic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
I1RLA7 7.89e-19 92 24 9 394 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6DQW3 8.77e-19 92 22 9 381 1 CTB1 Non-reducing polyketide synthase CTB1 Cercospora nicotianae
W7LKX1 8.81e-19 92 26 7 284 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A2G5IC96 9.18e-19 92 22 9 381 3 CTB1 Non-reducing polyketide synthase CTB1 Cercospora beticola
A0A6F8RNP4 9.42e-19 92 24 10 396 1 grgA Reducing polyketide synthase grgA Penicillium sp.
I1RF58 1.08e-18 92 25 8 324 1 PKS12 Non-reducing polyketide synthase PKS12 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q0UI00 1.14e-18 92 23 8 382 1 elcA Non-reducing polyketide synthase elcA (Fragment) Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q5B8A0 1.17e-18 92 23 9 381 1 pkfA Non-reducing polyketide synthase pkfA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A443HK81 1.19e-18 92 22 10 394 1 VdtA Non-reducing polyketide synthase VdtA Byssochlamys spectabilis
A0A0N9HNS9 1.21e-18 92 22 13 441 3 desS Desertorin synthase Aspergillus desertorum
Q5BBP8 1.23e-18 92 24 10 380 1 pkhA Non-reducing polyketide synthase pkhA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C5H885 1.35e-18 92 25 10 373 3 rads1 Reducing polyketide synthase rads1 Floropilus chiversii
A0A0A2KT65 1.44e-18 92 22 10 407 2 melA Conidial yellow pigment biosynthesis polyketide synthase melA Penicillium expansum
A0A1L9WLD9 1.65e-18 92 23 15 451 1 AacuL Atrochrysone carboxylic acid synthase AacuL Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A348HAX6 1.69e-18 92 27 6 281 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
K3VA96 1.7e-18 92 23 14 445 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
Q54B51 2.12e-18 91 22 14 447 3 pks44 Probable polyketide synthase 44 Dictyostelium discoideum
A0A0S6XH49 2.2e-18 91 27 6 278 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
K2QYX5 2.27e-18 91 24 10 404 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
S7ZFK6 2.45e-18 91 24 8 393 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A3G9H990 2.47e-18 91 26 7 283 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
Q5AUX1 2.51e-18 91 24 9 381 1 orsA Orsellinic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A2U8NET4 2.61e-18 91 23 10 393 1 Pks1 Polyketide synthase 1 Metarhizium album (strain ARSEF 1941)
Q7SHI6 2.75e-18 91 23 8 376 2 srdA Highly reducing polyketide synthase srdA Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A0A411KUP8 2.8e-18 91 25 8 374 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
A0A1W5T1U1 2.91e-18 91 24 8 393 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
Q5AZ32 2.92e-18 91 24 10 359 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1L9WN37 2.94e-18 91 25 6 366 1 acuA 6-methylsalicylic acid synthase acuA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
Q54FQ3 3.37e-18 90 24 11 447 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
Q54FC8 3.96e-18 90 24 12 445 3 pks39 Probable polyketide synthase 39 Dictyostelium discoideum
A0A089FSA4 4.32e-18 90 26 8 301 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
Q54FD2 4.84e-18 90 24 12 445 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
A7UMW1 4.97e-18 90 21 11 443 2 PKS1 Non-reducing polyketide synthase 1 Elsinoe fawcettii
E5AE40 5.46e-18 90 25 14 449 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
A0A6S5ZY48 6.35e-18 90 24 9 362 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
S0DS59 6.35e-18 90 26 6 290 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q5W262 7.2e-18 89 26 8 275 1 pigJ Beta-ketoacyl synthase PigJ Serratia sp. (strain ATCC 39006)
Q54B49 8.01e-18 89 22 11 439 3 pks45 Probable polyketide synthase 45 Dictyostelium discoideum
B3FWS8 8.31e-18 89 22 12 441 1 hpm3 Non-reducing polyketide synthase hmp3 Hypomyces subiculosus
B0G170 9.11e-18 89 24 7 344 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
Q55CN6 9.76e-18 89 25 8 284 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
Q54FN2 9.85e-18 89 24 11 444 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
G1XU04 1.24e-17 89 24 7 369 1 AOL_s00215g283 6-methylsalicylic acid synthase AOL_s00215g283 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
Q54QD3 1.27e-17 89 23 13 439 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
P9WET2 1.38e-17 89 25 14 440 1 Preu6 Non-reducing polyketide synthase Preu6 Preussia isomera
Q0CF75 1.93e-17 88 25 6 290 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
R4WH05 2.07e-17 88 23 10 418 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
G3JUI8 2.41e-17 88 24 8 378 1 milA Highly reducing polyketide synthase milA Cordyceps militaris (strain CM01)
P9WET3 3.18e-17 87 22 11 444 1 Preu8 Non-reducing polyketide synthase Preu8 Preussia isomera
Q54FQ1 3.23e-17 87 23 11 445 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
G3XNF4 3.27e-17 87 24 11 431 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
I1S166 3.48e-17 87 23 11 454 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1V6PAF7 3.65e-17 87 30 8 290 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
Q0C8L6 4.81e-17 87 26 6 286 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
N4WHA7 6.76e-17 87 25 7 282 3 PKS2 Reducing polyketide synthase PKS2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
P9WET4 7.3e-17 87 26 11 413 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
A0A1B3PEI8 7.82e-17 86 28 5 257 1 ORF-B Polyunsaturated fatty acid synthase subunit B Thraustochytrium sp. (strain ATCC 26185 / S-3)
Q5BBP5 7.92e-17 86 22 9 422 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P36189 9.22e-17 84 25 11 367 1 FASN Fatty acid synthase (Fragment) Anser anser anser
Q5BEJ4 9.82e-17 86 24 7 293 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54ED6 9.83e-17 86 23 9 397 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
D7UQ44 9.96e-17 86 25 10 377 1 sol1 Prosolanapyrone synthase Alternaria solani
Q54FP8 1.13e-16 86 25 14 448 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
Q8J0F5 1.6e-16 85 25 11 366 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
A0A0D1DNX1 1.61e-16 85 25 9 354 2 fas2 Fatty acid synthase 2 Ustilago maydis (strain 521 / FGSC 9021)
S0DTP6 1.68e-16 85 22 10 395 2 FSR1 Non-reducing polyketide synthase fsr1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q54G30 1.82e-16 85 24 8 348 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
O31784 1.96e-16 85 22 11 451 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 1.35e-14 79 22 14 458 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
Q54QD1 1.98e-16 85 23 13 439 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
P9WEV0 1.98e-16 85 25 8 368 3 valA Highly reducing polyketide synthase valA Aspergillus terreus
P9WEQ0 2.18e-16 85 24 9 410 3 olcA Non-reducing polyketide synthase olcA Penicillium canescens
B4XYB8 2.46e-16 85 25 8 360 1 aziB 5-methyl-1-naphthoate synthase Streptomyces sahachiroi
A0A1B7YCC9 2.57e-16 85 22 8 421 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
A0A179H0J7 2.73e-16 85 23 10 386 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
E9KMQ2 2.99e-16 85 23 13 443 2 PKS16 Non-reducing polyketide synthase PKS16 Cladonia grayi
Q558W4 3.18e-16 85 23 14 464 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
A0A384XH94 4e-16 84 26 5 370 1 stpks1 Highly reducing polyketide synthase stpks1 Strobilurus tenacellus
A2R6H1 4.32e-16 84 23 7 367 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A1R3RGK0 4.48e-16 84 25 6 281 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
I1RL11 4.55e-16 84 26 11 363 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P0DUK1 4.81e-16 84 21 12 431 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
B3FWT6 6.53e-16 84 22 13 446 1 rdc1 Non-reducing polyketide synthase rdc1 Metacordyceps chlamydosporia
A0A443HK66 7.06e-16 84 26 6 276 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
G3J9P0 7.1e-16 83 23 14 453 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Cordyceps militaris (strain CM01)
P22367 8.69e-16 83 25 8 370 1 None 6-methylsalicylic acid synthase Penicillium patulum
A0A481WR96 1.46e-15 82 24 11 372 3 claI Highly reducing polyketide synthase claI Penicillium crustosum
Q9HU15 1.47e-15 82 27 9 292 1 fabY Beta-ketoacyl-[acyl-carrier-protein] synthase FabY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q54ED7 1.63e-15 82 23 9 399 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
G4N296 1.88e-15 82 22 7 379 2 PKS19 Highly reducing polyketide synthase 19 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q4WAY3 2.27e-15 82 24 9 372 1 af370 Fumagillin dodecapentaenoate synthase af370 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A2V5GX43 2.77e-15 82 24 5 338 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
P9WES2 3.26e-15 81 23 3 308 1 None Atrochrysone carboxylic acid synthase PKS4 Calonarius odorifer
A0A068ABB7 4.51e-15 81 24 8 377 1 Bref-PKS Highly reducing polyketide synthase Eupenicillium brefeldianum
Q86ZD9 4.64e-15 81 22 8 367 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
A2QK66 4.7e-15 81 23 10 378 3 ktnS Kotanin synthase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
G3XMD1 4.71e-15 81 24 7 293 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
I1RVD8 5.84e-15 80 26 7 279 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P9WES1 7.82e-15 80 23 3 308 1 None Atrochrysone carboxylic acid synthase PKS1 Calonarius odorifer
S0EMV0 8.73e-15 80 24 12 418 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q2T4N2 1.62e-14 79 23 14 451 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 1.02e-13 77 29 9 276 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5BA83 1.67e-14 79 22 7 367 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
G3J453 1.91e-14 79 27 8 276 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
A0A0U4ZX08 1.98e-14 79 23 8 404 1 drtA Low-reducing polyketide synthase drtA Aspergillus calidoustus
A0A0A2JW91 5.09e-14 78 24 12 381 1 cnsI Highly reducing polyketide synthase cnsI Penicillium expansum
C5H882 7.11e-14 77 22 13 444 3 radS2 Non-reducing polyketide synthase rads2 Floropilus chiversii
Q5AXA9 8.47e-14 77 23 3 301 1 pkgA Non-reducing polyketide synthase pkgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1W7M1U5 1.14e-13 77 23 7 322 1 pgmA Non-reducing polyketide synthase pgmA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A0N7D745 1.75e-13 76 22 8 375 2 Dhc5 Non-reducing polyketide synthase Dhc5 Alternaria cinerariae
Q0UK48 2.12e-13 76 25 5 280 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A455LLX1 2.72e-13 75 24 8 285 1 atnH Highly reducing polyketide synthase atnH Arthrinium sp.
Q0CS88 2.76e-13 75 26 4 233 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
S7RK07 2.97e-13 75 24 12 376 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617)
A0A017SEX7 3.6e-13 75 24 3 278 1 fogA Highly reducing polyketide synthase fogA Aspergillus ruber (strain CBS 135680)
A0A3G1DJF3 4.9e-13 75 25 6 285 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
Q00681 5.06e-13 74 24 11 385 2 stcJ Fatty acid synthase alpha subunit stcJ Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A3G9K3K9 5.36e-13 74 23 12 434 1 hisps Hispidin synthase Neonothopanus nambi
A0A345BJN0 6.93e-13 74 26 6 278 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
Q0V6Q6 8.61e-13 74 27 7 266 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A179H2I8 9.09e-13 74 24 15 375 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
L7XAV2 9.7e-13 73 24 5 285 1 curS2 Non-reducing polyketide synthase curS2 Aspergillus terreus
D2E9X0 1.61e-12 73 25 8 290 2 DEP5 Reducing polyketide synthase DEP5 Alternaria brassicicola
W3X7U2 2.92e-12 72 22 6 322 2 PfmaE Conidial pigment polyketide synthase PfmaE Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
G4NEB1 5.06e-12 72 29 5 205 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q54D44 9.43e-12 70 21 8 378 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
G0LET7 1.47e-11 70 22 9 372 2 BOA9 Reducing polyketide synthase BOA9 Botryotinia fuckeliana (strain B05.10)
A0A125R003 1.5e-11 70 22 11 442 1 cla3 Non-reducing polyketide synthase cla3 Cladosporium cladosporioides
A0A0N0DCA3 3.06e-11 69 25 7 291 2 DEP5 Reducing polyketide synthase DEP5 Fusarium langsethiae
P9WET0 3.1e-11 69 28 6 207 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
A0A0F7GFS4 5.15e-11 68 21 9 407 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
A0A455M2Y3 8.48e-11 67 23 6 279 2 ntnH Highly reducing polyketide synthase ntnH Nectria sp.
A0A098D6U0 9.67e-11 67 21 10 391 1 ZEA1 Non-reducing polyketide synthase ZEA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A3G1DJH7 1.71e-10 67 21 8 367 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
W6QDA2 2.16e-10 66 26 5 209 1 anuA Highly reducing polyketide synthase anuA Penicillium roqueforti (strain FM164)
Q2T4P1 7.42e-10 65 21 13 446 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
G4N137 2.11e-09 63 23 13 401 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P9WET7 6.69e-09 62 27 7 219 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
Q0CSA2 1.73e-08 60 25 8 248 1 tazA Non-reducing polyketide synthase tazA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A345BJP0 1.75e-08 60 21 9 370 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
Q765N2 1.23e-07 57 34 2 123 3 FAS2 Fatty acid synthase subunit alpha Lachancea kluyveri
Q765N2 9.34e-05 48 23 5 230 3 FAS2 Fatty acid synthase subunit alpha Lachancea kluyveri
G8BAW7 1.24e-07 57 34 2 123 2 FAS2 Fatty acid synthase subunit alpha Candida parapsilosis (strain CDC 317 / ATCC MYA-4646)
G8BAW7 0.000511 46 22 5 225 2 FAS2 Fatty acid synthase subunit alpha Candida parapsilosis (strain CDC 317 / ATCC MYA-4646)
Q2TXF0 1.44e-07 57 33 2 133 3 oryfasA Fatty acid synthase subunit alpha Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P19097 1.53e-07 57 33 2 130 1 FAS2 Fatty acid synthase subunit alpha Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P19097 0.001 45 22 5 212 1 FAS2 Fatty acid synthase subunit alpha Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P78615 2.58e-07 57 33 2 130 3 fasA Fatty acid synthase subunit alpha Emericella nidulans
S5NIA2 3.56e-07 56 23 7 257 3 TOXH Fatty acid synthase subunit alpha Cochliobolus carbonum

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07500
Feature type CDS
Gene fabF
Product beta-ketoacyl-ACP synthase II
Location 1567779 - 1569023 (strand: -1)
Length 1245 (nucleotides) / 414 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_98
Orthogroup size 12
N. genomes 7

Actions

Genomic region

Domains

PF00109 Beta-ketoacyl synthase, N-terminal domain
PF02801 Beta-ketoacyl synthase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0304 Lipid transport and metabolism (I)
Secondary metabolites biosynthesis, transport and catabolism (Q)		 IQ 3-oxoacyl-(acyl-carrier-protein) synthase

Kegg Ortholog Annotation(s)

Protein Sequence

MSERRVVVTGLGMLSPVGNTVESSWDAVCAGQSGISLIEHFDTTNHATKFAGMVKDFNHEEFNISRKDARKMDLFIQYGVAAGIQAMTDSGIEVTEANATRIGAAIGSGIGGLGLIEENCNSLSHGGPRKVSPFFVPSTIINMVAGHLSIIYGLRGPSISIATACTSGVHNIGHAARIIAYGDADVMVAGGTEKASTPLGVAGFGAARALSTNNDNPQTASRPWDKDRDGFVLGDGAGMLVLEEYEHAKKRGAKIYAELVGFGMSSDAYHMTSPPENGEGAALAMANALQDAKLSADQIGYINAHGTSTSAGDVAEARAVEAVFGKGTSVLVSSTKSMTGHLLGAAGAVESIFTILSLRDQIVPPTINLDNQDDAVCKLDFVPGKARKVEGMEYVLCNSFGFGGTNGSLIFRKI

Flanking regions ( +/- flanking 50bp)

GACCGCCTATGTTATTTATTCCTTTTATTTTCCCTCCCTGGAGGATCAGCGTGTCTGAGCGTCGTGTAGTCGTGACCGGACTGGGCATGTTATCTCCTGTCGGTAATACAGTTGAATCATCATGGGATGCTGTGTGTGCCGGACAGAGTGGTATCAGCCTGATTGAACATTTTGACACCACAAACCATGCGACAAAGTTCGCCGGTATGGTGAAAGACTTCAATCACGAAGAATTCAATATTTCGCGCAAAGATGCACGGAAAATGGATCTCTTTATTCAATATGGTGTTGCTGCCGGTATTCAGGCAATGACCGACTCCGGAATTGAAGTAACAGAAGCCAATGCAACGCGTATCGGTGCTGCGATTGGTTCTGGTATTGGTGGGCTCGGACTGATTGAAGAAAACTGCAATTCTCTTAGTCATGGCGGACCGCGTAAAGTCAGTCCGTTTTTTGTGCCGTCGACGATTATTAATATGGTCGCAGGCCATCTGAGCATTATCTACGGTCTGCGTGGCCCGAGTATCTCGATTGCCACAGCCTGTACGTCCGGTGTTCATAATATCGGTCATGCGGCGCGGATTATCGCGTACGGTGATGCGGATGTGATGGTTGCAGGCGGAACTGAAAAAGCCAGCACACCATTAGGTGTTGCAGGATTTGGTGCTGCCCGTGCATTATCCACCAATAATGACAATCCGCAGACGGCAAGCCGTCCGTGGGATAAAGATCGCGACGGGTTCGTGCTGGGTGACGGTGCCGGAATGTTGGTGCTGGAAGAGTATGAGCACGCGAAAAAACGCGGTGCAAAAATTTATGCGGAACTGGTTGGTTTCGGGATGAGCAGCGATGCTTATCACATGACATCGCCGCCGGAAAATGGTGAAGGTGCTGCGCTGGCGATGGCTAACGCGTTGCAGGATGCGAAATTGTCCGCAGACCAGATTGGCTATATTAACGCACACGGCACATCAACCTCAGCGGGTGATGTGGCGGAAGCCCGCGCCGTTGAAGCGGTATTTGGCAAAGGAACATCTGTTCTGGTCAGCTCCACCAAATCCATGACCGGGCATTTACTGGGTGCGGCAGGTGCGGTTGAGTCGATTTTTACGATTCTTTCCCTGCGTGACCAGATTGTTCCGCCGACCATCAACCTGGATAATCAGGATGATGCAGTCTGCAAACTCGACTTTGTACCGGGTAAAGCCCGCAAAGTGGAAGGTATGGAATATGTACTCTGTAATTCTTTCGGTTTCGGCGGCACCAACGGTTCCCTGATTTTCCGTAAAATTTAAGATATTCCGTCAGGAAAAAGCGCCGGTGGCGCTTTTTTTTTGCCTGTCTC