Homologs in group_1950

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14640 FBDBKF_14640 84.1 Morganella morganii S1 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
EHELCC_15445 EHELCC_15445 84.1 Morganella morganii S2 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
NLDBIP_15975 NLDBIP_15975 84.1 Morganella morganii S4 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
LHKJJB_15865 LHKJJB_15865 84.1 Morganella morganii S3 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
HKOGLL_14985 HKOGLL_14985 84.1 Morganella morganii S5 hisC Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase
PMI_RS07080 PMI_RS07080 62.6 Proteus mirabilis HI4320 - aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme

Distribution of the homologs in the orthogroup group_1950

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1950

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q2RL44 5.38e-55 189 31 6 356 3 hisC Histidinol-phosphate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C0ZCE7 4.42e-47 167 33 6 334 3 hisC Histidinol-phosphate aminotransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q8Y0Y8 7.16e-45 162 34 6 334 3 hisC2 Histidinol-phosphate aminotransferase 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A4XMY1 6.27e-44 159 29 7 362 3 hisC Histidinol-phosphate aminotransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q3JEN8 1.35e-41 153 31 8 363 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q5QZ49 8.88e-41 150 31 10 339 3 hisC1 Histidinol-phosphate aminotransferase 1 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q9KCA8 6.26e-40 148 30 8 324 3 hisC Histidinol-phosphate aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0BVW4 6.46e-40 148 30 9 341 3 hisC Histidinol-phosphate aminotransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B1HTD4 1.04e-39 148 28 9 365 3 hisC Histidinol-phosphate aminotransferase Lysinibacillus sphaericus (strain C3-41)
Q3AAT6 2.78e-39 146 30 8 355 3 hisC2 Histidinol-phosphate aminotransferase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q46Y48 1.01e-38 145 29 6 346 3 hisC1 Histidinol-phosphate aminotransferase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q31GD4 1.55e-38 145 31 12 360 3 hisC2 Histidinol-phosphate aminotransferase 2 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A7Z614 1.8e-38 144 30 7 335 3 hisC Histidinol-phosphate aminotransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A7HCR6 1.93e-38 144 29 7 358 3 hisC Histidinol-phosphate aminotransferase Anaeromyxobacter sp. (strain Fw109-5)
O07131 2.53e-38 144 30 9 335 3 hisC Histidinol-phosphate aminotransferase Methylobacillus flagellatus
A1VEW4 3.01e-38 144 29 4 331 3 hisC Histidinol-phosphate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72DA0 7.03e-38 143 29 4 331 1 hisC Histidinol-phosphate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q3K8U2 3.52e-37 141 30 6 338 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain Pf0-1)
Q82XE0 5.31e-37 140 27 6 341 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q67KI2 8.77e-37 140 30 6 333 3 hisC Histidinol-phosphate aminotransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A8MEH2 9.76e-37 140 31 9 339 3 hisC Histidinol-phosphate aminotransferase Alkaliphilus oremlandii (strain OhILAs)
A7GN55 1.34e-36 139 29 8 331 3 hisC Histidinol-phosphate aminotransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q311Z4 3.34e-36 139 31 3 278 3 hisC Histidinol-phosphate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q47GP2 4.85e-36 138 29 9 375 3 hisC1 Histidinol-phosphate aminotransferase 1 Dechloromonas aromatica (strain RCB)
Q5WGR9 2.21e-35 136 30 8 341 3 hisC Histidinol-phosphate aminotransferase Shouchella clausii (strain KSM-K16)
Q2JPM4 5.37e-35 135 32 14 359 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
P34037 6.76e-35 135 29 8 343 1 hisC Histidinol-phosphate aminotransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q89GX0 1.94e-34 133 31 13 360 3 hisC1 Histidinol-phosphate aminotransferase 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2Y6Y6 2.11e-34 134 27 7 344 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
P60998 2.39e-34 134 30 9 347 3 hisC Histidinol-phosphate aminotransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q4K8N0 2.95e-34 133 28 6 332 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q81SV5 3.01e-34 133 28 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus anthracis
Q73AX7 3.07e-34 133 27 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
C5A7A4 3.37e-34 132 28 10 335 3 hisC Histidinol-phosphate aminotransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
B3DXN2 3.55e-34 133 31 9 325 3 hisC Histidinol-phosphate aminotransferase Methylacidiphilum infernorum (isolate V4)
P17731 4.11e-34 132 28 5 334 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis (strain 168)
Q6AQK2 4.36e-34 133 31 11 358 3 hisC Histidinol-phosphate aminotransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q2JTG5 5.25e-34 132 32 10 312 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-3-3Ab)
Q9CMI7 9.17e-34 132 29 10 342 3 hisC2 Histidinol-phosphate aminotransferase 2 Pasteurella multocida (strain Pm70)
Q63DL4 9.66e-34 132 28 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ZK / E33L)
Q6HL37 1.25e-33 131 28 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q62FC0 1.65e-33 131 30 12 358 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia mallei (strain ATCC 23344)
Q8KZ92 1.72e-33 131 28 5 334 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis subsp. natto
Q63XM1 3.59e-33 130 30 12 358 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia pseudomallei (strain K96243)
Q3JW89 3.59e-33 130 30 12 358 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia pseudomallei (strain 1710b)
Q5FRR4 4.45e-33 130 27 7 343 3 hisC1 Histidinol-phosphate aminotransferase 1 Gluconobacter oxydans (strain 621H)
B9DK21 1.19e-32 129 30 8 333 3 hisC Histidinol-phosphate aminotransferase Staphylococcus carnosus (strain TM300)
Q9HZ68 1.92e-32 128 28 8 335 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q49VS0 2.03e-32 128 29 8 331 3 hisC Histidinol-phosphate aminotransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q03VY3 3.6e-32 127 30 11 332 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q4QLD1 5.14e-32 127 28 9 339 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain 86-028NP)
Q5HR08 6.25e-32 126 29 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CTG8 6.64e-32 126 29 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q4FP52 6.93e-32 126 26 6 348 3 hisC Histidinol-phosphate aminotransferase Pelagibacter ubique (strain HTCC1062)
A1TGS6 1.14e-31 125 30 10 342 3 pat Putative phenylalanine aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q39CT7 1.3e-31 125 29 12 357 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q57004 1.54e-31 125 27 9 339 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B7GHJ8 2.33e-31 125 29 5 302 3 hisC Histidinol-phosphate aminotransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
P61005 2.66e-31 125 31 11 334 3 pat Putative phenylalanine aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0AK37 2.88e-31 125 29 8 340 3 hisC Histidinol-phosphate aminotransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q1GP30 2.91e-31 125 29 13 356 3 hisC Histidinol-phosphate aminotransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q5KXV3 3.45e-31 125 30 7 338 3 hisC Histidinol-phosphate aminotransferase Geobacillus kaustophilus (strain HTA426)
Q2W047 3.47e-31 125 29 6 344 3 hisC Histidinol-phosphate aminotransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q930J0 5.64e-31 124 28 5 341 3 hisC3 Histidinol-phosphate aminotransferase 3 Rhizobium meliloti (strain 1021)
B1MFC0 6.35e-31 124 30 8 325 3 pat Putative phenylalanine aminotransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q88UE6 7.33e-31 124 27 6 337 3 hisC Histidinol-phosphate aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q6ABU3 9.44e-31 123 28 6 304 3 pat Putative phenylalanine aminotransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q5P791 1.09e-30 123 30 14 361 3 hisC Histidinol-phosphate aminotransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q82FJ1 1.23e-30 123 27 8 353 3 pat Putative phenylalanine aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A8FEJ6 1.45e-30 123 28 6 337 3 hisC Histidinol-phosphate aminotransferase Bacillus pumilus (strain SAFR-032)
A0Q9F3 1.53e-30 123 31 11 334 3 pat Putative phenylalanine aminotransferase Mycobacterium avium (strain 104)
Q8Y5X8 2.1e-30 122 30 9 340 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5WV43 2.74e-30 122 27 6 334 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila (strain Lens)
Q65I37 2.99e-30 122 30 8 333 3 hisC Histidinol-phosphate aminotransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C1KWM5 3.22e-30 122 30 10 341 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q92L21 3.5e-30 122 30 11 340 3 hisC2 Histidinol-phosphate aminotransferase 2 Rhizobium meliloti (strain 1021)
A5FVN2 3.85e-30 122 27 7 342 3 hisC Histidinol-phosphate aminotransferase Acidiphilium cryptum (strain JF-5)
Q4L4E7 7.41e-30 121 28 8 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
A6UTL8 8.27e-30 121 26 11 341 3 hisC Histidinol-phosphate aminotransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q71Y90 8.32e-30 121 30 10 341 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
Q5ZU10 9.21e-30 121 26 6 334 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q92A83 9.49e-30 120 29 8 340 1 hisC Histidinol-phosphate aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9RI00 9.99e-30 120 28 8 338 3 hisC Histidinol-phosphate aminotransferase Stutzerimonas stutzeri
P9WML5 1.13e-29 120 28 7 342 1 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WML4 1.13e-29 120 28 7 342 3 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9A1 1.13e-29 120 28 7 342 3 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AIM6 1.35e-29 120 29 8 343 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KQA5 1.35e-29 120 29 8 343 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TVQ0 1.35e-29 120 29 8 343 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A3Q7J9 1.51e-29 120 29 10 342 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain JLS)
B6IYQ0 1.56e-29 120 28 7 343 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q5X3Q5 1.74e-29 120 27 6 334 3 hisC2 Histidinol-phosphate aminotransferase 2 Legionella pneumophila (strain Paris)
Q3MAX6 1.77e-29 120 31 10 318 3 hisC2 Histidinol-phosphate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q2RP86 1.8e-29 120 27 8 343 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B8DC01 1.81e-29 120 30 10 341 3 hisC Histidinol-phosphate aminotransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q1B1Z8 1.82e-29 120 29 10 342 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain MCS)
A1UN51 1.82e-29 120 29 10 342 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain KMS)
B7I6C5 1.86e-29 120 30 13 358 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AB0057)
B7GZI3 1.86e-29 120 30 13 358 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AB307-0294)
C0R1Z0 1.92e-29 120 28 12 363 3 hisC Histidinol-phosphate aminotransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q24QJ1 2.29e-29 120 27 12 350 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain Y51)
Q9A671 2.36e-29 119 29 7 351 3 hisC1 Histidinol-phosphate aminotransferase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A0R5X8 2.7e-29 119 29 9 341 1 pat Putative phenylalanine aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q1IE97 2.96e-29 119 31 15 334 3 hisC Histidinol-phosphate aminotransferase Pseudomonas entomophila (strain L48)
Q8TUE9 3.27e-29 119 31 13 334 3 hisC Histidinol-phosphate aminotransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A4IQ80 4.15e-29 119 29 8 338 3 hisC Histidinol-phosphate aminotransferase Geobacillus thermodenitrificans (strain NG80-2)
B0VV21 4.17e-29 119 30 13 358 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain SDF)
Q65S79 5.06e-29 119 28 10 340 3 hisC1 Histidinol-phosphate aminotransferase 1 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q11VM5 1.1e-28 117 30 13 342 3 hisC Histidinol-phosphate aminotransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
C5D3D2 1.24e-28 118 28 6 335 3 hisC Histidinol-phosphate aminotransferase Geobacillus sp. (strain WCH70)
Q608S3 1.37e-28 118 26 8 360 3 hisC2 Histidinol-phosphate aminotransferase 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A5CZ78 1.44e-28 117 30 8 337 3 hisC Histidinol-phosphate aminotransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8PX17 1.75e-28 117 30 12 333 3 hisC Histidinol-phosphate aminotransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P45358 1.83e-28 117 28 11 340 3 hisC Histidinol-phosphate aminotransferase Acetobacter pasteurianus
Q8YMG7 1.83e-28 117 31 11 323 3 hisC2 Histidinol-phosphate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B8FP20 2.36e-28 117 27 11 346 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B2UPR9 2.58e-28 117 28 7 355 3 hisC Histidinol-phosphate aminotransferase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
A5VZ57 2.67e-28 116 31 14 332 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8TH25 2.98e-28 116 28 10 341 3 hisC Histidinol-phosphate aminotransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q736A5 3e-28 117 29 7 330 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q3SI68 3.17e-28 116 30 15 375 3 hisC2 Histidinol-phosphate aminotransferase 2 Thiobacillus denitrificans (strain ATCC 25259)
Q81C43 3.66e-28 116 28 6 330 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q88P86 3.8e-28 116 31 14 332 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q97ES6 4.23e-28 116 28 15 360 3 hisC Histidinol-phosphate aminotransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2LST8 4.48e-28 116 27 10 365 3 hisC Histidinol-phosphate aminotransferase Syntrophus aciditrophicus (strain SB)
Q1AY33 4.51e-28 116 32 8 277 3 hisC Histidinol-phosphate aminotransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A1R558 5.49e-28 116 31 13 345 3 hisC Histidinol-phosphate aminotransferase Paenarthrobacter aurescens (strain TC1)
Q8EQB9 5.86e-28 116 26 6 334 3 hisC2 Histidinol-phosphate aminotransferase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7VIJ3 6.37e-28 116 24 3 363 3 hisC Histidinol-phosphate aminotransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2GAI1 6.84e-28 116 27 10 360 3 hisC Histidinol-phosphate aminotransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q492K2 8.97e-28 115 28 10 317 3 hisC Histidinol-phosphate aminotransferase Blochmanniella pennsylvanica (strain BPEN)
A4WUN9 9.13e-28 115 26 9 348 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q5LNM6 9.41e-28 115 27 7 346 3 hisC Histidinol-phosphate aminotransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B0V7Q2 9.6e-28 115 30 13 358 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain AYE)
B2HTW5 9.6e-28 115 30 13 358 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain ACICU)
Q9ZBY8 9.78e-28 115 27 8 353 3 pat Putative phenylalanine aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q63A05 1.13e-27 115 29 8 331 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
B1VP97 1.5e-27 115 27 8 363 3 pat Putative phenylalanine aminotransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q4ZNW0 1.81e-27 114 30 14 334 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. syringae (strain B728a)
B9KPH4 1.82e-27 114 26 9 348 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A3M2I8 1.9e-27 114 30 13 358 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q163G3 1.97e-27 114 26 9 349 3 hisC Histidinol-phosphate aminotransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6HHF6 1.99e-27 114 28 8 331 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q3KHZ1 2.73e-27 114 30 12 331 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain Pf0-1)
Q3J445 2.8e-27 114 26 9 348 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q2NEQ0 2.96e-27 114 25 12 354 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
P0DI07 3.09e-27 115 28 10 339 1 HISN6B Histidinol-phosphate aminotransferase 2, chloroplastic Arabidopsis thaliana
B9DHD3 3.09e-27 115 28 10 339 1 HISN6A Histidinol-phosphate aminotransferase 1, chloroplastic Arabidopsis thaliana
Q5LAZ9 3.87e-27 113 29 7 313 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64RE8 4.15e-27 113 28 6 312 3 hisC Histidinol-phosphate aminotransferase Bacteroides fragilis (strain YCH46)
Q8R5Q4 4.23e-27 113 28 10 310 1 hisC Histidinol-phosphate aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3A7R3 4.7e-27 113 26 10 345 3 hisC Histidinol-phosphate aminotransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q87WV6 5.14e-27 113 30 14 334 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q81P62 5.25e-27 113 29 9 331 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
Q8NXN3 5.3e-27 113 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 5.3e-27 113 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
Q8ESS3 5.7e-27 113 29 11 346 3 hisC1 Histidinol-phosphate aminotransferase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5V4K3 6.14e-27 113 26 8 346 3 hisC Histidinol-phosphate aminotransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q0AM22 6.59e-27 113 27 7 347 3 hisC Histidinol-phosphate aminotransferase Maricaulis maris (strain MCS10)
Q6GIR8 7.02e-27 112 27 8 333 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MRSA252)
A3PIA4 7.39e-27 113 26 9 348 3 hisC Histidinol-phosphate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q2N7G6 7.63e-27 113 27 9 344 3 hisC Histidinol-phosphate aminotransferase Erythrobacter litoralis (strain HTCC2594)
P55683 7.74e-27 113 26 8 351 3 hisC Histidinol-phosphate aminotransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3SK85 8.08e-27 113 27 5 311 3 hisC1 Histidinol-phosphate aminotransferase 1 Thiobacillus denitrificans (strain ATCC 25259)
B0KQJ6 8.29e-27 112 29 11 329 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain GB-1)
A4QAL4 8.58e-27 112 32 7 328 3 pat Putative phenylalanine aminotransferase Corynebacterium glutamicum (strain R)
B2HLJ8 9.21e-27 112 29 10 342 3 pat Putative phenylalanine aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q4FSH2 9.89e-27 113 26 5 337 3 hisC1 Histidinol-phosphate aminotransferase 1 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q58365 1.08e-26 112 25 11 343 3 hisC Histidinol-phosphate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q2YSI3 1.1e-26 112 27 8 334 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9HVX0 1.35e-26 112 31 12 331 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8FU28 1.4e-26 112 31 10 317 3 pat Putative phenylalanine aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q46E46 1.44e-26 112 28 8 305 3 hisC Histidinol-phosphate aminotransferase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q47KH1 1.56e-26 112 27 8 343 3 pat Putative phenylalanine aminotransferase Thermobifida fusca (strain YX)
P17736 1.81e-26 112 26 11 340 3 hisC Histidinol-phosphate aminotransferase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P61004 1.95e-26 111 29 9 302 3 pat Putative phenylalanine aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q4KI72 2.06e-26 111 30 13 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A8YZZ5 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 2.11e-26 111 27 7 332 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 2.11e-26 111 27 7 332 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
B9KDN6 2.38e-26 111 26 7 331 3 hisC Histidinol-phosphate aminotransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A0PVN0 3.95e-26 110 28 7 336 3 pat Putative phenylalanine aminotransferase Mycobacterium ulcerans (strain Agy99)
P61003 4.02e-26 111 25 12 342 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A4FWW1 4.18e-26 111 25 12 342 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q4JSJ5 4.34e-26 111 28 9 315 3 pat Putative phenylalanine aminotransferase Corynebacterium jeikeium (strain K411)
O27624 4.66e-26 110 27 12 361 3 hisC Histidinol-phosphate aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8NTT4 6.48e-26 110 31 7 324 3 pat Probable phenylalanine aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q47AL9 7.35e-26 110 30 15 357 3 hisC2 Histidinol-phosphate aminotransferase 2 Dechloromonas aromatica (strain RCB)
Q0S962 7.96e-26 110 35 6 224 3 pat Putative phenylalanine aminotransferase Rhodococcus jostii (strain RHA1)
A6LAM2 9.32e-26 109 26 7 340 3 hisC Histidinol-phosphate aminotransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q8DTQ4 9.44e-26 109 28 13 351 3 hisC Histidinol-phosphate aminotransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q18F03 1.13e-25 110 27 11 339 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
A6VUD3 1.14e-25 109 29 14 357 3 hisC Histidinol-phosphate aminotransferase Marinomonas sp. (strain MWYL1)
A9AA96 1.27e-25 109 25 12 342 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A6LUF3 1.27e-25 109 29 12 355 3 hisC Histidinol-phosphate aminotransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q6FEC7 1.28e-25 109 31 15 360 3 hisC Histidinol-phosphate aminotransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q11DR9 1.31e-25 109 27 8 345 3 hisC Histidinol-phosphate aminotransferase Chelativorans sp. (strain BNC1)
Q2IS68 1.82e-25 109 27 8 347 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain HaA2)
Q81FQ1 2.03e-25 109 28 6 333 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C0ZM44 2.13e-25 108 29 8 331 3 pat Putative phenylalanine aminotransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
B3PCJ2 2.54e-25 108 28 10 314 3 hisC Histidinol-phosphate aminotransferase Cellvibrio japonicus (strain Ueda107)
Q20YH9 2.71e-25 108 27 4 282 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB18)
Q4FQF9 2.73e-25 108 30 15 355 3 hisC2 Histidinol-phosphate aminotransferase 2 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q609W4 3.41e-25 108 29 15 358 3 hisC1 Histidinol-phosphate aminotransferase 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B0K735 3.51e-25 108 28 11 314 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B1JBC0 3.97e-25 108 29 13 332 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain W619)
C3KVX5 4.57e-25 107 26 11 349 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain 657 / Type Ba4)
Q48ED0 5.46e-25 107 29 14 334 3 hisC Histidinol-phosphate aminotransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q31I36 5.8e-25 107 29 14 355 3 hisC1 Histidinol-phosphate aminotransferase 1 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B7MWU0 6.21e-25 107 25 8 331 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O81 (strain ED1a)
B8I5V1 7.72e-25 107 28 11 331 3 hisC Histidinol-phosphate aminotransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B5E9W9 1.03e-24 107 27 12 347 3 hisC Histidinol-phosphate aminotransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A6Q1Z5 1.09e-24 107 25 8 366 3 hisC Histidinol-phosphate aminotransferase Nitratiruptor sp. (strain SB155-2)
Q3IRT1 1.17e-24 106 28 8 338 3 hisC Histidinol-phosphate aminotransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q98G10 1.36e-24 107 27 8 362 3 hisC2 Histidinol-phosphate aminotransferase 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q39YP6 1.64e-24 106 25 10 339 1 hisC Histidinol-phosphate aminotransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q92MG0 1.81e-24 106 29 3 282 3 hisC1 Histidinol-phosphate aminotransferase 1 Rhizobium meliloti (strain 1021)
B1IZ53 2.27e-24 105 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B0K625 2.45e-24 105 27 10 314 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
A7ZNJ3 2.88e-24 105 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7VQW9 3e-24 105 26 10 320 3 hisC Histidinol-phosphate aminotransferase Blochmanniella floridana
B7MDH5 3.27e-24 105 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q28TL1 3.43e-24 105 26 8 340 3 hisC Histidinol-phosphate aminotransferase Jannaschia sp. (strain CCS1)
Q3AD52 4.19e-24 105 27 6 306 3 hisC1 Histidinol-phosphate aminotransferase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3Z0G4 4.72e-24 105 25 7 311 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)
Q1R089 5.46e-24 104 29 15 346 3 hisC Histidinol-phosphate aminotransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A0RMN9 6.09e-24 105 27 11 344 3 hisC Histidinol-phosphate aminotransferase Campylobacter fetus subsp. fetus (strain 82-40)
Q51687 6.23e-24 105 28 13 350 3 hisC Histidinol-phosphate aminotransferase Paracoccus denitrificans (strain Pd 1222)
B1ILA9 6.29e-24 104 26 13 353 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Okra / Type B1)
Q32EF0 6.93e-24 104 25 7 311 3 hisC Histidinol-phosphate aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
A8LK96 7.65e-24 104 27 7 334 3 hisC Histidinol-phosphate aminotransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B5YU77 7.72e-24 104 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q9S5G6 7.72e-24 104 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7
Q5JFU6 9.46e-24 103 28 8 296 3 hisC Histidinol-phosphate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q987C8 1.07e-23 104 26 8 341 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B2GBR8 1.11e-23 104 26 7 326 3 hisC Histidinol-phosphate aminotransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B7L9P8 1.13e-23 103 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain 55989 / EAEC)
A9H311 1.19e-23 103 29 11 351 3 hisC Histidinol-phosphate aminotransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q323J1 1.23e-23 103 25 7 314 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 4 (strain Sb227)
B1N009 1.29e-23 103 29 7 267 3 hisC Histidinol-phosphate aminotransferase Leuconostoc citreum (strain KM20)
A0KKB7 1.38e-23 103 32 4 191 3 hisC Histidinol-phosphate aminotransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B2IDA4 1.44e-23 103 26 8 349 3 hisC Histidinol-phosphate aminotransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A6VGF6 1.53e-23 103 23 12 342 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
B6I848 1.84e-23 103 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SE11)
P06986 1.84e-23 103 25 7 311 1 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12)
B1X6V8 1.84e-23 103 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZSB0 1.84e-23 103 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M400 1.84e-23 103 25 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O8 (strain IAI1)
Q07IG8 1.95e-23 103 25 7 342 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisA53)
Q31PF9 2.06e-23 103 27 10 308 3 hisC Histidinol-phosphate aminotransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P16246 2.25e-23 103 26 8 353 3 hisC Histidinol-phosphate aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B2TYF9 2.28e-23 103 24 7 314 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
C1FN41 2.31e-23 103 27 14 354 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Kyoto / Type A2)
Q83KJ6 2.37e-23 103 25 7 311 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri
Q0T3A6 2.37e-23 103 25 7 311 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri serotype 5b (strain 8401)
Q5N4R3 2.46e-23 103 27 10 308 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A8A1P5 2.75e-23 103 24 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O9:H4 (strain HS)
A1JTV9 2.83e-23 103 26 9 311 3 hisC Histidinol-phosphate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FJH1 3e-23 103 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JPW1 3.03e-23 103 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4SMP7 3.11e-23 102 31 3 191 3 hisC Histidinol-phosphate aminotransferase Aeromonas salmonicida (strain A449)
B7NC61 3.35e-23 102 24 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A4TKK4 3.75e-23 103 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CGX0 3.75e-23 103 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2K5 3.75e-23 103 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFX6 3.75e-23 103 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis
Q1C9R1 3.75e-23 103 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
O28255 4.12e-23 102 28 15 346 3 hisC2 Histidinol-phosphate aminotransferase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A5I245 4.37e-23 102 25 13 353 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FU81 4.37e-23 102 25 13 353 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain ATCC 19397 / Type A)
Q5FQA6 4.7e-23 102 28 12 342 3 hisC2 Histidinol-phosphate aminotransferase 2 Gluconobacter oxydans (strain 621H)
Q66C50 4.93e-23 102 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZM8 4.93e-23 102 32 9 254 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q8U9W3 5e-23 102 27 8 342 3 hisC Histidinol-phosphate aminotransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q98B00 5.27e-23 102 25 7 332 3 hisC3 Histidinol-phosphate aminotransferase 3 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B7NQG9 6.59e-23 102 24 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A5UKY0 6.73e-23 102 25 11 354 3 hisC Histidinol-phosphate aminotransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A7ZCF3 6.78e-23 102 25 4 312 3 hisC Histidinol-phosphate aminotransferase Campylobacter concisus (strain 13826)
B9EAC1 6.97e-23 101 28 10 332 3 hisC Histidinol-phosphate aminotransferase Macrococcus caseolyticus (strain JCSC5402)
Q8YV89 7.7e-23 101 25 10 339 3 hisC1 Histidinol-phosphate aminotransferase 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B7UT58 7.71e-23 101 24 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q2NTX2 7.73e-23 101 24 8 317 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
C6E916 8.24e-23 101 27 12 347 3 hisC Histidinol-phosphate aminotransferase Geobacter sp. (strain M21)
A1ACN3 8.67e-23 101 25 8 314 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O1:K1 / APEC
Q82AA5 8.67e-23 101 26 8 353 3 hisC Histidinol-phosphate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q5Z3C0 8.9e-23 101 27 6 317 3 pat Putative phenylalanine aminotransferase Nocardia farcinica (strain IFM 10152)
Q2YAU6 9.26e-23 101 30 12 319 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B8HW95 1.18e-22 101 28 10 341 3 hisC Histidinol-phosphate aminotransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q1GET3 1.51e-22 100 27 11 349 3 hisC Histidinol-phosphate aminotransferase Ruegeria sp. (strain TM1040)
A3CNT7 1.89e-22 100 26 11 348 3 hisC Histidinol-phosphate aminotransferase Streptococcus sanguinis (strain SK36)
Q1RA52 1.97e-22 100 24 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 1.97e-22 100 24 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 1.97e-22 100 24 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B3Q8Z5 2.46e-22 100 27 6 285 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain TIE-1)
P61002 2.46e-22 100 27 6 285 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q46WL3 2.49e-22 100 28 12 318 1 hisC2 Histidinol-phosphate aminotransferase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A8AY31 2.64e-22 100 27 11 348 3 hisC Histidinol-phosphate aminotransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A6UPL6 2.7e-22 100 24 14 349 3 hisC Histidinol-phosphate aminotransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q131B9 2.77e-22 100 26 9 345 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB5)
Q7VWL5 3.03e-22 100 28 12 343 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
C6DF75 3.63e-22 99 26 9 319 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8EWM9 3.65e-22 100 23 11 373 3 hisC Histidinol-phosphate aminotransferase Aliarcobacter butzleri (strain RM4018)
B7LUF2 4.35e-22 99 24 7 314 3 hisC Histidinol-phosphate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q5HWF4 4.63e-22 99 26 6 330 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni (strain RM1221)
Q9A5B6 4.67e-22 99 26 6 324 3 hisC2 Histidinol-phosphate aminotransferase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O82030 4.77e-22 100 28 11 340 2 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana tabacum
A7H084 5.16e-22 99 25 4 307 3 hisC Histidinol-phosphate aminotransferase Campylobacter curvus (strain 525.92)
B1LP20 5.29e-22 99 24 7 311 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
A7MJP4 5.51e-22 99 25 8 311 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
A3CWS8 5.82e-22 99 26 12 371 3 hisC Histidinol-phosphate aminotransferase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q10VS0 7.07e-22 99 28 12 359 3 hisC Histidinol-phosphate aminotransferase Trichodesmium erythraeum (strain IMS101)
Q8TVG3 7.34e-22 99 26 10 354 3 hisC Histidinol-phosphate aminotransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q9FEW2 7.72e-22 99 28 11 340 1 HPA Histidinol-phosphate aminotransferase, chloroplastic Nicotiana plumbaginifolia
Q0P8H7 1.11e-21 98 25 11 352 1 Cj1437c Dihydroxyacetone phosphate transaminase Cj1437c Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A4WC70 1.13e-21 98 25 7 317 3 hisC Histidinol-phosphate aminotransferase Enterobacter sp. (strain 638)
P73807 1.15e-21 98 27 11 348 3 hisC Histidinol-phosphate aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P61000 1.16e-21 98 25 11 341 3 hisC Histidinol-phosphate aminotransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q7WHN5 1.7e-21 97 28 12 343 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q03K75 1.74e-21 97 26 11 353 3 hisC Histidinol-phosphate aminotransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q7W6Q1 1.77e-21 97 28 12 343 3 hisC1 Histidinol-phosphate aminotransferase 1 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A5G9G1 1.83e-21 97 26 10 337 3 hisC Histidinol-phosphate aminotransferase Geotalea uraniireducens (strain Rf4)
A1KV06 2.24e-21 97 29 12 314 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JTH8 2.24e-21 97 29 12 314 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M185 2.24e-21 97 29 12 314 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup C (strain 053442)
Q04Z75 2.27e-21 97 27 12 345 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QW8 2.27e-21 97 27 12 345 3 hisC Histidinol-phosphate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B5XPE6 2.59e-21 97 26 10 319 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
B5FM42 2.87e-21 97 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
Q8Z5J9 3.81e-21 97 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella typhi
Q65RB2 4.1e-21 96 31 5 191 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1VY36 4.12e-21 97 26 6 330 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A0M287 4.18e-21 96 26 9 318 3 hisC Histidinol-phosphate aminotransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A6GY79 4.65e-21 96 27 8 310 3 hisC Histidinol-phosphate aminotransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A7GDQ6 4.8e-21 96 26 14 341 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q7M7Y6 4.83e-21 96 23 9 369 3 hisC Histidinol-phosphate aminotransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B0JJJ7 5.1e-21 96 26 10 338 3 hisC Histidinol-phosphate aminotransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A9MSC2 6.12e-21 96 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX42 6.12e-21 96 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella newport (strain SL254)
B4TMR6 6.3e-21 96 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 6.3e-21 96 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 6.3e-21 96 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 6.3e-21 96 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
A6TBC4 6.4e-21 96 31 5 191 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C0Q1K1 6.43e-21 96 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
Q3ARM7 6.93e-21 96 27 10 305 3 hisC Histidinol-phosphate aminotransferase Chlorobium chlorochromatii (strain CaD3)
Q6D410 7.12e-21 96 30 5 199 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q57MS2 7.36e-21 96 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
A6QBY8 8.43e-21 95 25 7 328 3 hisC Histidinol-phosphate aminotransferase Sulfurovum sp. (strain NBC37-1)
B4T9N5 1.13e-20 95 25 10 318 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
Q8DM42 1.16e-20 95 28 14 361 3 hisC Histidinol-phosphate aminotransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A8AEK3 1.16e-20 95 24 8 316 3 hisC Histidinol-phosphate aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q7N6I1 1.19e-20 97 28 13 319 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P10369 1.23e-20 95 25 10 318 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C1B997 1.4e-20 95 27 7 355 3 pat Putative phenylalanine aminotransferase Rhodococcus opacus (strain B4)
Q8ABA8 1.51e-20 95 26 6 312 3 hisC Histidinol-phosphate aminotransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A8FKA6 1.56e-20 95 25 6 330 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q8FNZ1 1.61e-20 95 27 12 342 3 hisC Histidinol-phosphate aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q7P0F4 1.68e-20 95 29 10 315 3 hisC Histidinol-phosphate aminotransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q6ABX6 2.22e-20 94 27 6 288 3 pat Putative phenylalanine aminotransferase Leifsonia xyli subsp. xyli (strain CTCB07)
B5BFB9 2.37e-20 94 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP4 2.37e-20 94 25 8 316 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1QQD5 2.54e-20 94 26 5 285 3 hisC Histidinol-phosphate aminotransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q9HQS0 2.59e-20 94 26 12 345 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4Q4 2.59e-20 94 26 12 345 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9JYH7 2.74e-20 94 29 12 321 3 hisC Histidinol-phosphate aminotransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9ZHE5 2.86e-20 94 26 9 314 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q63Q87 2.97e-20 94 29 10 303 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain K96243)
Q62GE0 2.97e-20 94 29 10 303 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia mallei (strain ATCC 23344)
Q4JW58 3.04e-20 94 28 10 343 3 hisC Histidinol-phosphate aminotransferase Corynebacterium jeikeium (strain K411)
Q3JMZ7 3.12e-20 94 29 10 303 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain 1710b)
Q2SBJ7 3.28e-20 94 30 14 308 3 hisC Histidinol-phosphate aminotransferase Hahella chejuensis (strain KCTC 2396)
A8HZS2 3.33e-20 94 28 6 283 3 hisC Histidinol-phosphate aminotransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A9ML15 4.03e-20 94 28 4 194 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A5V022 4.13e-20 94 28 16 388 3 hisC Histidinol-phosphate aminotransferase Roseiflexus sp. (strain RS-1)
Q8XV80 4.14e-20 94 27 12 346 3 hisC1 Histidinol-phosphate aminotransferase 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3ZXL8 4.39e-20 94 25 11 358 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
B9LNJ8 4.65e-20 94 26 9 316 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q89AX7 5.82e-20 93 24 9 317 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8FY98 5.92e-20 93 27 7 342 3 hisC Histidinol-phosphate aminotransferase Brucella suis biovar 1 (strain 1330)
A5VSV7 5.92e-20 93 27 7 342 3 hisC Histidinol-phosphate aminotransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57AR7 5.92e-20 93 27 7 342 3 hisC Histidinol-phosphate aminotransferase Brucella abortus biovar 1 (strain 9-941)
Q2YR81 5.92e-20 93 27 7 342 3 hisC Histidinol-phosphate aminotransferase Brucella abortus (strain 2308)
A5FR29 6.58e-20 93 25 10 347 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q8KD01 6.65e-20 93 25 9 339 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q3M504 7.36e-20 93 24 8 311 3 hisC1 Histidinol-phosphate aminotransferase 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B5FDA0 7.44e-20 93 30 5 191 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain MJ11)
Q7UNC3 7.57e-20 93 26 11 349 3 hisC Histidinol-phosphate aminotransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A2SE05 7.86e-20 93 28 13 314 3 hisC Histidinol-phosphate aminotransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q87QL0 8.76e-20 92 31 6 191 3 hisC Histidinol-phosphate aminotransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3SV41 9.57e-20 93 25 4 293 3 hisC Histidinol-phosphate aminotransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q0C348 9.77e-20 93 25 8 286 3 hisC Histidinol-phosphate aminotransferase Hyphomonas neptunium (strain ATCC 15444)
Q30TC9 1.06e-19 92 26 5 259 3 hisC Histidinol-phosphate aminotransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q9KSX2 1.13e-19 92 31 6 191 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0UN04 1.32e-19 92 28 4 282 3 hisC Histidinol-phosphate aminotransferase Methylobacterium sp. (strain 4-46)
A6L2V8 1.41e-19 92 26 7 312 3 hisC Histidinol-phosphate aminotransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B9MDV4 1.41e-19 92 29 15 325 3 hisC Histidinol-phosphate aminotransferase Acidovorax ebreus (strain TPSY)
Q84I51 1.42e-19 92 26 13 319 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Schlechtendalia chinensis
Q9CLM3 1.43e-19 92 31 5 187 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q3J7H2 1.47e-19 92 30 14 321 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A5FFY0 1.48e-19 92 25 7 310 3 hisC Histidinol-phosphate aminotransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q8Z8H8 1.62e-19 92 27 13 317 3 cobD Threonine-phosphate decarboxylase Salmonella typhi
Q1LT68 1.9e-19 92 25 10 310 3 hisC Histidinol-phosphate aminotransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
B4RJ05 1.92e-19 92 28 12 321 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F7D7 1.92e-19 92 28 12 321 3 hisC Histidinol-phosphate aminotransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9PII2 2.22e-19 92 25 6 330 1 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q2J8K9 2.23e-19 92 28 12 352 3 hisC Histidinol-phosphate aminotransferase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B1WY56 2.49e-19 91 25 9 356 3 hisC Histidinol-phosphate aminotransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q3Z879 2.68e-19 91 27 13 359 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q8R5U4 2.91e-19 91 25 7 280 3 cobD Putative threonine-phosphate decarboxylase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7H556 3.36e-19 91 24 6 330 3 hisC Histidinol-phosphate aminotransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q8YJK3 3.49e-19 91 27 7 342 3 hisC Histidinol-phosphate aminotransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q87C30 3.77e-19 91 26 10 346 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5Y0 3.77e-19 91 26 10 346 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M23)
Q89UL9 4.23e-19 91 24 5 283 3 hisC2 Histidinol-phosphate aminotransferase 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q15RU8 4.48e-19 91 25 10 320 3 hisC Histidinol-phosphate aminotransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0U3B2 4.56e-19 91 26 10 346 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain M12)
A5CVR5 4.61e-19 90 26 10 312 3 hisC Histidinol-phosphate aminotransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
C3LU31 5.11e-19 90 31 6 191 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F2A2 5.11e-19 90 31 6 191 3 hisC Histidinol-phosphate aminotransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B4SGL8 5.17e-19 90 28 12 319 3 hisC Histidinol-phosphate aminotransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A2RKS5 6.04e-19 90 25 10 341 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q970Z4 6.04e-19 90 24 6 311 3 hisC Histidinol-phosphate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q9X0D0 6.17e-19 90 27 8 258 1 hisC Histidinol-phosphate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q4UU41 7.27e-19 90 28 14 349 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain 8004)
Q9PBC6 8.57e-19 90 26 10 346 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain 9a5c)
Q8F6W9 1.07e-18 90 25 6 285 3 hisC Histidinol-phosphate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PG3 1.07e-18 90 25 6 285 3 hisC Histidinol-phosphate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P57202 1.1e-18 90 26 10 318 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A8GC78 1.15e-18 89 25 9 312 3 hisC Histidinol-phosphate aminotransferase Serratia proteamaculans (strain 568)
Q5E637 1.47e-18 89 29 5 191 3 hisC Histidinol-phosphate aminotransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B1L869 1.58e-18 89 27 8 258 3 hisC Histidinol-phosphate aminotransferase Thermotoga sp. (strain RQ2)
Q7W2Y3 1.62e-18 89 26 10 316 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
B8D707 1.62e-18 89 26 10 318 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8Q3 1.62e-18 89 26 10 318 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q02YW3 1.8e-18 89 25 11 342 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q39K90 1.81e-18 89 29 14 307 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q845V2 1.85e-18 89 29 11 303 3 hisC Histidinol-phosphate aminotransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q7WDY3 1.91e-18 89 26 10 316 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B9LZ53 2.16e-18 89 27 14 340 3 hisC Histidinol-phosphate aminotransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
P61001 2.33e-18 89 26 12 364 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QHI1 2.56e-18 89 26 12 364 3 hisC Histidinol-phosphate aminotransferase Mycobacterium avium (strain 104)
A7MX17 2.79e-18 88 30 6 191 3 hisC Histidinol-phosphate aminotransferase Vibrio campbellii (strain ATCC BAA-1116)
Q12U08 2.84e-18 88 30 8 223 3 hisC Histidinol-phosphate aminotransferase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
B4S8L6 2.87e-18 88 25 7 278 3 hisC Histidinol-phosphate aminotransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q9X7B8 3.09e-18 89 27 11 358 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain TN)
B8ZRB0 3.09e-18 89 27 11 358 3 hisC Histidinol-phosphate aminotransferase Mycobacterium leprae (strain Br4923)
P97084 3.31e-18 88 26 13 317 1 cobD Threonine-phosphate decarboxylase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B0RSL5 3.47e-18 88 27 14 349 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain B100)
A0PXP5 3.53e-18 88 24 14 356 3 hisC Histidinol-phosphate aminotransferase Clostridium novyi (strain NT)
A1W431 4.24e-18 88 29 12 294 3 hisC Histidinol-phosphate aminotransferase Acidovorax sp. (strain JS42)
Q84I53 4.45e-18 88 23 8 343 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Diuraphis noxia
Q7NL03 5.32e-18 87 26 9 313 3 hisC Histidinol-phosphate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B4U9L1 6.23e-18 87 25 12 348 3 hisC Histidinol-phosphate aminotransferase Hydrogenobaculum sp. (strain Y04AAS1)
P07172 7.37e-18 87 26 11 306 1 HIS5 Histidinol-phosphate aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7VSZ0 1.13e-17 87 26 10 316 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P58892 1.16e-17 87 27 14 349 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
O28277 1.25e-17 86 26 11 336 3 hisC1 Histidinol-phosphate aminotransferase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A1TKZ0 1.35e-17 87 28 12 316 3 hisC Histidinol-phosphate aminotransferase Paracidovorax citrulli (strain AAC00-1)
A4QFG6 1.54e-17 86 27 12 341 3 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain R)
A4SE60 1.65e-17 86 30 5 223 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q9KJU4 2.03e-17 86 27 12 341 1 hisC Histidinol-phosphate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q02135 2.34e-17 85 26 10 317 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q8D8Q1 3.17e-17 85 30 6 191 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain CMCP6)
Q0W253 3.69e-17 85 25 10 348 3 hisC Histidinol-phosphate aminotransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
B8IRU5 3.84e-17 85 28 3 283 3 hisC Histidinol-phosphate aminotransferase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A5INE2 4.91e-17 84 26 8 258 3 hisC Histidinol-phosphate aminotransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q7MLS5 5.09e-17 84 30 6 191 3 hisC Histidinol-phosphate aminotransferase Vibrio vulnificus (strain YJ016)
A7ICA9 6.5e-17 85 28 4 231 3 hisC Histidinol-phosphate aminotransferase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q82WM3 7.15e-17 84 28 11 314 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5H0L0 7.47e-17 84 28 14 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3K2 7.47e-17 84 28 14 352 3 hisC Histidinol-phosphate aminotransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P60999 8.58e-17 84 25 9 348 3 hisC Histidinol-phosphate aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5YYP9 9.77e-17 84 26 10 349 3 hisC Histidinol-phosphate aminotransferase Nocardia farcinica (strain IFM 10152)
B2FPM0 1.01e-16 84 25 11 334 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain K279a)
A7I2V8 1.04e-16 84 23 5 366 3 hisC Histidinol-phosphate aminotransferase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B6EJ89 1.15e-16 84 27 5 191 3 hisC Histidinol-phosphate aminotransferase Aliivibrio salmonicida (strain LFI1238)
Q84I52 1.34e-16 84 26 11 317 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Melaphis rhois
P36605 1.69e-16 84 25 10 340 3 his3 Histidinol-phosphate aminotransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1VK38 1.69e-16 83 29 12 314 3 hisC Histidinol-phosphate aminotransferase Polaromonas naphthalenivorans (strain CJ2)
A5N7Q7 2.25e-16 83 27 12 306 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E168 2.25e-16 83 27 12 306 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain NBRC 12016)
Q3BUF6 2.4e-16 83 27 12 325 3 hisC Histidinol-phosphate aminotransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A1S6Z2 3.01e-16 82 25 9 292 3 hisC Histidinol-phosphate aminotransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B3QP11 3.33e-16 82 26 12 315 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B9K9R9 4.78e-16 82 24 9 317 3 hisC Histidinol-phosphate aminotransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
P58891 6.13e-16 82 27 12 321 3 hisC Histidinol-phosphate aminotransferase Xanthomonas axonopodis pv. citri (strain 306)
B0TY45 6.88e-16 81 28 3 187 3 hisC Histidinol-phosphate aminotransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B3ECG2 8.44e-16 81 27 5 223 3 hisC Histidinol-phosphate aminotransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B7JUI4 8.81e-16 81 23 10 353 3 hisC Histidinol-phosphate aminotransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8EXQ7 8.81e-16 82 23 9 336 3 cobDQ Adenosylcobalamin biosynthesis bifunctional protein CobDQ Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
A2SSJ1 1.18e-15 80 26 14 347 3 hisC Histidinol-phosphate aminotransferase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
P9WML7 1.57e-15 80 26 8 341 1 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WML6 1.57e-15 80 26 8 341 3 hisC Histidinol-phosphate aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07435
Feature type CDS
Gene -
Product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
Location 1555682 - 1556851 (strand: 1)
Length 1170 (nucleotides) / 389 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1950
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0079 Amino acid transport and metabolism (E) E Histidinol-phosphate/aromatic aminotransferase or cobyric acid decarboxylase

Kegg Ortholog Annotation(s)

Protein Sequence

MDRRLFLKSTGIVLGGLSAASLVSHSYAATDAASAAVPAAPLSEKNPLLLNFNENSLGMSANARRAIVESLPTAFRYPDAAREALVEQIAAHYSLTPEHISLGNGSSETIRAAVQMLVADAQKKQQPIQLIVPDPTFNYAELYAQPLGVNVVKVPLKADLSFDLAAMQAIADNFAGHTIIYICNPNNPTAMITPASALAAWIKNAPLQQHFIIDEAYAEFVSDPEFKSAVEWVSAGKPNIIVTRTFSKIFALAGLRVGYGIAVPEVTKQINNFNSSDNTNIAGAVAALTSINDSSFIDYNRKSTDVSREIVIAALTELNLAYAPSQANFIFHQVNGDVKTYQQRMKENHIMVGREFPPVIGRSRLTLGTPEEMLQFVSVLKQFRQKGWV

Flanking regions ( +/- flanking 50bp)

ATATCGGTTAGTATTTGCCTGAACATAATTAAAAAAACAGGGTAAATACTATGGATCGTCGTTTGTTTCTCAAATCAACCGGGATTGTTCTCGGCGGTTTAAGTGCCGCCTCACTGGTCAGTCACAGCTATGCCGCCACAGATGCGGCAAGCGCGGCAGTACCTGCGGCTCCGCTCAGTGAAAAAAATCCGCTGCTGCTGAACTTTAATGAAAATTCACTGGGTATGTCAGCCAATGCCCGCCGCGCAATTGTTGAATCACTGCCGACGGCATTCCGTTATCCGGATGCCGCCCGTGAAGCGCTGGTTGAGCAGATTGCCGCACACTACTCTCTGACGCCGGAGCACATCAGCTTAGGAAATGGTTCATCAGAAACCATTCGGGCGGCGGTGCAGATGCTGGTCGCGGATGCACAGAAAAAACAGCAGCCGATACAATTAATCGTACCGGACCCGACGTTTAATTATGCTGAGCTGTATGCACAACCGCTGGGTGTCAATGTTGTCAAAGTGCCGCTGAAAGCAGATCTCTCTTTTGACCTGGCGGCAATGCAGGCAATTGCTGATAATTTTGCCGGGCACACCATCATTTATATCTGTAACCCGAACAACCCGACAGCCATGATAACCCCGGCGTCGGCCTTAGCGGCATGGATCAAAAACGCGCCTTTACAGCAACATTTTATTATTGATGAAGCCTATGCTGAGTTTGTTTCTGACCCGGAATTTAAAAGTGCGGTTGAATGGGTTTCTGCCGGAAAACCTAATATTATCGTAACGCGGACATTTTCAAAAATATTTGCGCTGGCGGGATTACGTGTCGGATACGGTATTGCCGTACCGGAAGTGACAAAACAGATTAATAACTTCAATTCTAGCGATAATACAAATATAGCAGGAGCCGTTGCTGCATTAACATCAATAAATGACTCGTCGTTTATTGACTACAACCGTAAATCAACAGACGTTTCGCGGGAAATTGTTATAGCTGCACTGACTGAATTAAATCTGGCTTACGCGCCTTCACAGGCTAATTTTATCTTTCATCAGGTGAACGGTGATGTAAAAACCTATCAGCAGCGAATGAAAGAGAATCATATTATGGTAGGACGTGAATTCCCGCCTGTGATTGGCAGAAGCCGCCTGACATTAGGTACACCAGAAGAAATGTTACAGTTTGTTTCTGTATTAAAGCAATTTCGCCAAAAAGGCTGGGTTTAATTATAATCTAAATTAAATTAAAAGTGACTTACACCATTATTCATTCAAAC