Homologs in group_1977

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14560 FBDBKF_14560 95.1 Morganella morganii S1 mnmA tRNA 2-thiouridine(34) synthase MnmA
EHELCC_15365 EHELCC_15365 95.1 Morganella morganii S2 mnmA tRNA 2-thiouridine(34) synthase MnmA
NLDBIP_15895 NLDBIP_15895 95.1 Morganella morganii S4 mnmA tRNA 2-thiouridine(34) synthase MnmA
LHKJJB_15945 LHKJJB_15945 95.1 Morganella morganii S3 mnmA tRNA 2-thiouridine(34) synthase MnmA
HKOGLL_15065 HKOGLL_15065 95.1 Morganella morganii S5 mnmA tRNA 2-thiouridine(34) synthase MnmA
PMI_RS04365 PMI_RS04365 87.2 Proteus mirabilis HI4320 mnmA tRNA 2-thiouridine(34) synthase MnmA

Distribution of the homologs in the orthogroup group_1977

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1977

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EVG2 0.0 679 87 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Proteus mirabilis (strain HI4320)
A8GDD5 0.0 670 85 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Serratia proteamaculans (strain 568)
A1JLK6 0.0 669 86 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JI67 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669Q4 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLN3 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis (strain Pestoides F)
Q1CI58 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R0L5 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFQ5 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis
B2K711 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6S0 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis bv. Antiqua (strain Antiqua)
A7FH61 0.0 665 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7MB22 0.0 665 85 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C5B8B9 0.0 664 85 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Edwardsiella ictaluri (strain 93-146)
C6DFW7 0.0 659 85 1 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D4E9 0.0 655 84 1 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MFV2 0.0 652 85 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Cronobacter sakazakii (strain ATCC BAA-894)
A6T7K3 0.0 636 87 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XSN3 0.0 635 87 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Klebsiella pneumoniae (strain 342)
Q8ZPZ4 0.0 629 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z7G9 0.0 628 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella typhi
A9N4K8 0.0 628 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PMJ4 0.0 628 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A4W9E5 0.0 627 84 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Enterobacter sp. (strain 638)
Q57QC0 0.0 627 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella choleraesuis (strain SC-B67)
A9MG80 0.0 624 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8AHK2 0.0 622 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q1RD20 0.0 621 84 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain UTI89 / UPEC)
Q0TIU0 0.0 621 84 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AA27 0.0 621 84 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O1:K1 / APEC
Q83LF7 0.0 620 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella flexneri
Q0T5N9 0.0 620 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella flexneri serotype 5b (strain 8401)
B1LI10 0.0 620 84 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain SMS-3-5 / SECEC)
P25745 0.0 620 83 1 365 1 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain K12)
B1IUD4 0.0 620 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZ88 0.0 620 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O9:H4 (strain HS)
B1XA43 0.0 620 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain K12 / DH10B)
Q8X735 0.0 620 84 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O157:H7
A7ZKS3 0.0 620 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31ZK9 0.0 620 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella boydii serotype 4 (strain Sb227)
B2TZ86 0.0 619 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q32EZ1 0.0 619 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2Y6 0.0 618 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella sonnei (strain Ss046)
Q8CXZ8 0.0 615 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
C4L952 0.0 600 79 0 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q2NU15 0.0 600 78 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Sodalis glossinidius (strain morsitans)
A0KI53 0.0 595 78 1 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SKS0 0.0 593 78 1 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Aeromonas salmonicida (strain A449)
Q5QYZ7 0.0 584 76 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0I5Y6 0.0 582 76 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Histophilus somni (strain 129Pt)
Q9KSX8 0.0 581 77 2 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2F2 0.0 581 77 2 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A1STI9 0.0 580 75 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0UWF2 0.0 579 75 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Histophilus somni (strain 2336)
Q4QP16 0.0 576 78 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Haemophilus influenzae (strain 86-028NP)
P44551 0.0 574 78 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6LT18 0.0 572 75 3 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Photobacterium profundum (strain SS9)
Q7U342 0.0 571 74 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1S7B1 0.0 570 75 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7MLT4 0.0 568 75 3 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio vulnificus (strain YJ016)
Q9CLA3 0.0 566 75 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Pasteurella multocida (strain Pm70)
Q8CWJ6 0.0 565 75 3 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio vulnificus (strain CMCP6)
A5UFX6 0.0 561 77 1 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Haemophilus influenzae (strain PittGG)
Q87QL9 0.0 560 75 3 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MSW1 0.0 558 74 2 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio campbellii (strain ATCC BAA-1116)
B5FG83 0.0 558 74 3 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Aliivibrio fischeri (strain MJ11)
Q5E3W7 0.0 558 74 3 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Aliivibrio fischeri (strain ATCC 700601 / ES114)
B8CLH4 0.0 555 74 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella piezotolerans (strain WP3 / JCM 13877)
Q15T93 0.0 555 72 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0BS63 0.0 555 75 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3MYN0 0.0 553 75 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A3QD79 0.0 553 73 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B0TQ02 0.0 551 74 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella halifaxensis (strain HAW-EB4)
Q0HJT7 0.0 550 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sp. (strain MR-4)
Q8CX40 0.0 550 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8H5M1 0.0 549 73 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A9L4G9 0.0 548 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella baltica (strain OS195)
A3D5F8 0.0 548 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E945 0.0 548 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella baltica (strain OS223)
A6WP69 0.0 547 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella baltica (strain OS185)
Q3IH16 0.0 546 72 2 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudoalteromonas translucida (strain TAC 125)
A0KW11 0.0 546 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sp. (strain ANA-3)
Q0HW33 0.0 546 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sp. (strain MR-7)
A4Y7M1 0.0 546 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RIW8 0.0 544 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sp. (strain W3-18-1)
A8FUG9 0.0 542 71 0 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sediminis (strain HAW-EB3)
B1KID0 0.0 541 71 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella woodyi (strain ATCC 51908 / MS32)
Q12N64 0.0 540 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q081F9 0.0 538 72 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella frigidimarina (strain NCIMB 400)
Q65VV2 0.0 538 75 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q480B8 0.0 535 69 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q1LT51 0.0 534 69 0 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Baumannia cicadellinicola subsp. Homalodisca coagulata
A6VLY4 0.0 528 73 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q492R5 0.0 521 65 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Blochmanniella pennsylvanica (strain BPEN)
C3JY68 0.0 512 69 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas fluorescens (strain SBW25)
Q4K9U2 0.0 509 69 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4ZRK0 0.0 509 68 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas syringae pv. syringae (strain B728a)
A6W0E1 2.3e-180 508 68 1 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Marinomonas sp. (strain MWYL1)
Q3KA70 4.66e-180 507 68 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas fluorescens (strain Pf0-1)
Q48H61 8.76e-180 506 68 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4XUY9 1.72e-178 503 67 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas mendocina (strain ymp)
Q87ZR6 3e-178 502 67 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4VLW2 4.63e-178 502 67 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Stutzerimonas stutzeri (strain A1501)
B1JBJ1 1.53e-176 498 66 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas putida (strain W619)
Q88FR9 2.86e-176 497 66 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1IBE4 6.35e-176 496 66 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas entomophila (strain L48)
A5W1G2 9.12e-176 496 66 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KMQ6 1.04e-175 496 66 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas putida (strain GB-1)
A6V4G0 7.31e-175 494 67 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas aeruginosa (strain PA7)
A5WE20 4.88e-174 493 68 6 373 3 mnmA tRNA-specific 2-thiouridylase MnmA Psychrobacter sp. (strain PRwf-1)
B7UV15 1.37e-173 490 67 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas aeruginosa (strain LESB58)
A1U1H5 1.42e-173 491 66 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9I0L2 4.72e-173 489 67 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02NB8 4.72e-173 489 67 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q607H5 8.71e-169 478 65 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1QBM4 1.23e-168 479 66 5 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FSB4 8.9e-167 474 65 5 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A0Q454 1.45e-165 469 63 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. novicida (strain U112)
Q5NEF9 5.5e-165 468 63 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
B2SEJ7 5.5e-165 468 63 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14FW2 5.5e-165 468 63 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BP64 2.25e-164 466 62 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5X5 2.25e-164 466 62 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. holarctica (strain LVS)
A7N9A5 2.25e-164 466 62 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A4J081 2.41e-164 466 62 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. tularensis (strain WY96-3418)
B0TW32 2.54e-164 466 62 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q7U353 1.64e-163 465 58 0 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Blochmanniella floridana
P57349 1.57e-162 462 58 0 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q21K42 2.13e-162 462 63 3 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2SJL8 1.01e-161 460 62 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Hahella chejuensis (strain KCTC 2396)
B0VBY5 2.34e-161 459 64 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain AYE)
A3M7G3 2.34e-161 459 64 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VUD6 2.34e-161 459 64 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain SDF)
B7I4K8 2.34e-161 459 64 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain AB0057)
B7GZ21 2.34e-161 459 64 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain AB307-0294)
B2HVN5 5.08e-161 459 64 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain ACICU)
Q1QUR7 1.27e-160 458 63 1 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q145K0 5.11e-159 454 60 2 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Paraburkholderia xenovorans (strain LB400)
Q6FCW2 4.52e-157 449 62 5 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q63QY5 1.9e-156 447 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia pseudomallei (strain K96243)
A3NDE4 1.9e-156 447 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia pseudomallei (strain 668)
B2SX74 2.09e-156 447 59 3 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q3JNT6 2.19e-156 447 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia pseudomallei (strain 1710b)
A3NZ55 2.19e-156 447 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia pseudomallei (strain 1106a)
A1V076 2.94e-156 447 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia mallei (strain SAVP1)
Q62H98 2.94e-156 447 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia mallei (strain ATCC 23344)
A2S5A6 2.94e-156 447 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia mallei (strain NCTC 10229)
A3MP84 2.94e-156 447 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia mallei (strain NCTC 10247)
Q8XVV4 7.15e-156 445 59 1 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2SZ45 2.23e-155 445 57 2 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A9AH63 2.6e-155 444 58 1 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia multivorans (strain ATCC 17616 / 249)
B2UC85 9.03e-155 442 59 1 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Ralstonia pickettii (strain 12J)
Q0ADM9 2.44e-154 441 59 1 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q039P7 3.15e-154 441 57 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P59460 3.17e-154 441 56 1 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q31GM9 7.5e-154 441 61 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q0BI73 1.92e-153 440 58 1 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q82VV0 2.25e-153 439 58 1 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0VQ25 5.08e-153 438 61 2 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1LJ45 6.12e-153 437 59 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B2JGI9 1.21e-152 437 57 2 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q46XF1 1.65e-152 436 58 2 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A4G213 7.27e-152 435 57 5 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Herminiimonas arsenicoxydans
Q1GZF5 1.18e-151 434 59 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B1YTE9 1.3e-151 435 57 3 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia ambifaria (strain MC40-6)
Q5WWV9 1.7e-151 434 56 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Legionella pneumophila (strain Lens)
Q8K9Q8 2.03e-151 434 56 0 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7MBE1 5.2e-151 434 57 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5ZVQ1 5.42e-151 432 56 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IBN1 6.32e-151 432 56 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Legionella pneumophila (strain Corby)
Q8D397 9.3e-151 432 52 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Wigglesworthia glossinidia brevipalpis
B3R6Q0 1.33e-150 432 59 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q5X5H6 4.14e-150 430 56 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Legionella pneumophila (strain Paris)
Q0K720 1.89e-149 429 59 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B1JVW3 2.81e-149 429 56 2 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia orbicola (strain MC0-3)
Q39JI1 2.83e-149 429 56 2 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B9DNH6 3.25e-149 428 56 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus carnosus (strain TM300)
A6SUW6 6.94e-149 428 57 5 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Janthinobacterium sp. (strain Marseille)
Q9KDF2 1.26e-148 427 57 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A4JBM2 1.76e-148 427 57 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia vietnamiensis (strain G4 / LMG 22486)
B1HUL3 1.92e-148 427 56 4 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Lysinibacillus sphaericus (strain C3-41)
Q3J9J6 3.39e-148 426 58 1 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B1YJE9 7.78e-148 425 56 3 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A1TWB8 8.48e-147 422 57 4 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Paracidovorax citrulli (strain AAC00-1)
A6TUB2 1.93e-146 421 56 2 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Alkaliphilus metalliredigens (strain QYMF)
Q2KZ71 2.28e-146 421 58 6 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella avium (strain 197N)
Q21RZ7 8.3e-146 420 57 5 383 3 mnmA tRNA-specific 2-thiouridylase MnmA Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q49Y59 1.12e-145 419 56 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5WHN4 1.21e-145 419 55 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Shouchella clausii (strain KSM-K16)
A1K983 1.53e-145 419 58 6 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Azoarcus sp. (strain BH72)
A4SZU5 1.7e-145 419 57 3 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q5KWT8 2.03e-145 419 56 2 357 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Geobacillus kaustophilus (strain HTA426)
Q8CSA5 2.85e-145 419 56 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNS9 2.85e-145 419 56 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
C1CP03 3.41e-145 418 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain Taiwan19F-14)
Q97T38 3.41e-145 418 58 3 363 1 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A3CRB2 4.67e-145 418 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus sanguinis (strain SK36)
A4IR87 5.86e-145 418 56 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Geobacillus thermodenitrificans (strain NG80-2)
Q5L186 6.24e-145 417 57 2 360 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Geobacillus kaustophilus (strain HTA426)
C1CI29 7e-145 417 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain P1031)
B2IRK2 8.52e-145 417 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain CGSP14)
B8ZK04 9.2e-145 417 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q88V96 1.44e-144 417 55 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C1CAE7 1.59e-144 417 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain 70585)
B1I833 1.66e-144 417 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain Hungary19A-6)
Q7U359 1.88e-144 416 58 5 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7U375 1.88e-144 416 58 5 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7U387 1.88e-144 416 58 5 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8CXC7 2.17e-144 416 54 3 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A8MEV9 2.55e-144 416 57 2 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Alkaliphilus oremlandii (strain OhILAs)
Q8CWW0 2.83e-144 416 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04MV1 2.83e-144 416 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4L6W8 4.71e-144 415 55 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus haemolyticus (strain JCSC1435)
B9MIA2 8.49e-144 415 56 4 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Acidovorax ebreus (strain TPSY)
Q03EZ6 9.69e-144 415 55 6 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A8AU84 1.05e-143 414 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
P66979 1.11e-143 414 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P66978 1.11e-143 414 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus agalactiae serotype III (strain NEM316)
Q38XI3 1.46e-143 414 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Latilactobacillus sakei subsp. sakei (strain 23K)
Q1BZ27 1.48e-143 415 56 2 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia orbicola (strain AU 1054)
A0K4M4 1.48e-143 415 56 2 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia cenocepacia (strain HI2424)
Q47AW0 1.59e-143 414 56 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Dechloromonas aromatica (strain RCB)
C1CBU0 3.13e-143 413 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain JJA)
B4EE50 4.61e-143 414 56 2 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q2Y6T6 6.19e-143 412 59 1 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q3JYG1 9.02e-143 412 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B5E605 1.15e-142 412 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae serotype 19F (strain G54)
A2RLX1 1.22e-142 412 57 4 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactococcus lactis subsp. cremoris (strain MG1363)
Q8DRS4 1.94e-142 411 56 3 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q030C8 2.37e-142 411 56 4 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactococcus lactis subsp. cremoris (strain SK11)
A4VYE7 2.39e-142 411 57 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus suis (strain 05ZYH33)
A4W4N7 2.39e-142 411 57 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus suis (strain 98HAH33)
A7Z745 2.62e-142 411 56 4 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5P7R7 3.66e-142 410 56 6 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q122U9 3.68e-142 412 55 4 378 3 mnmA tRNA-specific 2-thiouridylase MnmA Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q2YT57 4.02e-142 410 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain bovine RF122 / ET3-1)
A1WD47 4.39e-142 410 55 4 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Acidovorax sp. (strain JS42)
Q9CHA1 8.41e-142 410 57 4 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactococcus lactis subsp. lactis (strain IL1403)
A5CW80 1.19e-141 409 56 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q5F7G4 1.49e-141 409 57 4 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A8Z4F9 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain USA300 / TCH1516)
Q6GG82 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain MRSA252)
Q99TM8 2.31e-141 409 54 4 362 1 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain N315)
Q931Q6 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHG3 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain Newman)
Q5HFE1 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain COL)
A5ITE6 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain JH9)
Q2FXV6 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGA5 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain USA300)
A6U290 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain JH1)
A7X333 2.31e-141 409 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q65GR9 2.63e-141 409 55 3 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A9IQK6 3.75e-141 408 57 6 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A2SLT0 4.03e-141 409 54 6 392 3 mnmA tRNA-specific 2-thiouridylase MnmA Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1XX60 4.4e-141 408 56 4 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
O35020 4.43e-141 408 55 3 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus subtilis (strain 168)
Q8NW84 5.29e-141 408 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain MW2)
Q6G8U8 5.29e-141 408 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain MSSA476)
B9DWD3 7.03e-141 407 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q6HDD0 1.36e-140 407 53 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634E9 1.36e-140 407 53 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cereus (strain ZK / E33L)
B9IYG1 1.36e-140 407 53 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cereus (strain Q1)
A0RJ05 1.36e-140 407 53 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus thuringiensis (strain Al Hakam)
Q81JE5 1.64e-140 406 53 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus anthracis
A8FFP0 1.72e-140 406 55 3 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus pumilus (strain SAFR-032)
Q730D7 4.74e-140 405 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0AIW1 4.95e-140 405 54 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A7GT74 5.22e-140 405 53 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q1WTT7 5.99e-140 405 55 7 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Ligilactobacillus salivarius (strain UCC118)
B0S3R4 7.51e-140 404 55 4 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
B4U0P1 8.96e-140 405 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q812R6 9.32e-140 404 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q04B58 9.9e-140 404 54 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q92BK1 1.4e-139 404 53 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q1GAS1 1.67e-139 404 54 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q8Y714 2e-139 404 54 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3SKH7 2e-139 403 58 2 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Thiobacillus denitrificans (strain ATCC 25259)
Q5FKU0 2.1e-139 404 53 5 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5M249 3.46e-139 403 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXJ9 3.46e-139 403 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus thermophilus (strain CNRZ 1066)
Q0A8N7 3.58e-139 403 58 2 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1VTY5 5.05e-139 404 54 4 378 3 mnmA tRNA-specific 2-thiouridylase MnmA Polaromonas naphthalenivorans (strain CJ2)
C0MB53 6.82e-139 402 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus equi subsp. equi (strain 4047)
C0MGQ2 1.33e-138 402 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus equi subsp. zooepidemicus (strain H70)
Q71ZF8 1.4e-138 402 53 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria monocytogenes serotype 4b (strain F2365)
C1KVF9 1.4e-138 402 53 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria monocytogenes serotype 4b (strain CLIP80459)
B8DDZ8 1.47e-138 401 53 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria monocytogenes serotype 4a (strain HCC23)
A2RH05 2.47e-138 401 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J455 2.47e-138 401 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5X9C1 2.47e-138 401 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1JED4 2.5e-138 401 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M2 (strain MGAS10270)
A1KUY0 2.88e-138 400 58 4 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q03I88 4.17e-138 400 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q1JJD5 4.17e-138 400 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1J988 4.17e-138 400 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M12 (strain MGAS2096)
A9VIM2 4.64e-138 400 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus mycoides (strain KBAB4)
P58075 5.24e-138 400 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M1
Q820U1 5.92e-138 400 55 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Enterococcus faecalis (strain ATCC 700802 / V583)
A1WEN1 6.42e-138 400 54 4 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Verminephrobacter eiseniae (strain EF01-2)
Q8NZ00 1.01e-137 399 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M18 (strain MGAS8232)
A9M0Y5 1.06e-137 399 58 4 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria meningitidis serogroup C (strain 053442)
A9NDN1 1.28e-137 399 53 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain RSA 331 / Henzerling II)
Q48QM8 2.05e-137 399 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M28 (strain MGAS6180)
B5XJA6 2.72e-137 398 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M49 (strain NZ131)
Q9JYJ6 3.18e-137 398 58 4 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q820W2 4.15e-137 397 53 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A1AX17 4.29e-137 397 54 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Ruthia magnifica subsp. Calyptogena magnifica
B6IZW5 4.59e-137 398 53 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain CbuG_Q212)
A9KE87 6.35e-137 397 53 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain Dugway 5J108-111)
B6J7H5 1.13e-136 397 53 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain CbuK_Q154)
A8YUQ2 1.18e-136 397 53 5 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus helveticus (strain DPC 4571)
P0DC35 3.43e-136 395 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC34 3.43e-136 395 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9JTJ9 6.33e-136 395 56 4 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q74JW9 9.27e-136 394 52 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q042R4 1.78e-135 394 52 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q03QJ0 2.34e-135 394 55 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8P9A1 2.4e-135 394 55 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RT32 2.4e-135 394 55 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas campestris pv. campestris (strain B100)
Q4UUJ7 2.4e-135 394 55 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas campestris pv. campestris (strain 8004)
A9BS40 3.31e-134 390 56 4 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Delftia acidovorans (strain DSM 14801 / SPH-1)
Q8PL08 8.23e-133 387 54 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas axonopodis pv. citri (strain 306)
Q3BTY6 1.02e-132 387 54 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q6MA75 4.26e-132 385 54 4 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Protochlamydia amoebophila (strain UWE25)
B2FQX2 1.58e-131 384 55 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Stenotrophomonas maltophilia (strain K279a)
B4SIN4 6.68e-131 382 54 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Stenotrophomonas maltophilia (strain R551-3)
Q5GZR1 1.05e-130 382 54 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SMD7 1.05e-130 382 54 2 359 3 mnmA1 tRNA-specific 2-thiouridylase MnmA Xanthomonas oryzae pv. oryzae (strain PXO99A)
B2G6L9 1.54e-129 379 52 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJ48 1.54e-129 379 52 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Limosilactobacillus reuteri (strain DSM 20016)
A5EVB4 2.28e-129 378 55 4 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Dichelobacter nodosus (strain VCS1703A)
B2GB92 3.34e-129 378 50 7 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q9PDD9 2.73e-126 370 52 2 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Xylella fastidiosa (strain 9a5c)
B0U6Q7 2.88e-126 370 53 2 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Xylella fastidiosa (strain M12)
Q2P2Q7 3.46e-126 370 53 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q87DM0 1.07e-124 367 52 2 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9X8 1.07e-124 367 52 2 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Xylella fastidiosa (strain M23)
Q6F152 2.32e-121 358 47 5 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
O84289 1.38e-119 353 49 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9PKA7 1.56e-119 353 50 7 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia muridarum (strain MoPn / Nigg)
Q3KM75 2.46e-119 352 49 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
A5IYK6 4.56e-119 352 50 7 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
B0BBR8 4.67e-119 351 49 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7K3 4.67e-119 351 49 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q2SRW8 1.18e-118 351 46 6 378 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q9Z8A5 6.06e-118 348 50 5 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia pneumoniae
Q057R1 6.09e-118 349 48 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q6MTG1 1.89e-117 348 46 6 378 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q820E9 2.71e-116 344 49 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B5ZBP8 5.41e-116 344 47 6 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
A9NFP7 4.18e-115 342 47 4 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Acholeplasma laidlawii (strain PG-8A)
Q5L6D1 5.24e-115 341 49 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia abortus (strain DSM 27085 / S26/3)
Q253W3 1.9e-113 337 48 6 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia felis (strain Fe/C-56)
A1WWV9 1.46e-112 336 49 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Halorhodospira halophila (strain DSM 244 / SL1)
Q98Q11 1.15e-111 333 46 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasmopsis pulmonis (strain UAB CTIP)
A8ES36 7.9e-111 331 47 2 363 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Aliarcobacter butzleri (strain RM4018)
Q9PQ88 7.11e-107 321 47 9 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ41 7.11e-107 321 47 9 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q8CXQ3 1.88e-106 320 45 8 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Malacoplasma penetrans (strain HF-2)
Q4A634 6.57e-106 318 47 9 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasmopsis synoviae (strain 53)
B3PM68 3.14e-105 317 47 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Metamycoplasma arthritidis (strain 158L3-1)
Q6YR90 2.81e-104 315 44 4 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Onion yellows phytoplasma (strain OY-M)
Q2NIM9 1.42e-103 313 43 4 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Aster yellows witches'-broom phytoplasma (strain AYWB)
A0M3J2 1.64e-102 310 45 10 400 3 mnmA tRNA-specific 2-thiouridylase MnmA Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B1VAX7 3.1e-102 309 44 4 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Phytoplasma australiense
Q6KHK4 1.16e-101 307 43 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q4A9Q7 2.03e-100 304 43 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q600M2 2.03e-100 304 43 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mesomycoplasma hyopneumoniae (strain 232)
A6H0G9 4.72e-100 304 42 10 400 3 mnmA tRNA-specific 2-thiouridylase MnmA Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q4A7U1 8.9e-100 303 43 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mesomycoplasma hyopneumoniae (strain 7448)
A5FHA9 1.38e-96 295 42 10 400 3 mnmA tRNA-specific 2-thiouridylase MnmA Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q67LS2 6.76e-96 293 44 6 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8RAH7 1.08e-94 290 44 9 368 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B1ZZ32 2.6e-94 289 43 7 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q5ZKW0 3.42e-94 290 40 5 393 2 TRMU Mitochondrial tRNA-specific 2-thiouridylase 1 Gallus gallus
B2A5K1 1.01e-93 287 42 6 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B0K0P8 2.02e-92 284 42 8 368 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Thermoanaerobacter sp. (strain X514)
B0K991 2.02e-92 284 42 8 368 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
O75648 5.38e-92 285 40 6 385 1 TRMU Mitochondrial tRNA-specific 2-thiouridylase 1 Homo sapiens
Q9W5B6 5.86e-92 283 40 6 359 2 CG3021 Mitochondrial tRNA-specific 2-thiouridylase 1 Drosophila melanogaster
B2UPK4 1.11e-91 281 44 4 344 3 mnmA tRNA-specific 2-thiouridylase MnmA Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q74A22 7.79e-91 280 41 7 375 3 mnmA tRNA-specific 2-thiouridylase MnmA Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q9DAT5 4.99e-90 279 40 6 385 1 Trmu Mitochondrial tRNA-specific 2-thiouridylase 1 Mus musculus
Q7NBZ0 2.58e-89 285 41 9 375 3 ribF/mnmA Trifunctional protein RibF/MnmA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q5RB73 5.9e-89 277 40 7 386 2 TRMU Mitochondrial tRNA-specific 2-thiouridylase 1 Pongo abelii
Q3B625 1.99e-88 273 41 8 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B2J5L9 3.08e-88 273 42 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q503J2 4.24e-88 274 41 7 385 2 trmu Mitochondrial tRNA-specific 2-thiouridylase 1 Danio rerio
A8Z5W4 1.26e-87 272 40 7 387 3 mnmA tRNA-specific 2-thiouridylase MnmA Karelsulcia muelleri (strain GWSS)
Q39XA9 2.17e-87 271 41 7 377 3 mnmA tRNA-specific 2-thiouridylase MnmA Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q8YX56 2.38e-87 270 42 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8XJH3 3.74e-87 270 39 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium perfringens (strain 13 / Type A)
Q0TPH2 3.74e-87 270 39 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q18BE2 5.88e-87 270 38 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridioides difficile (strain 630)
Q3M5R7 6.8e-87 269 42 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3AA24 8.62e-87 269 41 7 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q0SS39 2.41e-86 268 38 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium perfringens (strain SM101 / Type A)
A9KPI9 5.94e-86 267 39 6 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B7K1G5 7.16e-86 266 41 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Rippkaea orientalis (strain PCC 8801 / RF-1)
A5N749 1.28e-85 266 41 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B1WC37 1.2e-84 266 37 6 409 2 Trmu Mitochondrial tRNA-specific 2-thiouridylase 1 Rattus norvegicus
Q894S7 1.91e-84 263 39 6 365 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium tetani (strain Massachusetts / E88)
B1KZE1 1.94e-84 263 39 6 365 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain Loch Maree / Type A3)
B0JVR4 2.2e-84 263 41 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B2THM7 5.36e-84 262 39 7 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium botulinum (strain Eklund 17B / Type B)
A5GE36 7.34e-84 262 40 8 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Geotalea uraniireducens (strain Rf4)
B8CWH7 7.87e-84 261 39 6 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B1IIY2 1.07e-83 261 39 6 365 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain Okra / Type B1)
A7GHC7 1.37e-83 261 38 6 361 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A5I123 1.4e-83 261 39 6 365 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FT69 1.4e-83 261 39 6 365 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain ATCC 19397 / Type A)
A7GCM3 1.53e-83 261 39 6 365 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B0KC14 1.66e-83 261 38 6 370 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q3A3F8 1.77e-83 260 43 9 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q02BG1 2.33e-83 261 40 9 379 3 mnmA tRNA-specific 2-thiouridylase MnmA Solibacter usitatus (strain Ellin6076)
B1X0U7 2.49e-83 260 41 7 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Crocosphaera subtropica (strain ATCC 51142 / BH68)
A3DDC8 4.63e-83 259 40 8 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8R7F0 4.99e-83 259 38 6 370 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B0K584 5.38e-83 259 38 6 370 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Thermoanaerobacter sp. (strain X514)
P73755 6.08e-83 259 41 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6LSF2 6.99e-83 259 38 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P47537 2.18e-82 258 38 6 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
B3E966 3.24e-82 257 42 9 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q17440 4.08e-82 258 40 10 371 3 mttu-1 Probable mitochondrial tRNA-specific 2-thiouridylase 1 Caenorhabditis elegans
B1ILH4 5.22e-82 256 38 6 360 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain Okra / Type B1)
A4J2K1 6.01e-82 257 39 8 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A5D3F0 6.66e-82 257 39 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q5MZ36 1.2e-81 256 40 8 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31N30 1.2e-81 256 40 8 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B1XM11 2.27e-81 255 40 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A5I5Y9 3.21e-81 254 38 6 360 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXG3 3.21e-81 254 38 6 360 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain ATCC 19397 / Type A)
B1KZJ2 3.28e-81 254 38 6 360 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain Loch Maree / Type A3)
B2V3V9 5.7e-80 252 39 7 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium botulinum (strain Alaska E43 / Type E3)
B7KHE5 7.76e-80 251 39 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Gloeothece citriformis (strain PCC 7424)
Q97GY2 2.86e-79 249 38 6 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A5UV64 5.04e-79 249 40 8 377 3 mnmA tRNA-specific 2-thiouridylase MnmA Roseiflexus sp. (strain RS-1)
A9AYA7 8.19e-79 249 39 8 375 3 mnmA tRNA-specific 2-thiouridylase MnmA Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A0Q152 2.88e-78 247 39 5 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium novyi (strain NT)
Q3ATZ5 1.07e-77 246 39 7 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium chlorochromatii (strain CaD3)
A1BI85 1.23e-77 246 38 7 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B0TFA7 1.66e-77 246 39 8 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B3EN11 1.9e-77 245 38 5 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium phaeobacteroides (strain BS1)
P75365 5.78e-77 244 39 9 373 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A0L678 1.16e-76 243 38 6 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q2RHY7 4.05e-76 242 40 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A7NK07 6.95e-76 241 40 8 375 3 mnmA tRNA-specific 2-thiouridylase MnmA Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B0CE39 7.22e-76 241 38 7 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Acaryochloris marina (strain MBIC 11017)
B5RQ24 2.25e-75 239 34 7 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia recurrentis (strain A1)
B5RMM8 3.14e-75 239 34 7 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia duttonii (strain Ly)
Q118B7 3.96e-75 239 38 8 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Trichodesmium erythraeum (strain IMS101)
Q8R5X3 6.8e-75 239 40 11 368 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B5ENY8 1.19e-74 238 39 7 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J5X6 1.19e-74 238 39 7 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q73PV6 3.6e-74 237 40 8 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A4SD47 4.6e-74 236 36 6 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A0LEL7 5.04e-74 236 39 8 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q7MBC9 6.63e-74 236 37 8 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q896F5 1.5e-73 235 38 5 355 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium tetani (strain Massachusetts / E88)
Q2LWA6 1.57e-73 236 38 8 359 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Syntrophus aciditrophicus (strain SB)
Q1IPC9 1.97e-73 235 37 8 378 3 mnmA tRNA-specific 2-thiouridylase MnmA Koribacter versatilis (strain Ellin345)
Q2JY34 5.65e-73 234 38 6 350 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain JA-3-3Ab)
O13947 5.66e-73 235 36 10 380 3 SPAC23H4.04 Mitochondrial tRNA-specific 2-thiouridylase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0SMH1 6.01e-73 233 34 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borreliella afzelii (strain PKo)
A5GUP6 6.45e-73 234 39 8 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain RCC307)
Q2RZN9 1.07e-72 234 40 7 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Salinibacter ruber (strain DSM 13855 / M31)
A1R0A7 1.52e-72 232 34 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia turicatae (strain 91E135)
Q2JM78 1.74e-72 233 39 7 350 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain JA-2-3B'a(2-13))
B2S125 2.32e-72 232 34 6 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia hermsii (strain HS1 / DAH)
Q5SLN5 2.81e-72 232 39 9 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72GX1 2.81e-72 232 39 9 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q660I8 3.19e-72 231 34 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q7VAT9 3.58e-72 233 37 8 380 3 mnmA tRNA-specific 2-thiouridylase MnmA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B7J2N7 4.96e-72 231 33 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borreliella burgdorferi (strain ZS7)
A6KZ28 6.1e-72 231 38 9 364 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B8G5F1 7.6e-72 231 40 6 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chloroflexus aggregans (strain MD-66 / DSM 9485)
O51625 9.56e-72 230 33 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q7TTZ4 1.89e-71 231 35 8 397 3 mnmA tRNA-specific 2-thiouridylase MnmA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B1LV15 2.02e-71 230 38 9 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q1J090 2.65e-71 230 38 9 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q7TTR0 2.65e-71 231 37 8 381 3 mnmA tRNA-specific 2-thiouridylase MnmA Prochlorococcus marinus (strain MIT 9313)
A4XLP5 3.23e-71 229 36 8 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q8CWM0 3.41e-71 229 38 8 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7TTU4 7.92e-71 229 39 9 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Parasynechococcus marenigrum (strain WH8102)
A5GMJ9 1.13e-70 229 38 8 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain WH7803)
Q24US9 1.78e-70 228 36 9 377 3 mnmA tRNA-specific 2-thiouridylase MnmA Desulfitobacterium hafniense (strain Y51)
Q9ZDM1 2.07e-70 227 36 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia prowazekii (strain Madrid E)
A2CB44 2.32e-70 228 37 8 381 3 mnmA tRNA-specific 2-thiouridylase MnmA Prochlorococcus marinus (strain MIT 9303)
Q92IL0 2.38e-70 227 36 6 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8KBD3 2.44e-70 227 36 6 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A8F172 2.53e-70 227 35 6 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia massiliae (strain Mtu5)
B0SPC6 2.68e-70 228 37 8 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SG84 2.68e-70 228 37 8 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q2GDU3 3e-70 227 35 7 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
A2BXZ8 3.82e-70 227 36 9 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Prochlorococcus marinus (strain MIT 9515)
Q2RSS1 4.27e-70 227 37 9 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
C4K1W0 4.93e-70 226 36 6 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia peacockii (strain Rustic)
A8GRJ5 6.25e-70 226 36 6 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia rickettsii (strain Sheila Smith)
B0BWZ7 6.25e-70 226 36 6 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia rickettsii (strain Iowa)
Q11G66 6.29e-70 227 37 9 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Chelativorans sp. (strain BNC1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07355
Feature type CDS
Gene mnmA
Product tRNA 2-thiouridine(34) synthase MnmA
Location 1534551 - 1535654 (strand: 1)
Length 1104 (nucleotides) / 367 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1977
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03054 tRNA methyl transferase HUP domain
PF20258 Aminomethyltransferase beta-barrel domain
PF20259 tRNA methyl transferase PRC-barrel domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0482 Translation, ribosomal structure and biogenesis (J) J tRNA U34 2-thiouridine synthase MnmA/TrmU, contains the PP-loop ATPase domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00566 tRNA-uridine 2-sulfurtransferase [EC:2.8.1.13] Sulfur relay system -

Protein Sequence

MSDNSQKKVIVGMSGGVDSSVSAWLLQQQGYQVTGLFMKNWEEDDDTEYCSAAADLADAQAVCDKLGIELLTVNFAAEYWDNVFELFLEEYKAGRTPNPDILCNKEIKFKAFLEYAAEDLGADYIATGHYVRRRDINGTTQLLRGLDGNKDQSYFLYTLSHEQVAQSLFPVGELEKPEVRRIAEELDLITAKKKDSTGICFIGERKFRDFLARYLPAKPGPIMTVDGQEIGQHDGLMYHTLGQRKGLRIGGTRDGSEEPWYVVDKDVENNLLIVAQGHEHPRLMSVGLIAQQLDWVSREPLAHPLRCVVKTRYRQEDIPCTVTPLGEDKISVRFDIPVAAVTPGQSAVFYQDEVCLGGGIIEARITE

Flanking regions ( +/- flanking 50bp)

CTGCGCCTTTTTGCGTGTGCGGAGCTTCCCAATCGCCGCGAGATCAGCTCATGTCAGATAACAGCCAGAAAAAAGTCATCGTCGGTATGTCCGGTGGTGTGGATTCCTCCGTCTCAGCCTGGTTACTGCAACAACAGGGATATCAGGTGACCGGGCTGTTTATGAAGAACTGGGAAGAGGATGATGATACAGAATACTGCTCAGCCGCTGCCGACCTTGCCGATGCGCAGGCGGTGTGTGATAAGCTCGGCATTGAACTTCTGACCGTCAATTTCGCCGCTGAATACTGGGATAATGTATTTGAGCTTTTCCTGGAAGAGTATAAAGCCGGGCGCACACCAAACCCGGATATTCTCTGTAATAAAGAGATTAAATTCAAAGCATTCCTGGAATATGCCGCAGAAGATCTTGGCGCTGACTATATCGCTACCGGTCACTATGTCCGCCGCCGTGATATTAACGGCACAACGCAGTTATTACGCGGACTGGACGGCAATAAAGATCAAAGCTATTTCCTTTATACATTAAGTCATGAGCAGGTGGCGCAGAGCCTGTTCCCGGTCGGCGAACTGGAAAAACCGGAAGTCCGCCGTATTGCGGAAGAATTAGATCTTATCACAGCAAAGAAAAAAGACTCCACCGGCATCTGTTTTATCGGGGAGCGCAAGTTCCGTGATTTCCTTGCCCGTTATTTACCGGCAAAACCCGGTCCGATTATGACTGTGGACGGGCAGGAAATCGGTCAGCATGACGGGCTGATGTACCACACTCTCGGACAGCGCAAAGGGTTACGCATCGGCGGCACGCGTGACGGCTCAGAAGAACCCTGGTATGTCGTTGATAAAGATGTTGAAAACAATTTACTGATTGTTGCCCAGGGCCATGAGCACCCGCGTCTGATGTCTGTCGGGCTGATTGCACAACAACTGGATTGGGTATCACGGGAGCCGCTGGCACACCCGCTGCGCTGTGTTGTCAAAACACGTTACCGCCAGGAAGATATTCCCTGTACTGTTACCCCGCTCGGTGAAGATAAAATCAGTGTCCGGTTTGATATCCCGGTCGCGGCCGTTACACCGGGTCAGTCTGCTGTTTTCTATCAGGATGAAGTCTGCCTGGGCGGCGGGATCATTGAAGCGCGAATTACGGAGTAACTGTGGCTAAAAATTACGATGACATTACCCTCGCTCTGGCGGGTATCTGC