Homologs in group_1977

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14560 FBDBKF_14560 100.0 Morganella morganii S1 mnmA tRNA 2-thiouridine(34) synthase MnmA
NLDBIP_15895 NLDBIP_15895 100.0 Morganella morganii S4 mnmA tRNA 2-thiouridine(34) synthase MnmA
LHKJJB_15945 LHKJJB_15945 100.0 Morganella morganii S3 mnmA tRNA 2-thiouridine(34) synthase MnmA
HKOGLL_15065 HKOGLL_15065 100.0 Morganella morganii S5 mnmA tRNA 2-thiouridine(34) synthase MnmA
F4V73_RS07355 F4V73_RS07355 95.1 Morganella psychrotolerans mnmA tRNA 2-thiouridine(34) synthase MnmA
PMI_RS04365 PMI_RS04365 87.5 Proteus mirabilis HI4320 mnmA tRNA 2-thiouridine(34) synthase MnmA

Distribution of the homologs in the orthogroup group_1977

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1977

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EVG2 0.0 682 87 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Proteus mirabilis (strain HI4320)
Q7MB22 0.0 679 86 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JLK6 0.0 672 86 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JI67 0.0 667 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669Q4 0.0 667 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLN3 0.0 667 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis (strain Pestoides F)
Q1CI58 0.0 667 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R0L5 0.0 667 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFQ5 0.0 667 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis
B2K711 0.0 667 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6S0 0.0 667 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pestis bv. Antiqua (strain Antiqua)
A7FH61 0.0 666 85 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5B8B9 0.0 664 85 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Edwardsiella ictaluri (strain 93-146)
A8GDD5 0.0 661 83 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Serratia proteamaculans (strain 568)
C6DFW7 0.0 654 83 1 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7MFV2 0.0 650 84 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Cronobacter sakazakii (strain ATCC BAA-894)
Q6D4E9 0.0 649 83 1 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6T7K3 0.0 627 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XSN3 0.0 626 85 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Klebsiella pneumoniae (strain 342)
B1LI10 0.0 624 84 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain SMS-3-5 / SECEC)
Q83LF7 0.0 623 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella flexneri
Q0T5N9 0.0 623 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella flexneri serotype 5b (strain 8401)
P25745 0.0 623 83 1 365 1 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain K12)
B1IUD4 0.0 623 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZ88 0.0 623 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O9:H4 (strain HS)
B1XA43 0.0 623 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain K12 / DH10B)
Q8X735 0.0 623 84 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O157:H7
A7ZKS3 0.0 623 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31ZK9 0.0 623 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella boydii serotype 4 (strain Sb227)
Q8ZPZ4 0.0 622 83 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3Z2Y6 0.0 622 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella sonnei (strain Ss046)
B2TZ86 0.0 622 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q32EZ1 0.0 621 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Shigella dysenteriae serotype 1 (strain Sd197)
Q8Z7G9 0.0 621 83 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella typhi
A9N4K8 0.0 621 83 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PMJ4 0.0 621 83 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC0 0.0 620 83 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella choleraesuis (strain SC-B67)
A9MG80 0.0 620 84 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4W9E5 0.0 619 83 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Enterobacter sp. (strain 638)
Q1RD20 0.0 619 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli (strain UTI89 / UPEC)
Q0TIU0 0.0 619 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AA27 0.0 619 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O1:K1 / APEC
A8AHK2 0.0 617 83 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8CXZ8 0.0 613 83 1 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2NU15 0.0 605 77 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Sodalis glossinidius (strain morsitans)
C4L952 0.0 603 79 0 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0KI53 0.0 602 79 1 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SKS0 0.0 601 78 1 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Aeromonas salmonicida (strain A449)
Q0I5Y6 0.0 598 78 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Histophilus somni (strain 129Pt)
B0UWF2 0.0 594 77 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Histophilus somni (strain 2336)
Q5QYZ7 0.0 592 76 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q9KSX8 0.0 589 77 2 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2F2 0.0 589 77 2 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q4QP16 0.0 588 79 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Haemophilus influenzae (strain 86-028NP)
P44551 0.0 586 79 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1STI9 0.0 584 76 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q9CLA3 0.0 582 77 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Pasteurella multocida (strain Pm70)
Q7U342 0.0 578 75 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6LT18 0.0 575 75 3 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Photobacterium profundum (strain SS9)
Q7MLT4 0.0 574 75 3 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio vulnificus (strain YJ016)
A5UFX6 0.0 573 78 1 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Haemophilus influenzae (strain PittGG)
A1S7B1 0.0 571 74 0 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q15T93 0.0 570 73 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q87QL9 0.0 570 75 3 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8CWJ6 0.0 569 75 3 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio vulnificus (strain CMCP6)
B5FG83 0.0 566 74 3 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Aliivibrio fischeri (strain MJ11)
Q5E3W7 0.0 566 74 3 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Aliivibrio fischeri (strain ATCC 700601 / ES114)
B0BS63 0.0 565 75 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3MYN0 0.0 565 75 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A7MSW1 0.0 563 74 2 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Vibrio campbellii (strain ATCC BAA-1116)
Q8CX40 0.0 560 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HJT7 0.0 558 73 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sp. (strain MR-4)
B8CLH4 0.0 557 73 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella piezotolerans (strain WP3 / JCM 13877)
A3QD79 0.0 557 72 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0HW33 0.0 556 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sp. (strain MR-7)
A0KW11 0.0 555 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sp. (strain ANA-3)
A8H5M1 0.0 552 72 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TQ02 0.0 552 73 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella halifaxensis (strain HAW-EB4)
Q65VV2 0.0 551 76 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A9L4G9 0.0 550 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella baltica (strain OS195)
A6WP69 0.0 550 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella baltica (strain OS185)
A3D5F8 0.0 550 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E945 0.0 550 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella baltica (strain OS223)
A4Y7M1 0.0 547 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q3IH16 0.0 547 71 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudoalteromonas translucida (strain TAC 125)
A1RIW8 0.0 546 72 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sp. (strain W3-18-1)
A8FUG9 0.0 546 70 0 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella sediminis (strain HAW-EB3)
Q480B8 0.0 544 69 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B1KID0 0.0 542 70 0 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella woodyi (strain ATCC 51908 / MS32)
Q12N64 0.0 541 71 1 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A6VLY4 0.0 539 73 0 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q081F9 0.0 537 71 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Shewanella frigidimarina (strain NCIMB 400)
Q1LT51 0.0 536 68 0 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Baumannia cicadellinicola subsp. Homalodisca coagulata
C3JY68 0.0 522 69 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas fluorescens (strain SBW25)
Q4ZRK0 0.0 520 69 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas syringae pv. syringae (strain B728a)
A6W0E1 0.0 519 69 1 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Marinomonas sp. (strain MWYL1)
Q48H61 0.0 518 68 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q492R5 0.0 515 65 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Blochmanniella pennsylvanica (strain BPEN)
Q3KA70 0.0 514 68 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas fluorescens (strain Pf0-1)
Q87ZR6 0.0 513 68 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4K9U2 0.0 511 68 2 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A6V4G0 0.0 509 68 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas aeruginosa (strain PA7)
B1JBJ1 0.0 509 67 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas putida (strain W619)
A4XUY9 0.0 509 68 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas mendocina (strain ymp)
Q88FR9 1.65e-180 508 67 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A4VLW2 3.19e-180 507 67 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Stutzerimonas stutzeri (strain A1501)
Q1IBE4 3.96e-180 507 67 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas entomophila (strain L48)
A5W1G2 4.42e-180 507 67 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KMQ6 5.44e-180 506 67 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas putida (strain GB-1)
B7UV15 1.52e-178 503 68 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas aeruginosa (strain LESB58)
Q9I0L2 4.74e-178 502 68 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02NB8 4.74e-178 502 68 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Pseudomonas aeruginosa (strain UCBPP-PA14)
A1U1H5 1.19e-177 501 67 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A5WE20 3.9e-175 495 67 6 373 3 mnmA tRNA-specific 2-thiouridylase MnmA Psychrobacter sp. (strain PRwf-1)
Q607H5 1.86e-169 480 64 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q4FSB4 5.73e-168 478 65 5 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QBM4 1.47e-167 476 65 5 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A0Q454 2e-166 472 62 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. novicida (strain U112)
Q1QUR7 4.74e-166 472 64 1 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5NEF9 9.25e-166 470 62 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
B2SEJ7 9.25e-166 470 62 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14FW2 9.25e-166 470 62 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. tularensis (strain FSC 198)
A4J081 3.71e-165 468 62 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BP64 3.79e-165 468 62 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5X5 3.79e-165 468 62 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. holarctica (strain LVS)
A7N9A5 3.79e-165 468 62 2 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B0TW32 4.09e-165 468 61 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q2SJL8 7.65e-165 468 63 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Hahella chejuensis (strain KCTC 2396)
Q21K42 2.25e-164 467 63 3 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7U353 1.88e-161 459 57 0 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Blochmanniella floridana
P57349 1.36e-160 457 57 0 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B0VUD6 1.79e-160 457 63 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain SDF)
B0VBY5 2.01e-160 457 63 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain AYE)
A3M7G3 2.01e-160 457 63 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7I4K8 2.01e-160 457 63 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain AB0057)
B7GZ21 2.01e-160 457 63 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain AB307-0294)
B2HVN5 3.33e-160 457 63 4 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baumannii (strain ACICU)
Q3JNT6 1.52e-157 450 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia pseudomallei (strain 1710b)
A3NZ55 1.52e-157 450 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia pseudomallei (strain 1106a)
Q63QY5 1.57e-157 450 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia pseudomallei (strain K96243)
A3NDE4 1.57e-157 450 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia pseudomallei (strain 668)
Q6FCW2 2.06e-157 449 62 4 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1V076 2.74e-157 449 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia mallei (strain SAVP1)
Q62H98 2.74e-157 449 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia mallei (strain ATCC 23344)
A2S5A6 2.74e-157 449 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia mallei (strain NCTC 10229)
A3MP84 2.74e-157 449 58 2 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia mallei (strain NCTC 10247)
Q2SZ45 4.92e-157 449 57 2 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q145K0 4.93e-157 449 58 2 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Paraburkholderia xenovorans (strain LB400)
A9AH63 3.37e-156 447 57 1 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia multivorans (strain ATCC 17616 / 249)
Q0VQ25 4.81e-156 446 61 2 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8XVV4 2.33e-155 444 58 1 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2SX74 3.87e-155 444 58 3 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q039P7 8.4e-155 443 58 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q31GM9 1.12e-154 442 61 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B2UC85 1.32e-154 442 58 1 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Ralstonia pickettii (strain 12J)
Q0ADM9 1.53e-154 442 58 1 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0BI73 3.19e-154 442 57 1 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q46XF1 5.75e-154 440 58 2 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B2JGI9 6.43e-154 441 57 2 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q5WWV9 6.47e-154 440 56 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Legionella pneumophila (strain Lens)
Q8K9Q8 4.89e-153 438 57 0 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1GZF5 7.38e-153 437 57 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1LJ45 1e-152 437 57 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5ZVQ1 1.52e-152 437 56 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IBN1 1.81e-152 436 56 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Legionella pneumophila (strain Corby)
Q9KDF2 1.85e-152 437 57 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P59460 4.19e-152 436 56 1 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B1YTE9 5.24e-152 436 56 3 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia ambifaria (strain MC40-6)
Q82VV0 8.67e-152 435 57 1 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5X5H6 1.25e-151 434 55 1 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Legionella pneumophila (strain Paris)
A4G213 1.72e-151 434 56 5 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Herminiimonas arsenicoxydans
Q0K720 2.88e-151 433 58 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7MBE1 9.91e-151 433 56 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B3R6Q0 1e-150 432 57 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B1HUL3 1.24e-150 432 56 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Lysinibacillus sphaericus (strain C3-41)
Q39JI1 2.56e-150 432 55 2 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1JVW3 3.6e-150 432 55 2 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia orbicola (strain MC0-3)
B1YJE9 5.06e-150 431 56 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q3J9J6 4.34e-149 428 58 1 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A4JBM2 4.73e-149 429 56 2 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1TWB8 6.36e-149 428 56 4 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Paracidovorax citrulli (strain AAC00-1)
Q5WHN4 1.34e-148 427 55 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Shouchella clausii (strain KSM-K16)
B9DNH6 2.35e-148 426 55 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus carnosus (strain TM300)
Q88V96 2.91e-148 426 56 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A6SUW6 3.24e-148 426 56 5 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Janthinobacterium sp. (strain Marseille)
Q5KWT8 1.04e-147 425 56 2 357 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Geobacillus kaustophilus (strain HTA426)
Q21RZ7 1.31e-147 425 57 4 382 3 mnmA tRNA-specific 2-thiouridylase MnmA Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8D397 1.45e-147 424 51 0 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Wigglesworthia glossinidia brevipalpis
A6TUB2 1.97e-147 424 56 2 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Alkaliphilus metalliredigens (strain QYMF)
A4IR87 2.81e-147 424 56 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Geobacillus thermodenitrificans (strain NG80-2)
A3CRB2 3.32e-147 424 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus sanguinis (strain SK36)
Q03EZ6 4.16e-147 423 55 5 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A8MEV9 5.22e-147 422 58 2 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Alkaliphilus oremlandii (strain OhILAs)
B9MIA2 6.57e-147 422 56 4 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Acidovorax ebreus (strain TPSY)
A4SZU5 2.02e-146 421 57 3 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q38XI3 3.29e-146 421 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Latilactobacillus sakei subsp. sakei (strain 23K)
A1K983 5.13e-146 420 58 6 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Azoarcus sp. (strain BH72)
A8AU84 6.27e-146 420 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A5CW80 7.56e-146 420 57 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q47AW0 8.66e-146 419 56 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Dechloromonas aromatica (strain RCB)
Q2KZ71 1.24e-145 419 56 6 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella avium (strain 197N)
C1CI29 1.32e-145 419 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain P1031)
B2IRK2 1.35e-145 419 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain CGSP14)
Q2Y6T6 1.49e-145 419 59 1 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B8ZK04 1.55e-145 419 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CP03 2.13e-145 419 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain Taiwan19F-14)
Q97T38 2.13e-145 419 58 3 363 1 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1I833 2.3e-145 419 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain Hungary19A-6)
Q5L186 2.66e-145 419 56 2 360 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Geobacillus kaustophilus (strain HTA426)
A1WD47 3.15e-145 419 55 4 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Acidovorax sp. (strain JS42)
C1CAE7 3.19e-145 418 58 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain 70585)
Q8CSA5 3.4e-145 418 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNS9 3.4e-145 418 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CXC7 3.87e-145 418 54 3 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8CWW0 5.45e-145 418 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04MV1 5.45e-145 418 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q2YT57 6.91e-145 417 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain bovine RF122 / ET3-1)
A0AIW1 8.31e-145 417 54 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q49Y59 8.86e-145 417 55 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q122U9 1.89e-144 417 55 5 379 3 mnmA tRNA-specific 2-thiouridylase MnmA Polaromonas sp. (strain JS666 / ATCC BAA-500)
A8Z4F9 1.93e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain USA300 / TCH1516)
Q6GG82 1.93e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain MRSA252)
Q99TM8 1.93e-144 416 54 4 362 1 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain N315)
A6QHG3 1.93e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain Newman)
Q5HFE1 1.93e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain COL)
A5ITE6 1.93e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain JH9)
Q2FXV6 1.93e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGA5 1.93e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain USA300)
A6U290 1.93e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain JH1)
P66979 2e-144 416 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P66978 2e-144 416 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus agalactiae serotype III (strain NEM316)
Q931Q6 2.11e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X333 2.11e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q7U359 2.56e-144 416 57 5 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7U387 2.56e-144 416 57 5 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B4EE50 2.67e-144 417 56 2 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q7U375 2.73e-144 416 57 5 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q1BZ27 2.82e-144 417 56 2 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia orbicola (strain AU 1054)
A0K4M4 2.82e-144 417 56 2 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Burkholderia cenocepacia (strain HI2424)
Q92BK1 2.85e-144 416 53 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y714 2.95e-144 416 54 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A2RLX1 3.32e-144 416 55 4 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactococcus lactis subsp. cremoris (strain MG1363)
Q8NW84 4.94e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain MW2)
Q6G8U8 4.94e-144 416 54 4 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus aureus (strain MSSA476)
A7Z745 5.32e-144 415 56 4 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q030C8 6.11e-144 415 54 4 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactococcus lactis subsp. cremoris (strain SK11)
C1CBU0 6.71e-144 415 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae (strain JJA)
A4VYE7 1.02e-143 415 57 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus suis (strain 05ZYH33)
A4W4N7 1.02e-143 415 57 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus suis (strain 98HAH33)
Q5FKU0 1.2e-143 414 55 5 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q3JYG1 1.26e-143 414 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B5E605 1.28e-143 414 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pneumoniae serotype 19F (strain G54)
Q8DRS4 1.31e-143 414 55 3 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9CHA1 1.8e-143 414 55 4 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactococcus lactis subsp. lactis (strain IL1403)
B8DDZ8 2.08e-143 414 53 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZF8 2.13e-143 414 53 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria monocytogenes serotype 4b (strain F2365)
C1KVF9 2.13e-143 414 53 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Listeria monocytogenes serotype 4b (strain CLIP80459)
Q5P7R7 2.55e-143 414 56 6 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q4L6W8 4.32e-143 413 54 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Staphylococcus haemolyticus (strain JCSC1435)
Q65GR9 4.34e-143 413 55 3 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q3SKH7 5.04e-143 412 58 2 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Thiobacillus denitrificans (strain ATCC 25259)
O35020 3.02e-142 411 55 3 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus subtilis (strain 168)
A1VTY5 3.64e-142 411 54 5 379 3 mnmA tRNA-specific 2-thiouridylase MnmA Polaromonas naphthalenivorans (strain CJ2)
Q5F7G4 3.73e-142 410 56 3 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B1XX60 4.69e-142 410 56 4 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q6HDD0 1.5e-141 409 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634E9 1.5e-141 409 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cereus (strain ZK / E33L)
B9IYG1 1.5e-141 409 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cereus (strain Q1)
A0RJ05 1.5e-141 409 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus thuringiensis (strain Al Hakam)
B9DWD3 1.54e-141 409 57 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q81JE5 1.75e-141 409 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus anthracis
Q5M249 2.44e-141 409 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXJ9 2.44e-141 409 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus thermophilus (strain CNRZ 1066)
Q1WTT7 3.11e-141 408 54 5 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Ligilactobacillus salivarius (strain UCC118)
B4U0P1 3.35e-141 408 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q730D7 5.89e-141 407 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cereus (strain ATCC 10987 / NRS 248)
A7GT74 8.26e-141 407 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A2SLT0 1.25e-140 407 54 6 392 3 mnmA tRNA-specific 2-thiouridylase MnmA Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q812R6 1.38e-140 407 52 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A1WEN1 1.49e-140 406 54 4 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Verminephrobacter eiseniae (strain EF01-2)
A1AX17 1.62e-140 406 54 3 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Ruthia magnifica subsp. Calyptogena magnifica
Q04B58 1.69e-140 407 54 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
C0MGQ2 1.71e-140 406 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus equi subsp. zooepidemicus (strain H70)
A8YUQ2 2.01e-140 406 54 5 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus helveticus (strain DPC 4571)
Q03I88 2.14e-140 406 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
C0MB53 2.55e-140 406 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus equi subsp. equi (strain 4047)
A2RH05 3.74e-140 405 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J455 3.74e-140 405 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q5X9C1 3.74e-140 405 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A9NDN1 4.23e-140 405 53 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain RSA 331 / Henzerling II)
Q1JJD5 4.7e-140 405 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1J988 4.7e-140 405 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1GAS1 4.77e-140 405 54 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P58075 5.91e-140 405 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M1
B0S3R4 7.19e-140 405 55 4 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
A8FFP0 9.33e-140 404 54 3 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus pumilus (strain SAFR-032)
Q8NZ00 1.28e-139 404 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q1JED4 1.35e-139 404 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q820W2 1.83e-139 403 53 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9IQK6 1.93e-139 404 56 5 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B6IZW5 2.07e-139 404 53 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain CbuG_Q212)
Q48QM8 2.42e-139 404 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q820U1 2.98e-139 403 55 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Enterococcus faecalis (strain ATCC 700802 / V583)
A9KE87 3.05e-139 403 53 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain Dugway 5J108-111)
Q0A8N7 3.11e-139 403 57 2 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B5XJA6 3.5e-139 403 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M49 (strain NZ131)
A9VIM2 4.2e-139 403 51 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Bacillus mycoides (strain KBAB4)
B6J7H5 6.16e-139 402 52 2 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Coxiella burnetii (strain CbuK_Q154)
A9M0Y5 1.67e-138 401 57 3 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria meningitidis serogroup C (strain 053442)
Q9JYJ6 3.15e-138 400 57 3 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P0DC35 3.78e-138 400 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC34 3.78e-138 400 56 3 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q74JW9 3.87e-138 400 53 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8P9A1 4.89e-138 400 56 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RT32 4.89e-138 400 56 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas campestris pv. campestris (strain B100)
Q4UUJ7 4.89e-138 400 56 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas campestris pv. campestris (strain 8004)
A1KUY0 9.47e-138 399 57 3 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q042R4 1.25e-137 399 53 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q03QJ0 2.73e-137 398 53 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
A9BS40 7.11e-137 397 55 4 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Delftia acidovorans (strain DSM 14801 / SPH-1)
Q9JTJ9 9.69e-137 397 56 4 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q3BTY6 3.09e-135 393 55 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PL08 3.12e-135 393 55 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas axonopodis pv. citri (strain 306)
Q6MA75 9.58e-134 389 54 4 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Protochlamydia amoebophila (strain UWE25)
Q5GZR1 2.59e-133 388 54 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SMD7 2.59e-133 388 54 2 359 3 mnmA1 tRNA-specific 2-thiouridylase MnmA Xanthomonas oryzae pv. oryzae (strain PXO99A)
B2GB92 1.01e-132 387 51 8 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B2FQX2 1.22e-132 387 55 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Stenotrophomonas maltophilia (strain K279a)
B4SIN4 2.89e-132 386 55 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Stenotrophomonas maltophilia (strain R551-3)
B2G6L9 3.08e-132 385 52 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJ48 3.08e-132 385 52 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Limosilactobacillus reuteri (strain DSM 20016)
A5EVB4 6.79e-130 380 54 4 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Dichelobacter nodosus (strain VCS1703A)
Q9PDD9 4.74e-129 377 53 2 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Xylella fastidiosa (strain 9a5c)
Q2P2Q7 1.38e-128 376 54 2 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B0U6Q7 7.24e-128 375 53 2 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Xylella fastidiosa (strain M12)
Q87DM0 1.52e-127 374 53 2 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9X8 1.52e-127 374 53 2 354 3 mnmA tRNA-specific 2-thiouridylase MnmA Xylella fastidiosa (strain M23)
Q6F152 4.19e-125 367 48 5 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
O84289 1.06e-122 360 50 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KM75 1.62e-122 360 50 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0BBR8 3.19e-122 359 50 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7K3 3.19e-122 359 50 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q2SRW8 2.93e-120 355 47 6 378 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q9Z8A5 3.21e-120 354 50 5 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia pneumoniae
Q9PKA7 4.3e-120 354 50 7 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia muridarum (strain MoPn / Nigg)
Q6MTG1 1.26e-119 353 47 7 379 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q057R1 4.25e-118 350 48 2 357 3 mnmA tRNA-specific 2-thiouridylase MnmA Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q820E9 5.2e-118 349 49 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q5L6D1 8.4e-118 348 49 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia abortus (strain DSM 27085 / S26/3)
A5IYK6 1.21e-117 348 49 7 375 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
B5ZBP8 1.22e-117 348 47 6 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q253W3 1.13e-116 345 48 6 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlamydia felis (strain Fe/C-56)
A1WWV9 1.18e-115 343 49 3 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Halorhodospira halophila (strain DSM 244 / SL1)
A9NFP7 1.21e-115 343 47 4 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Acholeplasma laidlawii (strain PG-8A)
Q98Q11 6.38e-113 336 46 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasmopsis pulmonis (strain UAB CTIP)
A8ES36 3.43e-110 329 47 2 363 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Aliarcobacter butzleri (strain RM4018)
Q9PQ88 4.53e-110 330 47 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ41 4.53e-110 330 47 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q8CXQ3 1.54e-109 328 46 8 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Malacoplasma penetrans (strain HF-2)
B3PM68 7.64e-107 321 46 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Metamycoplasma arthritidis (strain 158L3-1)
Q4A634 9.19e-107 320 47 9 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasmopsis synoviae (strain 53)
B1VAX7 3.65e-105 317 45 4 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Phytoplasma australiense
Q4A9Q7 4.4e-104 314 44 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q600M2 4.4e-104 314 44 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mesomycoplasma hyopneumoniae (strain 232)
Q6YR90 8.69e-104 313 43 4 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Onion yellows phytoplasma (strain OY-M)
Q4A7U1 1.71e-103 312 44 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mesomycoplasma hyopneumoniae (strain 7448)
Q2NIM9 4.24e-103 311 43 4 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Aster yellows witches'-broom phytoplasma (strain AYWB)
A0M3J2 5.66e-103 311 44 9 399 3 mnmA tRNA-specific 2-thiouridylase MnmA Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q6KHK4 8.28e-103 310 43 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
A6H0G9 8.42e-101 306 42 10 399 3 mnmA tRNA-specific 2-thiouridylase MnmA Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q8RAH7 1.11e-98 300 44 9 368 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q67LS2 1.4e-98 300 44 6 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A5FHA9 3.84e-97 297 42 10 400 3 mnmA tRNA-specific 2-thiouridylase MnmA Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q5ZKW0 5.36e-97 297 40 5 393 2 TRMU Mitochondrial tRNA-specific 2-thiouridylase 1 Gallus gallus
B1ZZ32 2.2e-95 292 43 7 376 3 mnmA tRNA-specific 2-thiouridylase MnmA Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B2UPK4 4.66e-95 290 45 6 346 3 mnmA tRNA-specific 2-thiouridylase MnmA Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B0K0P8 4.67e-95 290 42 8 368 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Thermoanaerobacter sp. (strain X514)
B0K991 4.67e-95 290 42 8 368 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B2A5K1 4.75e-95 290 42 6 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q74A22 1.35e-94 289 41 7 375 3 mnmA tRNA-specific 2-thiouridylase MnmA Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
O75648 1.96e-94 291 40 6 385 1 TRMU Mitochondrial tRNA-specific 2-thiouridylase 1 Homo sapiens
Q9W5B6 2.64e-94 289 40 6 359 2 CG3021 Mitochondrial tRNA-specific 2-thiouridylase 1 Drosophila melanogaster
Q9DAT5 5.86e-93 287 40 6 385 1 Trmu Mitochondrial tRNA-specific 2-thiouridylase 1 Mus musculus
Q503J2 8.87e-92 284 41 6 385 2 trmu Mitochondrial tRNA-specific 2-thiouridylase 1 Danio rerio
Q5RB73 1.32e-91 283 40 7 386 2 TRMU Mitochondrial tRNA-specific 2-thiouridylase 1 Pongo abelii
B2J5L9 6.53e-91 279 41 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q7NBZ0 1.12e-90 288 42 9 375 3 ribF/mnmA Trifunctional protein RibF/MnmA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q39XA9 1.57e-90 279 41 7 377 3 mnmA tRNA-specific 2-thiouridylase MnmA Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A9KPI9 1.66e-90 278 40 6 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q3B625 1.83e-90 279 41 8 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8YX56 5.06e-90 277 42 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8XJH3 8.16e-90 277 39 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium perfringens (strain 13 / Type A)
Q0TPH2 8.16e-90 277 39 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B0KC14 1.35e-89 276 40 6 367 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q3M5R7 1.46e-89 276 42 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3AA24 3e-89 276 42 7 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B0K584 3.49e-89 275 40 6 367 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Thermoanaerobacter sp. (strain X514)
Q8R7F0 3.81e-89 275 40 6 367 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q0SS39 7.35e-89 275 38 5 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium perfringens (strain SM101 / Type A)
A8Z5W4 9.79e-89 275 40 7 387 3 mnmA tRNA-specific 2-thiouridylase MnmA Karelsulcia muelleri (strain GWSS)
A5N749 1.78e-88 273 41 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q18BE2 2.31e-88 273 37 6 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridioides difficile (strain 630)
A7GHC7 5.5e-88 272 39 6 361 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q894S7 5.64e-88 272 40 6 365 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium tetani (strain Massachusetts / E88)
B0JVR4 6.01e-88 272 41 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B1KZE1 8.82e-88 271 40 6 365 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain Loch Maree / Type A3)
B2THM7 1.16e-87 271 40 7 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium botulinum (strain Eklund 17B / Type B)
B8CWH7 1.39e-87 271 40 6 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A5GE36 3.29e-87 271 41 8 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Geotalea uraniireducens (strain Rf4)
B1WC37 4.97e-87 272 37 6 412 2 Trmu Mitochondrial tRNA-specific 2-thiouridylase 1 Rattus norvegicus
A5I123 5.15e-87 270 40 6 365 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FT69 5.15e-87 270 40 6 365 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain ATCC 19397 / Type A)
B1IIY2 5.87e-87 270 40 6 365 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain Okra / Type B1)
A7GCM3 7.61e-87 269 40 6 365 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1ILH4 2.16e-86 268 39 6 360 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium botulinum (strain Okra / Type B1)
Q3A3F8 2.75e-86 268 42 7 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B3E966 6.51e-86 267 42 9 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A6LSF2 6.75e-86 267 38 5 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B1KZJ2 8.18e-86 266 39 6 360 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain Loch Maree / Type A3)
B7K1G5 9.08e-86 266 40 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Rippkaea orientalis (strain PCC 8801 / RF-1)
A5I5Y9 1.08e-85 266 39 6 360 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXG3 1.08e-85 266 39 6 360 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Clostridium botulinum (strain ATCC 19397 / Type A)
A3DDC8 1.92e-85 266 40 8 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A4J2K1 1.14e-84 264 39 8 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
P47537 1.89e-84 263 38 6 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5MZ36 6.36e-84 262 39 8 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31N30 6.36e-84 262 39 8 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q97GY2 6.52e-84 261 39 6 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A0Q152 8.26e-84 261 41 6 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium novyi (strain NT)
Q02BG1 9.81e-84 262 40 9 379 3 mnmA tRNA-specific 2-thiouridylase MnmA Solibacter usitatus (strain Ellin6076)
B2V3V9 1.05e-83 261 40 7 356 3 mnmA tRNA-specific 2-thiouridylase MnmA Clostridium botulinum (strain Alaska E43 / Type E3)
A5D3F0 1.12e-83 261 39 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B1X0U7 1.41e-83 261 40 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Crocosphaera subtropica (strain ATCC 51142 / BH68)
P73755 1.63e-83 261 40 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A5UV64 6.75e-83 259 40 8 377 3 mnmA tRNA-specific 2-thiouridylase MnmA Roseiflexus sp. (strain RS-1)
B7KHE5 7.2e-83 259 39 6 359 3 mnmA tRNA-specific 2-thiouridylase MnmA Gloeothece citriformis (strain PCC 7424)
Q17440 1.43e-82 259 39 9 369 3 mttu-1 Probable mitochondrial tRNA-specific 2-thiouridylase 1 Caenorhabditis elegans
B1XM11 3.46e-82 257 39 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B0TFA7 1.96e-81 256 39 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A9AYA7 3.15e-81 255 39 8 373 3 mnmA tRNA-specific 2-thiouridylase MnmA Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A1BI85 5.58e-81 254 39 7 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q3ATZ5 1.3e-80 253 39 7 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium chlorochromatii (strain CaD3)
A0L678 4.33e-80 252 39 6 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B3EN11 1.07e-79 251 38 5 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium phaeobacteroides (strain BS1)
Q8R5X3 2.21e-79 250 41 11 368 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P75365 3.03e-79 250 39 9 373 3 mnmA tRNA-specific 2-thiouridylase MnmA Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q2RHY7 6.32e-79 249 40 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A7NK07 1.01e-78 249 40 8 375 3 mnmA tRNA-specific 2-thiouridylase MnmA Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B5ENY8 1.36e-77 245 40 7 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J5X6 1.36e-77 245 40 7 362 3 mnmA tRNA-specific 2-thiouridylase MnmA Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A4SD47 3.04e-77 244 37 6 361 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B5RQ24 4.93e-77 244 35 7 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia recurrentis (strain A1)
B5RMM8 6.75e-77 243 35 7 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia duttonii (strain Ly)
A0LEL7 1.33e-76 243 39 7 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B0CE39 1.63e-76 243 37 7 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Acaryochloris marina (strain MBIC 11017)
Q73PV6 1.7e-76 243 40 8 355 3 mnmA tRNA-specific 2-thiouridylase MnmA Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q118B7 2.04e-76 243 38 8 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Trichodesmium erythraeum (strain IMS101)
Q2LWA6 2.83e-76 243 39 8 359 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Syntrophus aciditrophicus (strain SB)
Q1IPC9 3.69e-76 242 37 8 378 3 mnmA tRNA-specific 2-thiouridylase MnmA Koribacter versatilis (strain Ellin345)
Q0SMH1 6.55e-76 241 35 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borreliella afzelii (strain PKo)
Q896F5 6.77e-76 241 38 5 355 3 mnmA1 tRNA-specific 2-thiouridylase MnmA 1 Clostridium tetani (strain Massachusetts / E88)
B7J2N7 1.24e-75 240 34 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borreliella burgdorferi (strain ZS7)
Q5SLN5 1.6e-75 240 39 9 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72GX1 1.6e-75 240 39 9 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
O13947 1.63e-75 242 36 10 380 3 SPAC23H4.04 Mitochondrial tRNA-specific 2-thiouridylase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2JY34 2.05e-75 240 38 6 350 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain JA-3-3Ab)
Q2JM78 2.29e-75 240 39 7 350 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain JA-2-3B'a(2-13))
O51625 2.63e-75 239 34 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q660I8 3.37e-75 239 35 6 358 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q2RZN9 2.11e-74 238 39 7 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Salinibacter ruber (strain DSM 13855 / M31)
A1R0A7 2.35e-74 237 35 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia turicatae (strain 91E135)
Q7TTR0 4.15e-74 238 37 8 381 3 mnmA tRNA-specific 2-thiouridylase MnmA Prochlorococcus marinus (strain MIT 9313)
B8G5F1 4.19e-74 236 41 6 360 3 mnmA tRNA-specific 2-thiouridylase MnmA Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q7MBC9 5.41e-74 236 36 8 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B2S125 5.51e-74 236 35 7 363 3 mnmA tRNA-specific 2-thiouridylase MnmA Borrelia hermsii (strain HS1 / DAH)
Q8CWM0 5.66e-74 236 38 9 369 3 mnmA tRNA-specific 2-thiouridylase MnmA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A6KZ28 7.69e-74 236 37 8 364 3 mnmA2 tRNA-specific 2-thiouridylase MnmA 2 Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q7TTU4 7.85e-74 237 37 8 372 3 mnmA tRNA-specific 2-thiouridylase MnmA Parasynechococcus marenigrum (strain WH8102)
Q8KBD3 9.49e-74 236 36 6 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A5GUP6 1.06e-73 236 38 7 371 3 mnmA tRNA-specific 2-thiouridylase MnmA Synechococcus sp. (strain RCC307)
B0SPC6 1.22e-73 236 37 8 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SG84 1.22e-73 236 37 8 367 3 mnmA tRNA-specific 2-thiouridylase MnmA Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A8EZE8 1.3e-73 236 36 7 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia canadensis (strain McKiel)
Q24US9 1.47e-73 236 36 8 377 3 mnmA tRNA-specific 2-thiouridylase MnmA Desulfitobacterium hafniense (strain Y51)
B1LV15 2.34e-73 235 37 9 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q92IL0 2.41e-73 235 36 6 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8F172 3.28e-73 234 36 6 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia massiliae (strain Mtu5)
Q9ZDM1 3.29e-73 234 36 7 365 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia prowazekii (strain Madrid E)
A2CB44 3.63e-73 236 37 8 381 3 mnmA tRNA-specific 2-thiouridylase MnmA Prochlorococcus marinus (strain MIT 9303)
Q68X66 3.7e-73 234 36 7 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7TTZ4 3.84e-73 235 35 8 397 3 mnmA tRNA-specific 2-thiouridylase MnmA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C4K1W0 4.3e-73 234 36 6 368 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia peacockii (strain Rustic)
Q5L8X6 5e-73 234 35 7 366 3 mnmA3 tRNA-specific 2-thiouridylase MnmA 3 Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A8GRJ5 7.28e-73 233 36 6 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia rickettsii (strain Sheila Smith)
B0BWZ7 7.28e-73 233 36 6 366 3 mnmA tRNA-specific 2-thiouridylase MnmA Rickettsia rickettsii (strain Iowa)
Q7VAT9 1.15e-72 234 36 7 379 3 mnmA tRNA-specific 2-thiouridylase MnmA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q2RSS1 1.36e-72 233 37 9 370 3 mnmA tRNA-specific 2-thiouridylase MnmA Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q1J090 1.73e-72 233 37 8 364 3 mnmA tRNA-specific 2-thiouridylase MnmA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A2BXZ8 1.94e-72 233 37 9 374 3 mnmA tRNA-specific 2-thiouridylase MnmA Prochlorococcus marinus (strain MIT 9515)
Q64P39 2.11e-72 232 35 7 366 3 mnmA3 tRNA-specific 2-thiouridylase MnmA 3 Bacteroides fragilis (strain YCH46)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_15365
Feature type CDS
Gene mnmA
Product tRNA 2-thiouridine(34) synthase MnmA
Location 36391 - 37494 (strand: 1)
Length 1104 (nucleotides) / 367 (amino acids)
In genomic island -

Contig

Accession ZDB_226
Length 116685 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1977
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03054 tRNA methyl transferase HUP domain
PF20258 Aminomethyltransferase beta-barrel domain
PF20259 tRNA methyl transferase PRC-barrel domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0482 Translation, ribosomal structure and biogenesis (J) J tRNA U34 2-thiouridine synthase MnmA/TrmU, contains the PP-loop ATPase domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00566 tRNA-uridine 2-sulfurtransferase [EC:2.8.1.13] Sulfur relay system -

Protein Sequence

MSDNSQKKVIVGMSGGVDSSVSAYLLQQQGYQVTGLFMKNWEEDDDTEYCSAAADLADAQAVCDKLGIELLTINFAAEYWDNVFEHFLEEYKAGRTPNPDILCNKEIKFKAFLEYAAEDLGADYIATGHYVRRRDINGTTQLLRGLDSNKDQSYFLYTLSHDQVAQSLFPVGELEKPEVRRIAEQLGLITAKKKDSTGICFIGERKFRDFLARYLPAKPGPIMTVDGQEIGQHDGLMYHTLGQRKGLKIGGTREGSDEPWYVVDKDVENNILIVAQGHEHPRLMSAGLIAQQLDWVSREPLTQPMRCVVKTRYRQEDIPCTVTPLGDDKISVRFDNPVAAVTPGQSAVFYQDEVCLGGGVIEARITE

Flanking regions ( +/- flanking 50bp)

CTTCTTCGCATCACTGTTGCGGAGCAGACCGAATCGCCGCGAGATCAGCCATGTCAGATAACAGCCAGAAAAAAGTCATCGTCGGAATGTCCGGCGGTGTGGATTCCTCCGTCTCAGCCTATTTACTGCAACAGCAGGGTTATCAGGTGACCGGGCTGTTTATGAAGAACTGGGAAGAGGACGATGATACCGAATACTGCTCCGCCGCCGCCGACCTGGCGGATGCACAGGCCGTCTGCGATAAACTCGGCATTGAACTGCTGACCATCAACTTCGCGGCGGAATACTGGGATAATGTGTTCGAGCATTTCCTGGAAGAATATAAAGCGGGACGCACGCCGAACCCGGATATTCTGTGCAACAAAGAGATCAAATTCAAAGCGTTCCTGGAATATGCCGCAGAAGATCTCGGGGCGGATTATATCGCCACCGGACATTATGTGCGCCGCCGCGATATCAACGGTACCACGCAATTACTGCGCGGCCTGGACAGCAATAAAGATCAGAGCTATTTCCTGTATACACTGAGTCACGACCAGGTGGCACAAAGCCTGTTCCCTGTCGGGGAACTGGAAAAACCGGAAGTCCGCCGGATTGCGGAGCAATTAGGGCTTATCACCGCGAAGAAAAAAGATTCCACCGGGATCTGCTTTATCGGTGAGCGCAAATTCCGTGATTTTCTCGCCCGTTATCTGCCCGCCAAACCGGGTCCGATTATGACGGTTGATGGTCAGGAAATCGGTCAGCACGACGGGCTGATGTACCATACCCTCGGCCAGCGCAAAGGGCTGAAAATCGGCGGAACCCGTGAAGGTTCCGACGAGCCGTGGTATGTTGTCGATAAAGATGTTGAAAACAATATTCTGATTGTCGCACAGGGCCATGAACACCCGCGTCTGATGTCTGCAGGGCTTATCGCGCAGCAGCTGGACTGGGTATCGCGGGAGCCGCTGACTCAGCCGATGCGTTGTGTGGTGAAAACCCGTTACCGTCAGGAAGATATTCCCTGTACTGTCACCCCGCTTGGCGATGACAAAATCAGTGTCCGGTTTGATAACCCGGTTGCTGCGGTCACGCCGGGTCAGTCCGCTGTCTTTTATCAGGATGAAGTCTGCCTGGGCGGCGGAGTCATTGAAGCGCGTATTACGGAGTGATTATGGCTAAAAATTACGAAGACATAACCCTCGCCCTGGCCGGGATCTGC