Homologs in group_490

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00875 FBDBKF_00875 87.1 Morganella morganii S1 pyrC dihydroorotase
EHELCC_00670 EHELCC_00670 87.1 Morganella morganii S2 pyrC dihydroorotase
NLDBIP_02790 NLDBIP_02790 87.1 Morganella morganii S4 pyrC dihydroorotase
LHKJJB_04305 LHKJJB_04305 87.1 Morganella morganii S3 pyrC dihydroorotase
HKOGLL_02740 HKOGLL_02740 87.1 Morganella morganii S5 pyrC dihydroorotase
PMI_RS08210 PMI_RS08210 71.3 Proteus mirabilis HI4320 pyrC dihydroorotase

Distribution of the homologs in the orthogroup group_490

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_490

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N5W0 0.0 555 75 0 348 3 pyrC Dihydroorotase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8AI14 0.0 546 74 0 347 3 pyrC Dihydroorotase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B1LIU8 0.0 546 74 0 347 3 pyrC Dihydroorotase Escherichia coli (strain SMS-3-5 / SECEC)
B6I9D9 0.0 546 74 0 347 3 pyrC Dihydroorotase Escherichia coli (strain SE11)
B1IV40 0.0 546 74 0 347 1 pyrC Dihydroorotase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZ20 0.0 546 74 0 347 3 pyrC Dihydroorotase Escherichia coli O9:H4 (strain HS)
B7M937 0.0 546 74 0 347 3 pyrC Dihydroorotase Escherichia coli O8 (strain IAI1)
B7MTJ3 0.0 546 74 0 347 3 pyrC Dihydroorotase Escherichia coli O81 (strain ED1a)
B7LFZ6 0.0 546 74 0 347 3 pyrC Dihydroorotase Escherichia coli (strain 55989 / EAEC)
B7UP76 0.0 546 74 0 347 3 pyrC Dihydroorotase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZKG7 0.0 546 74 0 347 3 pyrC Dihydroorotase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z354 0.0 545 74 0 347 3 pyrC Dihydroorotase Shigella sonnei (strain Ss046)
P05020 0.0 545 74 0 347 1 pyrC Dihydroorotase Escherichia coli (strain K12)
Q0TJ12 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1X9H5 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli (strain K12 / DH10B)
C4ZS02 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli (strain K12 / MC4100 / BW2952)
B5YVT2 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8N8 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli O157:H7
Q1RD95 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli (strain UTI89 / UPEC)
A1A9V7 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli O1:K1 / APEC
B7NL72 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MIK3 0.0 545 74 0 347 3 pyrC Dihydroorotase Escherichia coli O45:K1 (strain S88 / ExPEC)
A9MH00 0.0 544 73 0 347 3 pyrC Dihydroorotase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q83RT8 0.0 544 74 0 347 3 pyrC Dihydroorotase Shigella flexneri
B4TSS5 0.0 544 74 0 347 3 pyrC Dihydroorotase Salmonella schwarzengrund (strain CVM19633)
Q32ES3 0.0 543 74 0 347 3 pyrC Dihydroorotase Shigella dysenteriae serotype 1 (strain Sd197)
B5BBC6 0.0 543 74 0 347 3 pyrC Dihydroorotase Salmonella paratyphi A (strain AKU_12601)
Q5PGW5 0.0 543 74 0 347 3 pyrC Dihydroorotase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B2TTK9 0.0 543 74 0 347 3 pyrC Dihydroorotase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7NAT7 0.0 543 74 0 347 3 pyrC Dihydroorotase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q31ZB7 0.0 543 73 0 347 3 pyrC Dihydroorotase Shigella boydii serotype 4 (strain Sb227)
C0Q845 0.0 543 74 0 347 3 pyrC Dihydroorotase Salmonella paratyphi C (strain RKS4594)
Q57QJ4 0.0 543 74 0 347 3 pyrC Dihydroorotase Salmonella choleraesuis (strain SC-B67)
Q8FIR2 0.0 543 74 0 347 3 pyrC Dihydroorotase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A9N5P9 0.0 542 74 0 347 3 pyrC Dihydroorotase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5RBD7 0.0 542 74 0 347 3 pyrC Dihydroorotase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QY02 0.0 542 74 0 347 3 pyrC Dihydroorotase Salmonella enteritidis PT4 (strain P125109)
B5FL01 0.0 542 74 0 347 3 pyrC Dihydroorotase Salmonella dublin (strain CT_02021853)
Q0T5X0 0.0 542 73 0 347 3 pyrC Dihydroorotase Shigella flexneri serotype 5b (strain 8401)
B4T2Z5 0.0 542 74 0 347 3 pyrC Dihydroorotase Salmonella newport (strain SL254)
B5F944 0.0 542 74 0 347 3 pyrC Dihydroorotase Salmonella agona (strain SL483)
B7LT74 0.0 542 72 0 347 3 pyrC Dihydroorotase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8Z7L2 0.0 540 73 0 347 3 pyrC Dihydroorotase Salmonella typhi
B4TET5 0.0 538 73 0 347 3 pyrC Dihydroorotase Salmonella heidelberg (strain SL476)
P06204 0.0 538 73 0 347 1 pyrC Dihydroorotase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A6T7D6 0.0 536 73 0 347 1 pyrC Dihydroorotase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8GD09 0.0 535 72 0 347 3 pyrC Dihydroorotase Serratia proteamaculans (strain 568)
B5XXJ5 0.0 534 73 0 344 3 pyrC Dihydroorotase Klebsiella pneumoniae (strain 342)
A7MG30 0.0 526 71 0 347 3 pyrC Dihydroorotase Cronobacter sakazakii (strain ATCC BAA-894)
A4W975 0.0 525 72 0 347 3 pyrC Dihydroorotase Enterobacter sp. (strain 638)
A1JN45 0.0 522 70 0 347 3 pyrC Dihydroorotase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DKU3 0.0 520 70 0 346 3 pyrC Dihydroorotase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q669K2 0.0 514 69 0 347 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLT2 0.0 514 69 0 347 3 pyrC Dihydroorotase Yersinia pestis (strain Pestoides F)
Q1CI09 0.0 514 69 0 347 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7Y6 0.0 514 69 0 347 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFU4 0.0 514 69 0 347 1 pyrC Dihydroorotase Yersinia pestis
B2K767 0.0 514 69 0 347 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6L6 0.0 514 69 0 347 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Antiqua)
C5BA73 0.0 514 69 0 341 3 pyrC Dihydroorotase Edwardsiella ictaluri (strain 93-146)
A7FH16 0.0 514 69 0 347 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JHH4 0.0 511 69 0 347 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q6D698 0.0 511 69 0 346 3 pyrC Dihydroorotase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VDJ8 6.27e-180 505 70 1 348 3 pyrC Dihydroorotase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NCC9 7.79e-155 441 62 0 341 3 pyrC Dihydroorotase Erythrobacter litoralis (strain HTCC2594)
Q2G9U3 6.25e-154 439 62 0 340 3 pyrC Dihydroorotase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q1GT81 1.19e-153 438 64 1 339 3 pyrC Dihydroorotase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A5GR03 1.9e-149 427 62 1 346 3 pyrC Dihydroorotase Synechococcus sp. (strain RCC307)
Q2SCE3 2.32e-147 422 57 0 344 3 pyrC Dihydroorotase Hahella chejuensis (strain KCTC 2396)
Q3AKY8 7.32e-146 418 62 1 340 3 pyrC Dihydroorotase Synechococcus sp. (strain CC9605)
A9BSM4 1.83e-144 415 58 1 346 3 pyrC Dihydroorotase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q1LRD4 7.97e-144 413 59 0 342 3 pyrC Dihydroorotase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q7U618 5.21e-143 411 59 1 343 3 pyrC Dihydroorotase Parasynechococcus marenigrum (strain WH8102)
Q0KEE2 4.85e-142 409 58 0 342 3 pyrC Dihydroorotase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A1U3L1 5.34e-142 408 60 3 341 3 pyrC Dihydroorotase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q475T7 8.85e-142 408 59 0 342 3 pyrC Dihydroorotase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B2AH54 1.18e-141 407 59 0 342 3 pyrC Dihydroorotase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A5VZH8 1.22e-139 402 57 0 339 3 pyrC Dihydroorotase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1XWS5 4.84e-139 401 58 1 341 3 pyrC Dihydroorotase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B1J4I2 2.77e-138 399 56 0 339 3 pyrC Dihydroorotase Pseudomonas putida (strain W619)
Q88NW7 4.1e-138 399 56 0 339 3 pyrC Dihydroorotase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KUE9 2e-137 397 56 0 339 3 pyrC Dihydroorotase Pseudomonas putida (strain GB-1)
Q3AYG9 3.27e-137 396 59 1 344 3 pyrC Dihydroorotase Synechococcus sp. (strain CC9902)
Q087W5 8.13e-137 395 55 2 346 3 pyrC Dihydroorotase Shewanella frigidimarina (strain NCIMB 400)
Q5E0G4 1.58e-136 394 54 1 342 3 pyrC Dihydroorotase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A1WC79 2.25e-136 394 58 1 335 3 pyrC Dihydroorotase Acidovorax sp. (strain JS42)
Q28RK3 7.09e-136 393 55 1 344 3 pyrC Dihydroorotase Jannaschia sp. (strain CCS1)
A1RGK8 1.2e-135 392 55 0 342 3 pyrC Dihydroorotase Shewanella sp. (strain W3-18-1)
B2UFJ8 1.22e-135 392 57 0 340 3 pyrC Dihydroorotase Ralstonia pickettii (strain 12J)
A4Y9S5 1.86e-135 392 54 0 342 3 pyrC Dihydroorotase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8Y249 1.95e-135 392 57 0 342 3 pyrC Dihydroorotase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9KL24 2.29e-135 392 54 1 343 1 pyrC Dihydroorotase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5ETI9 2.47e-135 391 53 1 343 3 pyrC Dihydroorotase Aliivibrio fischeri (strain MJ11)
A6VXW9 2.91e-135 391 55 2 344 3 pyrC Dihydroorotase Marinomonas sp. (strain MWYL1)
B6ER91 3.54e-135 391 53 1 343 3 pyrC Dihydroorotase Aliivibrio salmonicida (strain LFI1238)
Q4K747 3.82e-135 391 56 0 339 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0HRV9 5.37e-135 390 54 0 342 3 pyrC Dihydroorotase Shewanella sp. (strain MR-7)
Q0HLX7 5.37e-135 390 54 0 342 3 pyrC Dihydroorotase Shewanella sp. (strain MR-4)
A0L0B8 5.37e-135 390 54 0 342 3 pyrC Dihydroorotase Shewanella sp. (strain ANA-3)
Q3K7J8 6.45e-135 390 55 0 339 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain Pf0-1)
Q0AB36 2.3e-134 389 56 0 342 3 pyrC Dihydroorotase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B1KEK5 2.51e-134 389 56 2 344 3 pyrC Dihydroorotase Shewanella woodyi (strain ATCC 51908 / MS32)
Q5P6Y5 3.64e-134 389 56 2 346 3 pyrC Dihydroorotase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1K3T5 3.76e-134 389 57 1 343 3 pyrC Dihydroorotase Azoarcus sp. (strain BH72)
C5BNK6 1.05e-133 387 56 1 341 3 pyrC Dihydroorotase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q1IE05 1.28e-133 387 55 0 339 3 pyrC Dihydroorotase Pseudomonas entomophila (strain L48)
B0VAC1 3.56e-133 386 52 1 342 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AYE)
A3M3K3 3.56e-133 386 52 1 342 3 pyrC Dihydroorotase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWF6 3.56e-133 386 52 1 342 3 pyrC Dihydroorotase Acinetobacter baumannii (strain ACICU)
B7I9G6 3.56e-133 386 52 1 342 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AB0057)
B7GX48 3.56e-133 386 52 1 342 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AB307-0294)
A8FZC6 3.6e-133 386 55 2 344 3 pyrC Dihydroorotase Shewanella sediminis (strain HAW-EB3)
Q6FD29 3.8e-133 386 52 1 342 3 pyrC Dihydroorotase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P72170 6.33e-133 385 56 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q12NL3 1.17e-132 385 54 0 340 3 pyrC Dihydroorotase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q7MFB3 1.33e-132 384 53 1 343 3 pyrC Dihydroorotase Vibrio vulnificus (strain YJ016)
B8CT15 1.54e-132 384 56 2 346 3 pyrC Dihydroorotase Shewanella piezotolerans (strain WP3 / JCM 13877)
A7N655 1.77e-132 384 54 1 342 3 pyrC Dihydroorotase Vibrio campbellii (strain ATCC BAA-1116)
B0VKW9 1.96e-132 384 52 1 342 3 pyrC Dihydroorotase Acinetobacter baumannii (strain SDF)
Q11IA4 2.1e-132 384 55 1 345 3 pyrC Dihydroorotase Chelativorans sp. (strain BNC1)
A4VIU5 2.53e-132 384 55 0 342 3 pyrC Dihydroorotase Stutzerimonas stutzeri (strain A1501)
B7UVV3 2.98e-132 384 55 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain LESB58)
Q02QZ8 3.05e-132 384 55 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain UCBPP-PA14)
C5CMK6 3.48e-132 384 56 1 340 3 pyrC Dihydroorotase Variovorax paradoxus (strain S110)
Q6LPI7 4.42e-132 383 53 1 342 3 pyrC Dihydroorotase Photobacterium profundum (strain SS9)
Q8D3T9 5.04e-132 383 53 1 343 3 pyrC Dihydroorotase Vibrio vulnificus (strain CMCP6)
Q87J46 7e-132 383 54 1 342 3 pyrC Dihydroorotase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3KBZ0 7.71e-132 383 54 0 339 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain SBW25)
B0TRS6 9.04e-132 382 55 2 344 3 pyrC Dihydroorotase Shewanella halifaxensis (strain HAW-EB4)
C1DQV1 9.9e-132 382 54 0 339 3 pyrC Dihydroorotase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A4XS41 1.02e-131 382 54 0 339 3 pyrC Dihydroorotase Pseudomonas mendocina (strain ymp)
A6V1R9 1.77e-131 382 55 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain PA7)
Q5LQ43 2.73e-131 381 55 1 343 3 pyrC Dihydroorotase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1GFQ7 4.17e-131 381 55 1 344 3 pyrC Dihydroorotase Ruegeria sp. (strain TM1040)
A6U5N6 4.18e-131 381 58 0 315 3 pyrC Dihydroorotase Sinorhizobium medicae (strain WSM419)
B0JQJ1 4.95e-131 380 53 0 343 3 pyrC Dihydroorotase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
C1D672 5.18e-131 380 56 1 343 3 pyrC Dihydroorotase Laribacter hongkongensis (strain HLHK9)
Q92SC7 6.33e-131 380 58 0 315 3 pyrC Dihydroorotase Rhizobium meliloti (strain 1021)
B1XI96 6.46e-131 380 53 0 341 3 pyrC Dihydroorotase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A8H7J4 6.88e-131 380 55 2 346 3 pyrC Dihydroorotase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3QAV2 7.48e-131 380 55 1 342 3 pyrC Dihydroorotase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1SX20 7.49e-131 380 54 1 337 3 pyrC Dihydroorotase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q48F12 8.87e-131 380 54 0 339 3 pyrC Dihydroorotase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87XM1 3.11e-130 379 54 0 339 3 pyrC Dihydroorotase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5QWC6 3.2e-130 379 55 0 342 3 pyrC Dihydroorotase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3J872 4.17e-130 378 54 0 342 3 pyrC Dihydroorotase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q4ZPJ8 7.21e-130 378 54 0 339 3 pyrC Dihydroorotase Pseudomonas syringae pv. syringae (strain B728a)
A9M2W6 8.1e-130 377 54 2 344 3 pyrC Dihydroorotase Neisseria meningitidis serogroup C (strain 053442)
B8E4P5 1.06e-129 377 54 0 342 3 pyrC Dihydroorotase Shewanella baltica (strain OS223)
A9L3F5 1.15e-129 377 54 0 342 3 pyrC Dihydroorotase Shewanella baltica (strain OS195)
B8D7M3 1.28e-129 377 49 1 335 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D9C1 1.28e-129 377 49 1 335 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A1S9L6 1.47e-129 377 55 2 346 3 pyrC Dihydroorotase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q2KCZ6 1.73e-129 377 54 1 345 3 pyrC Dihydroorotase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A6WK08 2.18e-129 376 54 0 342 3 pyrC Dihydroorotase Shewanella baltica (strain OS185)
Q8EB40 3.45e-129 376 54 0 342 3 pyrC Dihydroorotase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B7VQP0 3.72e-129 376 53 1 343 3 pyrC Dihydroorotase Vibrio atlanticus (strain LGP32)
P57416 8.53e-129 375 48 1 335 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B9JQV9 8.72e-129 375 57 0 318 3 pyrC Dihydroorotase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A3D7V9 1.7e-128 374 53 0 342 3 pyrC Dihydroorotase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q9JVD6 2.01e-128 374 54 2 344 3 pyrC Dihydroorotase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0JJD1 2.12e-128 376 53 2 343 2 PYRC Dihydroorotase, mitochondrial Oryza sativa subsp. japonica
O04904 4.37e-128 374 55 2 340 1 PYR4 Dihydroorotase, mitochondrial Arabidopsis thaliana
B3Q0A1 4.99e-128 373 57 0 314 3 pyrC Dihydroorotase Rhizobium etli (strain CIAT 652)
Q9K0D1 9.04e-128 372 54 2 344 3 pyrC Dihydroorotase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8K9L2 9.51e-128 372 48 1 335 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A1KSU5 1.15e-127 372 54 2 344 3 pyrC Dihydroorotase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q5F9Y1 1.32e-127 372 54 2 344 3 pyrC Dihydroorotase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q1MM16 2.92e-127 371 57 0 314 3 pyrC Dihydroorotase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B4RJT2 5.91e-127 370 54 2 344 3 pyrC Dihydroorotase Neisseria gonorrhoeae (strain NCCP11945)
C3MF80 1.11e-126 370 56 0 313 3 pyrC Dihydroorotase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P74438 1.17e-126 369 53 1 342 3 pyrC Dihydroorotase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8UI99 2.55e-126 369 53 1 345 3 pyrC Dihydroorotase Agrobacterium fabrum (strain C58 / ATCC 33970)
B5ZNS1 2.88e-125 366 53 1 344 3 pyrC Dihydroorotase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q82WF3 3.12e-125 366 51 1 348 3 pyrC Dihydroorotase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0VNK6 5.71e-125 365 53 0 341 3 pyrC Dihydroorotase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B0CF78 8.02e-125 365 51 0 342 3 pyrC Dihydroorotase Acaryochloris marina (strain MBIC 11017)
B9J8H5 8.21e-125 365 55 1 324 3 pyrC Dihydroorotase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q15YC5 4.69e-124 363 53 2 341 3 pyrC Dihydroorotase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A4WPB7 4.3e-123 360 53 1 343 3 pyrC Dihydroorotase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q163V6 1.2e-122 359 53 0 341 3 pyrC Dihydroorotase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A9NA67 1.61e-121 357 49 0 343 3 pyrC Dihydroorotase Coxiella burnetii (strain RSA 331 / Henzerling II)
A1WV00 3.97e-121 355 51 0 343 3 pyrC Dihydroorotase Halorhodospira halophila (strain DSM 244 / SL1)
Q0AFI1 4.33e-121 355 50 1 343 3 pyrC Dihydroorotase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1GYZ0 9.16e-119 349 52 0 342 3 pyrC Dihydroorotase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9S3S1 4.31e-106 312 72 0 200 3 pyrC Dihydroorotase (Fragment) Serratia marcescens
Q7VIJ1 1.53e-59 198 34 8 347 3 pyrC Dihydroorotase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q9UTI0 2.21e-57 192 36 8 345 3 ura2 Probable dihydroorotase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9ZLQ0 9.78e-53 180 33 8 338 3 pyrC Dihydroorotase Helicobacter pylori (strain J99 / ATCC 700824)
Q17W17 1.39e-52 180 32 8 338 3 pyrC Dihydroorotase Helicobacter acinonychis (strain Sheeba)
Q1CTU5 1.63e-52 179 32 8 338 3 pyrC Dihydroorotase Helicobacter pylori (strain HPAG1)
B2UTP7 2.69e-52 179 32 9 340 3 pyrC Dihydroorotase Helicobacter pylori (strain Shi470)
B5Z6V2 2.1e-51 177 32 8 338 3 pyrC Dihydroorotase Helicobacter pylori (strain G27)
P56465 2.12e-51 177 31 6 338 3 pyrC Dihydroorotase Helicobacter pylori (strain ATCC 700392 / 26695)
P20051 4.06e-51 177 34 12 357 1 URA4 Dihydroorotase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B6JLG3 1.06e-50 175 32 9 340 3 pyrC Dihydroorotase Helicobacter pylori (strain P12)
P31301 5.06e-49 172 34 10 332 2 PYR3 Dihydroorotase Ustilago maydis (strain 521 / FGSC 9021)
O66990 3.36e-05 48 24 13 295 1 pyrC Dihydroorotase Aquifex aeolicus (strain VF5)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS06870
Feature type CDS
Gene pyrC
Product dihydroorotase
Location 1422126 - 1423178 (strand: 1)
Length 1053 (nucleotides) / 350 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_490
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0418 Nucleotide transport and metabolism (F) F Dihydroorotase

Protein Sequence

MTHPISSLKIRRPDDWHIHFRDGAMLNTVVPYTSEFFGRAIVMPNLAPPVTTVDAAIAYRERILAAVPDGHHFTPLMTCYLTDGANTAEIERGFSEGVFTACKLYPANATTNSAHGVSDVRNIYPVLEMMSRTGMPLLVHGEVTQADIDIFDREARFIEQVMIPLRRDFPALKVVFEHITTKEAAQYVLDADDNVAATLTPQHLIFNRNHMLVGGIHPHLYCLPVLKRNIHQEALRQAVASGSPRFFFGTDSAPHVRHRKESSCGCAGVFNAPNALAAYATVFEELGALAHFEAFCSLNGPAFYGLPVNDGFIELTREETIVPETIGEAEEALVPFLAGTDARWRVNVCK

Flanking regions ( +/- flanking 50bp)

TATGGCATCCGCCATCAGGTTATCCTTATACTTATTTCGGAGCCGGTTCAATGACTCATCCAATATCTTCCCTGAAAATCCGCCGCCCTGACGACTGGCATATTCATTTCCGTGATGGCGCGATGCTCAATACTGTTGTGCCTTATACCAGTGAGTTTTTCGGCCGTGCCATTGTGATGCCGAATCTGGCTCCGCCGGTAACCACCGTGGATGCCGCCATAGCGTACCGTGAGCGCATTCTGGCCGCTGTACCGGATGGACACCATTTTACCCCGCTGATGACCTGTTACCTGACAGATGGTGCAAATACCGCAGAAATTGAACGTGGCTTTAGTGAAGGGGTATTTACCGCCTGTAAGCTTTATCCGGCAAATGCGACCACCAACTCTGCGCACGGTGTCTCTGATGTCAGAAATATTTATCCGGTGCTGGAGATGATGTCGCGCACCGGTATGCCGCTGCTGGTTCACGGCGAAGTGACACAGGCAGATATTGATATTTTTGATCGCGAAGCGCGTTTTATTGAGCAGGTGATGATCCCGCTGCGCCGTGATTTTCCGGCACTGAAAGTAGTTTTTGAGCACATTACCACCAAAGAGGCTGCGCAGTATGTCCTTGACGCTGATGATAATGTTGCCGCAACACTGACCCCGCAGCATCTGATATTTAACCGCAACCATATGCTGGTTGGCGGAATTCATCCGCACCTGTATTGTCTGCCGGTGCTCAAACGTAATATTCATCAGGAAGCACTGCGTCAGGCGGTGGCAAGCGGCTCTCCGCGTTTCTTCTTCGGAACAGATAGCGCACCGCACGTACGCCACCGGAAAGAATCATCCTGCGGCTGTGCCGGTGTTTTTAATGCACCAAACGCCCTCGCGGCTTATGCTACTGTCTTTGAAGAGCTGGGTGCACTGGCACATTTTGAAGCCTTCTGTTCACTCAACGGACCTGCATTTTACGGCTTACCGGTAAATGACGGGTTTATTGAATTAACGCGGGAAGAAACAATAGTTCCTGAAACTATCGGTGAAGCAGAAGAGGCGCTGGTGCCTTTCCTGGCAGGCACTGATGCCCGCTGGCGTGTTAATGTTTGTAAGTAAGCCTATTTACTTAGTATAAGTACCTGACTCTTTGGTGCAATAAGGTGAAA