Homologs in group_490

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00875 FBDBKF_00875 100.0 Morganella morganii S1 pyrC dihydroorotase
NLDBIP_02790 NLDBIP_02790 100.0 Morganella morganii S4 pyrC dihydroorotase
LHKJJB_04305 LHKJJB_04305 100.0 Morganella morganii S3 pyrC dihydroorotase
HKOGLL_02740 HKOGLL_02740 100.0 Morganella morganii S5 pyrC dihydroorotase
F4V73_RS06870 F4V73_RS06870 87.1 Morganella psychrotolerans pyrC dihydroorotase
PMI_RS08210 PMI_RS08210 74.4 Proteus mirabilis HI4320 pyrC dihydroorotase

Distribution of the homologs in the orthogroup group_490

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_490

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N5W0 0.0 562 75 0 348 3 pyrC Dihydroorotase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B6I9D9 0.0 558 76 0 347 3 pyrC Dihydroorotase Escherichia coli (strain SE11)
B7M937 0.0 558 76 0 347 3 pyrC Dihydroorotase Escherichia coli O8 (strain IAI1)
B7LFZ6 0.0 558 76 0 347 3 pyrC Dihydroorotase Escherichia coli (strain 55989 / EAEC)
A7ZKG7 0.0 558 76 0 347 3 pyrC Dihydroorotase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z354 0.0 558 76 0 347 3 pyrC Dihydroorotase Shigella sonnei (strain Ss046)
P05020 0.0 558 76 0 347 1 pyrC Dihydroorotase Escherichia coli (strain K12)
B1X9H5 0.0 558 76 0 347 3 pyrC Dihydroorotase Escherichia coli (strain K12 / DH10B)
C4ZS02 0.0 558 76 0 347 3 pyrC Dihydroorotase Escherichia coli (strain K12 / MC4100 / BW2952)
B1LIU8 0.0 557 75 0 347 3 pyrC Dihydroorotase Escherichia coli (strain SMS-3-5 / SECEC)
B1IV40 0.0 557 75 0 347 1 pyrC Dihydroorotase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZ20 0.0 557 75 0 347 3 pyrC Dihydroorotase Escherichia coli O9:H4 (strain HS)
B7MTJ3 0.0 557 75 0 347 3 pyrC Dihydroorotase Escherichia coli O81 (strain ED1a)
B7UP76 0.0 557 75 0 347 3 pyrC Dihydroorotase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A8AI14 0.0 557 75 0 347 3 pyrC Dihydroorotase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0TJ12 0.0 557 75 0 347 3 pyrC Dihydroorotase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q32ES3 0.0 556 75 0 347 3 pyrC Dihydroorotase Shigella dysenteriae serotype 1 (strain Sd197)
B7LT74 0.0 556 75 0 347 3 pyrC Dihydroorotase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5YVT2 0.0 556 75 0 347 3 pyrC Dihydroorotase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8N8 0.0 556 75 0 347 3 pyrC Dihydroorotase Escherichia coli O157:H7
Q83RT8 0.0 556 75 0 347 3 pyrC Dihydroorotase Shigella flexneri
B7NL72 0.0 556 75 0 347 3 pyrC Dihydroorotase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B2TTK9 0.0 555 75 0 347 3 pyrC Dihydroorotase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RD95 0.0 555 75 0 347 3 pyrC Dihydroorotase Escherichia coli (strain UTI89 / UPEC)
A1A9V7 0.0 555 75 0 347 3 pyrC Dihydroorotase Escherichia coli O1:K1 / APEC
B7MIK3 0.0 555 75 0 347 3 pyrC Dihydroorotase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NAT7 0.0 555 75 0 347 3 pyrC Dihydroorotase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0T5X0 0.0 554 75 0 347 3 pyrC Dihydroorotase Shigella flexneri serotype 5b (strain 8401)
Q31ZB7 0.0 554 75 0 347 3 pyrC Dihydroorotase Shigella boydii serotype 4 (strain Sb227)
Q8FIR2 0.0 553 75 0 347 3 pyrC Dihydroorotase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A9MH00 0.0 549 74 0 347 3 pyrC Dihydroorotase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6T7D6 0.0 548 74 0 347 1 pyrC Dihydroorotase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TSS5 0.0 547 74 0 347 3 pyrC Dihydroorotase Salmonella schwarzengrund (strain CVM19633)
B5BBC6 0.0 546 74 0 347 3 pyrC Dihydroorotase Salmonella paratyphi A (strain AKU_12601)
Q5PGW5 0.0 546 74 0 347 3 pyrC Dihydroorotase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5XXJ5 0.0 546 74 0 347 3 pyrC Dihydroorotase Klebsiella pneumoniae (strain 342)
C0Q845 0.0 546 74 0 347 3 pyrC Dihydroorotase Salmonella paratyphi C (strain RKS4594)
B5RBD7 0.0 546 74 0 347 3 pyrC Dihydroorotase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QY02 0.0 546 74 0 347 3 pyrC Dihydroorotase Salmonella enteritidis PT4 (strain P125109)
B5FL01 0.0 546 74 0 347 3 pyrC Dihydroorotase Salmonella dublin (strain CT_02021853)
Q57QJ4 0.0 546 74 0 347 3 pyrC Dihydroorotase Salmonella choleraesuis (strain SC-B67)
A9N5P9 0.0 545 74 0 347 3 pyrC Dihydroorotase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T2Z5 0.0 545 74 0 347 3 pyrC Dihydroorotase Salmonella newport (strain SL254)
B5F944 0.0 545 74 0 347 3 pyrC Dihydroorotase Salmonella agona (strain SL483)
Q8Z7L2 0.0 543 74 0 347 3 pyrC Dihydroorotase Salmonella typhi
B4TET5 0.0 542 74 0 347 3 pyrC Dihydroorotase Salmonella heidelberg (strain SL476)
P06204 0.0 541 73 0 347 1 pyrC Dihydroorotase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A7MG30 0.0 535 72 0 347 3 pyrC Dihydroorotase Cronobacter sakazakii (strain ATCC BAA-894)
A4W975 0.0 533 73 0 347 3 pyrC Dihydroorotase Enterobacter sp. (strain 638)
A8GD09 0.0 532 71 0 347 3 pyrC Dihydroorotase Serratia proteamaculans (strain 568)
C6DKU3 0.0 531 72 0 347 3 pyrC Dihydroorotase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1JN45 0.0 529 70 0 347 3 pyrC Dihydroorotase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4TLT2 0.0 521 70 0 347 3 pyrC Dihydroorotase Yersinia pestis (strain Pestoides F)
Q1CI09 0.0 521 70 0 347 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7Y6 0.0 521 70 0 347 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFU4 0.0 521 70 0 347 1 pyrC Dihydroorotase Yersinia pestis
Q1C6L6 0.0 521 70 0 347 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Antiqua)
Q669K2 0.0 521 70 0 347 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K767 0.0 521 70 0 347 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q6D698 0.0 521 70 0 347 3 pyrC Dihydroorotase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7FH16 0.0 520 70 0 347 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JHH4 0.0 518 70 0 347 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
C5BA73 0.0 508 68 0 341 3 pyrC Dihydroorotase Edwardsiella ictaluri (strain 93-146)
B2VDJ8 2.19e-180 506 70 1 348 3 pyrC Dihydroorotase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2G9U3 9.21e-153 436 61 0 340 3 pyrC Dihydroorotase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q2NCC9 1.78e-150 430 60 0 341 3 pyrC Dihydroorotase Erythrobacter litoralis (strain HTCC2594)
Q2SCE3 6.04e-149 426 57 0 344 3 pyrC Dihydroorotase Hahella chejuensis (strain KCTC 2396)
A5GR03 2.05e-146 420 61 1 344 3 pyrC Dihydroorotase Synechococcus sp. (strain RCC307)
Q1GT81 3.2e-146 419 61 1 337 3 pyrC Dihydroorotase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q3AKY8 1.61e-145 417 61 1 340 3 pyrC Dihydroorotase Synechococcus sp. (strain CC9605)
Q7U618 3.74e-144 414 59 1 343 3 pyrC Dihydroorotase Parasynechococcus marenigrum (strain WH8102)
A9BSM4 2.91e-143 412 57 1 346 3 pyrC Dihydroorotase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q9KL24 2.02e-142 409 57 1 343 1 pyrC Dihydroorotase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q087W5 4.86e-142 409 58 3 346 3 pyrC Dihydroorotase Shewanella frigidimarina (strain NCIMB 400)
Q1LRD4 2.94e-141 407 59 0 338 3 pyrC Dihydroorotase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A5VZH8 2.17e-140 404 58 0 337 3 pyrC Dihydroorotase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A7N655 5.25e-140 403 56 1 343 3 pyrC Dihydroorotase Vibrio campbellii (strain ATCC BAA-1116)
B2AH54 1.66e-139 402 58 0 341 3 pyrC Dihydroorotase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q475T7 2.06e-139 402 58 0 341 3 pyrC Dihydroorotase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0HRV9 4.33e-139 401 55 0 343 3 pyrC Dihydroorotase Shewanella sp. (strain MR-7)
Q0HLX7 4.33e-139 401 55 0 343 3 pyrC Dihydroorotase Shewanella sp. (strain MR-4)
A0L0B8 4.33e-139 401 55 0 343 3 pyrC Dihydroorotase Shewanella sp. (strain ANA-3)
A1RGK8 4.57e-139 401 55 0 343 3 pyrC Dihydroorotase Shewanella sp. (strain W3-18-1)
A4Y9S5 5.27e-139 401 55 0 343 3 pyrC Dihydroorotase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q87J46 7.88e-139 400 56 1 343 3 pyrC Dihydroorotase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B1J4I2 2.62e-138 399 57 0 337 3 pyrC Dihydroorotase Pseudomonas putida (strain W619)
Q88NW7 8.43e-138 398 57 0 337 3 pyrC Dihydroorotase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0KEE2 8.46e-138 398 57 0 341 3 pyrC Dihydroorotase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B0KUE9 8.52e-138 398 56 0 337 3 pyrC Dihydroorotase Pseudomonas putida (strain GB-1)
Q3AYG9 9.22e-138 398 58 1 343 3 pyrC Dihydroorotase Synechococcus sp. (strain CC9902)
Q7MFB3 9.3e-138 397 55 1 343 3 pyrC Dihydroorotase Vibrio vulnificus (strain YJ016)
Q4K747 4.53e-137 396 57 0 337 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A1U3L1 5.71e-137 395 59 4 345 3 pyrC Dihydroorotase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q5E0G4 6.36e-137 395 54 1 343 3 pyrC Dihydroorotase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q3K7J8 9.02e-137 395 56 0 337 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain Pf0-1)
Q8D3T9 9.63e-137 395 54 1 343 3 pyrC Dihydroorotase Vibrio vulnificus (strain CMCP6)
B2UFJ8 3.83e-136 394 58 0 338 3 pyrC Dihydroorotase Ralstonia pickettii (strain 12J)
B5ETI9 4.07e-136 394 54 1 343 3 pyrC Dihydroorotase Aliivibrio fischeri (strain MJ11)
B6ER91 1.2e-135 392 53 1 343 3 pyrC Dihydroorotase Aliivibrio salmonicida (strain LFI1238)
Q8Y249 1.99e-135 392 57 0 340 3 pyrC Dihydroorotase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B1XWS5 5.21e-135 391 57 1 339 3 pyrC Dihydroorotase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
C1DQV1 2.05e-134 389 56 0 337 3 pyrC Dihydroorotase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A4XS41 2.55e-134 389 56 0 339 3 pyrC Dihydroorotase Pseudomonas mendocina (strain ymp)
Q28RK3 2.75e-134 389 55 1 343 3 pyrC Dihydroorotase Jannaschia sp. (strain CCS1)
C5CMK6 6.99e-134 388 56 1 340 3 pyrC Dihydroorotase Variovorax paradoxus (strain S110)
Q1IE05 8.77e-134 388 55 0 337 3 pyrC Dihydroorotase Pseudomonas entomophila (strain L48)
A1K3T5 1.26e-133 387 57 1 341 3 pyrC Dihydroorotase Azoarcus sp. (strain BH72)
B7VQP0 1.37e-133 387 54 1 343 3 pyrC Dihydroorotase Vibrio atlanticus (strain LGP32)
Q6FD29 1.44e-133 387 52 1 339 3 pyrC Dihydroorotase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5LQ43 1.61e-133 387 57 1 341 3 pyrC Dihydroorotase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B8E4P5 2.83e-133 386 55 0 343 3 pyrC Dihydroorotase Shewanella baltica (strain OS223)
A9L3F5 3.37e-133 386 55 0 343 3 pyrC Dihydroorotase Shewanella baltica (strain OS195)
A1WC79 3.66e-133 386 57 1 333 3 pyrC Dihydroorotase Acidovorax sp. (strain JS42)
B1KEK5 4.2e-133 386 56 3 346 3 pyrC Dihydroorotase Shewanella woodyi (strain ATCC 51908 / MS32)
A6WK08 5.27e-133 385 55 0 343 3 pyrC Dihydroorotase Shewanella baltica (strain OS185)
Q48F12 7.12e-133 385 55 0 340 3 pyrC Dihydroorotase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8EB40 1.66e-132 384 55 0 343 3 pyrC Dihydroorotase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A6VXW9 2.02e-132 384 54 3 346 3 pyrC Dihydroorotase Marinomonas sp. (strain MWYL1)
A4VIU5 2.03e-132 384 56 0 340 3 pyrC Dihydroorotase Stutzerimonas stutzeri (strain A1501)
C3KBZ0 2.29e-132 384 55 0 337 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain SBW25)
B8CT15 2.81e-132 384 56 3 346 3 pyrC Dihydroorotase Shewanella piezotolerans (strain WP3 / JCM 13877)
A3D7V9 3.02e-132 384 54 0 343 3 pyrC Dihydroorotase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q6LPI7 3.26e-132 384 54 1 342 3 pyrC Dihydroorotase Photobacterium profundum (strain SS9)
Q87XM1 4.22e-132 384 55 0 340 3 pyrC Dihydroorotase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A9M2W6 5.52e-132 383 55 2 344 3 pyrC Dihydroorotase Neisseria meningitidis serogroup C (strain 053442)
Q02QZ8 5.55e-132 383 56 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain UCBPP-PA14)
P72170 6.69e-132 383 56 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVV3 6.98e-132 383 56 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain LESB58)
Q12NL3 8.36e-132 382 54 0 340 3 pyrC Dihydroorotase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0AB36 9.21e-132 382 56 0 339 3 pyrC Dihydroorotase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q4ZPJ8 1.02e-131 382 55 0 340 3 pyrC Dihydroorotase Pseudomonas syringae pv. syringae (strain B728a)
A1SX20 1.12e-131 382 53 1 341 3 pyrC Dihydroorotase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0TRS6 1.92e-131 382 55 3 346 3 pyrC Dihydroorotase Shewanella halifaxensis (strain HAW-EB4)
Q1GFQ7 2.07e-131 382 55 1 342 3 pyrC Dihydroorotase Ruegeria sp. (strain TM1040)
C1D672 2.29e-131 382 55 1 341 3 pyrC Dihydroorotase Laribacter hongkongensis (strain HLHK9)
B0VAC1 2.78e-131 381 52 1 341 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AYE)
A3M3K3 2.78e-131 381 52 1 341 3 pyrC Dihydroorotase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWF6 2.78e-131 381 52 1 341 3 pyrC Dihydroorotase Acinetobacter baumannii (strain ACICU)
B7I9G6 2.78e-131 381 52 1 341 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AB0057)
B7GX48 2.78e-131 381 52 1 341 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AB307-0294)
Q9K0D1 3.31e-131 381 55 2 344 3 pyrC Dihydroorotase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1S9L6 3.44e-131 381 54 1 343 3 pyrC Dihydroorotase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5P6Y5 3.46e-131 381 55 1 343 3 pyrC Dihydroorotase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A6V1R9 3.92e-131 381 55 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain PA7)
Q9JVD6 5.17e-131 380 55 2 344 3 pyrC Dihydroorotase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A8FZC6 1.09e-130 380 54 3 346 3 pyrC Dihydroorotase Shewanella sediminis (strain HAW-EB3)
A8H7J4 1.11e-130 380 55 3 346 3 pyrC Dihydroorotase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0VKW9 1.19e-130 380 51 1 341 3 pyrC Dihydroorotase Acinetobacter baumannii (strain SDF)
C5BNK6 2.09e-130 379 55 1 341 3 pyrC Dihydroorotase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q5F9Y1 2.21e-130 379 54 2 344 3 pyrC Dihydroorotase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B8D7M3 2.51e-130 379 49 1 348 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D9C1 2.51e-130 379 49 1 348 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57416 2.63e-130 379 48 1 348 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9L2 2.65e-130 379 48 1 336 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q5QWC6 3.81e-130 378 54 0 343 3 pyrC Dihydroorotase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B1XI96 5.79e-130 378 54 0 340 3 pyrC Dihydroorotase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B4RJT2 1.23e-129 377 54 2 344 3 pyrC Dihydroorotase Neisseria gonorrhoeae (strain NCCP11945)
A1KSU5 1.44e-129 377 54 2 344 3 pyrC Dihydroorotase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q3J872 1.63e-129 377 53 0 340 3 pyrC Dihydroorotase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A3QAV2 4.68e-129 375 54 1 343 3 pyrC Dihydroorotase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q92SC7 7.3e-129 375 57 0 312 3 pyrC Dihydroorotase Rhizobium meliloti (strain 1021)
B9JQV9 7.99e-129 375 55 1 343 3 pyrC Dihydroorotase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A6U5N6 1.09e-128 375 57 0 312 3 pyrC Dihydroorotase Sinorhizobium medicae (strain WSM419)
Q11IA4 1.12e-128 375 57 0 315 3 pyrC Dihydroorotase Chelativorans sp. (strain BNC1)
Q0JJD1 2.19e-128 376 53 2 343 2 PYRC Dihydroorotase, mitochondrial Oryza sativa subsp. japonica
O04904 2.25e-128 375 54 2 340 1 PYR4 Dihydroorotase, mitochondrial Arabidopsis thaliana
B0JQJ1 4.8e-127 370 53 0 339 3 pyrC Dihydroorotase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B3Q0A1 4.99e-127 370 55 2 333 3 pyrC Dihydroorotase Rhizobium etli (strain CIAT 652)
B5ZNS1 1.46e-126 369 55 2 333 3 pyrC Dihydroorotase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q0VNK6 2.66e-126 369 54 0 340 3 pyrC Dihydroorotase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q15YC5 9.54e-126 367 53 3 346 3 pyrC Dihydroorotase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q8UI99 3.62e-125 366 52 1 344 3 pyrC Dihydroorotase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2KCZ6 4.93e-125 365 52 1 345 3 pyrC Dihydroorotase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B0CF78 1.58e-124 364 52 0 342 3 pyrC Dihydroorotase Acaryochloris marina (strain MBIC 11017)
A4WPB7 4.08e-124 363 53 1 342 3 pyrC Dihydroorotase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q1MM16 1.95e-123 362 55 0 314 3 pyrC Dihydroorotase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q82WF3 3.05e-123 361 50 1 348 3 pyrC Dihydroorotase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
C3MF80 7.18e-123 360 55 0 313 3 pyrC Dihydroorotase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B9J8H5 7.19e-123 360 51 1 345 3 pyrC Dihydroorotase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q163V6 9.84e-123 360 53 0 340 3 pyrC Dihydroorotase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
P74438 1.91e-122 358 52 1 342 3 pyrC Dihydroorotase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A9NA67 3.74e-122 358 49 0 343 3 pyrC Dihydroorotase Coxiella burnetii (strain RSA 331 / Henzerling II)
A1WV00 2.02e-121 356 52 0 338 3 pyrC Dihydroorotase Halorhodospira halophila (strain DSM 244 / SL1)
Q0AFI1 1.57e-120 354 51 1 340 3 pyrC Dihydroorotase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1GYZ0 1.74e-117 346 52 0 343 3 pyrC Dihydroorotase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9S3S1 3.66e-105 310 72 0 200 3 pyrC Dihydroorotase (Fragment) Serratia marcescens
Q7VIJ1 2.48e-60 200 35 8 346 3 pyrC Dihydroorotase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q9UTI0 5.99e-54 183 35 9 342 3 ura2 Probable dihydroorotase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P20051 2.01e-51 177 34 12 358 1 URA4 Dihydroorotase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P31301 2.34e-51 178 32 12 399 2 PYR3 Dihydroorotase Ustilago maydis (strain 521 / FGSC 9021)
Q1CTU5 4.73e-50 173 31 6 338 3 pyrC Dihydroorotase Helicobacter pylori (strain HPAG1)
Q17W17 4.63e-49 171 30 6 338 3 pyrC Dihydroorotase Helicobacter acinonychis (strain Sheeba)
B2UTP7 6.11e-49 170 31 7 340 3 pyrC Dihydroorotase Helicobacter pylori (strain Shi470)
B6JLG3 7.71e-49 170 30 7 340 3 pyrC Dihydroorotase Helicobacter pylori (strain P12)
Q9ZLQ0 1.05e-48 169 31 6 338 3 pyrC Dihydroorotase Helicobacter pylori (strain J99 / ATCC 700824)
P56465 1.33e-48 169 34 5 296 3 pyrC Dihydroorotase Helicobacter pylori (strain ATCC 700392 / 26695)
B5Z6V2 1.5e-47 167 30 6 338 3 pyrC Dihydroorotase Helicobacter pylori (strain G27)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_00670
Feature type CDS
Gene pyrC
Product dihydroorotase
Location 151444 - 152496 (strand: -1)
Length 1053 (nucleotides) / 350 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_490
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0418 Nucleotide transport and metabolism (F) F Dihydroorotase

Protein Sequence

MTHPVTSLKIRRPDDWHIHFRDGAMLGTVVPFTSEFFGRAIVMPNLVPPVTTTDAAIAYRDRILAAVPQGHSFTPLMTCYLTDNADPAEIERGFREGVFTACKLYPANATTNSAHGVSDIRNIYPVLEMMSRNGMPLLVHGEVTHADIDIFDREARFIDDVMIPLRRDFPALKVVFEHITTKEAAQYVLDGDDNVAATLTPQHLMFNRNHMLVGGVRPHLFCLPILKRNVHQEALRQAVAGGCKRFFLGTDSAPHARHRKESSCGCAGVFNAPTALAAYATVFEELNALEHFEAFCSLNGPAFYGLPVNDGFIELTRQEVITPETINGAEDVLVPFLAGTDTRWDVKICR

Flanking regions ( +/- flanking 50bp)

TTATGGCACCCGCCATCAGGTTATCCTTTACTTATTTCGGAGCCGGTTCAATGACTCATCCTGTTACTTCCCTGAAAATCCGCCGCCCTGACGACTGGCATATCCATTTCCGTGATGGTGCGATGCTCGGTACTGTTGTGCCTTTCACCAGTGAATTTTTCGGGCGCGCCATTGTGATGCCGAACCTGGTTCCGCCGGTCACCACCACCGATGCCGCCATTGCGTACCGTGACCGTATTCTGGCCGCCGTACCGCAGGGGCACAGTTTCACCCCGCTGATGACCTGCTATCTGACCGATAACGCAGACCCGGCTGAGATTGAACGCGGTTTCCGCGAAGGTGTGTTTACCGCCTGTAAACTGTATCCGGCGAATGCGACCACCAACTCCGCACATGGCGTGTCAGATATCCGCAATATTTATCCGGTGCTGGAGATGATGTCCCGCAATGGTATGCCGTTGCTGGTACACGGTGAAGTGACACACGCCGATATTGATATTTTCGACCGTGAAGCCCGTTTTATTGATGATGTGATGATCCCGCTGCGCCGTGATTTCCCGGCACTGAAAGTGGTGTTCGAGCATATCACCACCAAAGAAGCTGCTCAGTATGTGCTGGACGGGGATGATAATGTCGCCGCCACACTGACACCGCAGCATCTGATGTTTAACCGCAACCATATGCTGGTCGGCGGTGTGCGTCCGCATCTGTTCTGCCTGCCGATCCTGAAACGTAATGTGCATCAGGAAGCACTGCGTCAGGCAGTGGCCGGCGGCTGCAAACGGTTCTTCCTCGGCACGGACAGCGCTCCGCATGCCCGTCACCGCAAAGAGTCCTCCTGCGGCTGTGCCGGGGTGTTCAATGCCCCGACCGCACTGGCCGCTTATGCCACGGTATTTGAGGAGCTGAACGCGCTGGAGCACTTTGAGGCATTCTGTTCACTGAACGGCCCGGCGTTTTATGGTCTGCCGGTCAATGACGGCTTTATCGAATTAACCCGTCAGGAAGTCATCACCCCGGAAACCATTAACGGTGCAGAGGATGTTTTAGTGCCTTTCCTGGCCGGAACTGATACCCGCTGGGATGTTAAAATCTGTCGTTAAGCAAAATAAACCAGGTATAAACACTCAGACTTTTAGTGCAATAAGGTAAA