Homologs in group_490

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00875 FBDBKF_00875 74.4 Morganella morganii S1 pyrC dihydroorotase
EHELCC_00670 EHELCC_00670 74.4 Morganella morganii S2 pyrC dihydroorotase
NLDBIP_02790 NLDBIP_02790 74.4 Morganella morganii S4 pyrC dihydroorotase
LHKJJB_04305 LHKJJB_04305 74.4 Morganella morganii S3 pyrC dihydroorotase
HKOGLL_02740 HKOGLL_02740 74.4 Morganella morganii S5 pyrC dihydroorotase
F4V73_RS06870 F4V73_RS06870 71.3 Morganella psychrotolerans pyrC dihydroorotase

Distribution of the homologs in the orthogroup group_490

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_490

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N5W0 0.0 563 74 0 347 3 pyrC Dihydroorotase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GD09 0.0 547 73 0 345 3 pyrC Dihydroorotase Serratia proteamaculans (strain 568)
A1JN45 0.0 540 72 0 345 3 pyrC Dihydroorotase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DKU3 0.0 538 71 0 345 3 pyrC Dihydroorotase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5XXJ5 0.0 536 70 0 346 3 pyrC Dihydroorotase Klebsiella pneumoniae (strain 342)
A4TLT2 0.0 532 70 0 346 3 pyrC Dihydroorotase Yersinia pestis (strain Pestoides F)
Q1CI09 0.0 532 70 0 346 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7Y6 0.0 532 70 0 346 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFU4 0.0 532 70 0 346 1 pyrC Dihydroorotase Yersinia pestis
Q1C6L6 0.0 532 70 0 346 3 pyrC Dihydroorotase Yersinia pestis bv. Antiqua (strain Antiqua)
Q669K2 0.0 531 70 0 346 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K767 0.0 531 70 0 346 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A6T7D6 0.0 531 69 0 346 1 pyrC Dihydroorotase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7FH16 0.0 531 70 0 346 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B7LT74 0.0 531 71 0 346 3 pyrC Dihydroorotase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7MG30 0.0 529 70 0 346 3 pyrC Dihydroorotase Cronobacter sakazakii (strain ATCC BAA-894)
B1JHH4 0.0 529 70 0 346 3 pyrC Dihydroorotase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A8AI14 0.0 525 69 0 346 3 pyrC Dihydroorotase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B6I9D9 0.0 523 69 0 346 3 pyrC Dihydroorotase Escherichia coli (strain SE11)
B7M937 0.0 523 69 0 346 3 pyrC Dihydroorotase Escherichia coli O8 (strain IAI1)
B7LFZ6 0.0 523 69 0 346 3 pyrC Dihydroorotase Escherichia coli (strain 55989 / EAEC)
A7ZKG7 0.0 523 69 0 346 3 pyrC Dihydroorotase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z354 0.0 522 69 0 346 3 pyrC Dihydroorotase Shigella sonnei (strain Ss046)
P05020 0.0 522 69 0 346 1 pyrC Dihydroorotase Escherichia coli (strain K12)
Q0TJ12 0.0 522 69 0 346 3 pyrC Dihydroorotase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1X9H5 0.0 522 69 0 346 3 pyrC Dihydroorotase Escherichia coli (strain K12 / DH10B)
C4ZS02 0.0 522 69 0 346 3 pyrC Dihydroorotase Escherichia coli (strain K12 / MC4100 / BW2952)
Q6D698 0.0 522 69 0 345 3 pyrC Dihydroorotase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1LIU8 0.0 522 69 0 346 3 pyrC Dihydroorotase Escherichia coli (strain SMS-3-5 / SECEC)
B1IV40 0.0 522 69 0 346 1 pyrC Dihydroorotase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZ20 0.0 522 69 0 346 3 pyrC Dihydroorotase Escherichia coli O9:H4 (strain HS)
B7MTJ3 0.0 522 69 0 346 3 pyrC Dihydroorotase Escherichia coli O81 (strain ED1a)
B7UP76 0.0 522 69 0 346 3 pyrC Dihydroorotase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NAT7 0.0 521 69 0 346 3 pyrC Dihydroorotase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5YVT2 0.0 521 69 0 346 3 pyrC Dihydroorotase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8N8 0.0 521 69 0 346 3 pyrC Dihydroorotase Escherichia coli O157:H7
A4W975 0.0 521 69 0 346 3 pyrC Dihydroorotase Enterobacter sp. (strain 638)
Q32ES3 0.0 520 69 0 346 3 pyrC Dihydroorotase Shigella dysenteriae serotype 1 (strain Sd197)
Q83RT8 0.0 520 69 0 346 3 pyrC Dihydroorotase Shigella flexneri
B2TTK9 0.0 520 69 0 346 3 pyrC Dihydroorotase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RD95 0.0 520 69 0 346 3 pyrC Dihydroorotase Escherichia coli (strain UTI89 / UPEC)
A1A9V7 0.0 520 69 0 346 3 pyrC Dihydroorotase Escherichia coli O1:K1 / APEC
B7NL72 0.0 520 69 0 346 3 pyrC Dihydroorotase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MIK3 0.0 520 69 0 346 3 pyrC Dihydroorotase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q31ZB7 0.0 519 69 0 346 3 pyrC Dihydroorotase Shigella boydii serotype 4 (strain Sb227)
A9MH00 0.0 519 68 0 346 3 pyrC Dihydroorotase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q0T5X0 0.0 518 69 0 346 3 pyrC Dihydroorotase Shigella flexneri serotype 5b (strain 8401)
Q8FIR2 0.0 518 69 0 346 3 pyrC Dihydroorotase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B4TSS5 0.0 518 68 0 345 3 pyrC Dihydroorotase Salmonella schwarzengrund (strain CVM19633)
B4TET5 0.0 518 68 0 345 3 pyrC Dihydroorotase Salmonella heidelberg (strain SL476)
C0Q845 0.0 517 68 0 345 3 pyrC Dihydroorotase Salmonella paratyphi C (strain RKS4594)
A9N5P9 0.0 517 68 0 345 3 pyrC Dihydroorotase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5RBD7 0.0 517 68 0 345 3 pyrC Dihydroorotase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QY02 0.0 517 68 0 345 3 pyrC Dihydroorotase Salmonella enteritidis PT4 (strain P125109)
B5FL01 0.0 517 68 0 345 3 pyrC Dihydroorotase Salmonella dublin (strain CT_02021853)
Q57QJ4 0.0 517 68 0 345 3 pyrC Dihydroorotase Salmonella choleraesuis (strain SC-B67)
B4T2Z5 0.0 516 68 0 345 3 pyrC Dihydroorotase Salmonella newport (strain SL254)
P06204 0.0 516 68 0 345 1 pyrC Dihydroorotase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5F944 0.0 516 68 0 345 3 pyrC Dihydroorotase Salmonella agona (strain SL483)
B5BBC6 0.0 511 68 0 345 3 pyrC Dihydroorotase Salmonella paratyphi A (strain AKU_12601)
Q5PGW5 0.0 511 68 0 345 3 pyrC Dihydroorotase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z7L2 0.0 509 68 0 345 3 pyrC Dihydroorotase Salmonella typhi
B2VDJ8 0.0 507 67 1 349 3 pyrC Dihydroorotase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BA73 2.03e-175 493 67 0 340 3 pyrC Dihydroorotase Edwardsiella ictaluri (strain 93-146)
Q2G9U3 3.83e-151 432 60 0 341 3 pyrC Dihydroorotase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q2NCC9 1.35e-148 425 58 0 341 3 pyrC Dihydroorotase Erythrobacter litoralis (strain HTCC2594)
A5GR03 2.1e-148 425 58 1 346 3 pyrC Dihydroorotase Synechococcus sp. (strain RCC307)
Q1GT81 7.54e-148 423 59 2 339 3 pyrC Dihydroorotase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2SCE3 7.74e-147 421 56 0 337 3 pyrC Dihydroorotase Hahella chejuensis (strain KCTC 2396)
Q4K747 6.3e-145 416 57 0 339 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A4Y9S5 5.08e-144 414 56 0 340 3 pyrC Dihydroorotase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q7U618 8.87e-144 413 58 2 340 3 pyrC Dihydroorotase Parasynechococcus marenigrum (strain WH8102)
Q0HRV9 3.26e-143 411 56 0 340 3 pyrC Dihydroorotase Shewanella sp. (strain MR-7)
Q0HLX7 3.26e-143 411 56 0 340 3 pyrC Dihydroorotase Shewanella sp. (strain MR-4)
A0L0B8 3.26e-143 411 56 0 340 3 pyrC Dihydroorotase Shewanella sp. (strain ANA-3)
A1RGK8 5.56e-143 411 56 0 340 3 pyrC Dihydroorotase Shewanella sp. (strain W3-18-1)
A9BSM4 6.45e-143 411 56 1 345 3 pyrC Dihydroorotase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q3K7J8 7.55e-143 411 56 0 339 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain Pf0-1)
Q8Y249 2.94e-142 409 57 0 338 3 pyrC Dihydroorotase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3AKY8 8e-142 408 57 2 340 3 pyrC Dihydroorotase Synechococcus sp. (strain CC9605)
B2UFJ8 4.51e-141 406 56 0 338 3 pyrC Dihydroorotase Ralstonia pickettii (strain 12J)
Q7MFB3 5.29e-141 406 56 1 340 3 pyrC Dihydroorotase Vibrio vulnificus (strain YJ016)
Q1LRD4 1.21e-140 405 56 0 340 3 pyrC Dihydroorotase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
C3KBZ0 1.74e-140 405 56 0 339 3 pyrC Dihydroorotase Pseudomonas fluorescens (strain SBW25)
Q8D3T9 2.34e-140 404 55 1 340 3 pyrC Dihydroorotase Vibrio vulnificus (strain CMCP6)
Q475T7 7.72e-140 403 56 0 337 3 pyrC Dihydroorotase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q88NW7 1.71e-139 402 55 0 339 3 pyrC Dihydroorotase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VZH8 1.8e-139 402 55 0 339 3 pyrC Dihydroorotase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KUE9 2.53e-139 402 55 0 339 3 pyrC Dihydroorotase Pseudomonas putida (strain GB-1)
Q087W5 6.03e-139 401 56 2 340 3 pyrC Dihydroorotase Shewanella frigidimarina (strain NCIMB 400)
B2AH54 9.42e-139 400 56 0 337 3 pyrC Dihydroorotase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B5ETI9 1.77e-138 399 55 1 338 3 pyrC Dihydroorotase Aliivibrio fischeri (strain MJ11)
B1J4I2 2.74e-138 399 54 0 339 3 pyrC Dihydroorotase Pseudomonas putida (strain W619)
A7N655 4.06e-138 399 55 1 340 3 pyrC Dihydroorotase Vibrio campbellii (strain ATCC BAA-1116)
Q6LPI7 7.32e-138 398 55 1 340 3 pyrC Dihydroorotase Photobacterium profundum (strain SS9)
B8E4P5 7.74e-138 398 55 0 340 3 pyrC Dihydroorotase Shewanella baltica (strain OS223)
Q0KEE2 9.65e-138 398 55 0 337 3 pyrC Dihydroorotase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5E0G4 1.24e-137 397 55 1 338 3 pyrC Dihydroorotase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8K9L2 1.64e-137 397 52 1 335 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q87J46 2.38e-137 397 55 1 341 3 pyrC Dihydroorotase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4XS41 2.65e-137 397 54 0 339 3 pyrC Dihydroorotase Pseudomonas mendocina (strain ymp)
Q1GFQ7 3.05e-137 396 55 1 343 3 pyrC Dihydroorotase Ruegeria sp. (strain TM1040)
Q48F12 3.12e-137 396 54 0 339 3 pyrC Dihydroorotase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8EB40 4.49e-137 396 55 0 340 3 pyrC Dihydroorotase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9KL24 6.79e-137 395 54 1 340 1 pyrC Dihydroorotase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A9L3F5 7.19e-137 395 55 0 340 3 pyrC Dihydroorotase Shewanella baltica (strain OS195)
A1U3L1 8.19e-137 395 57 4 342 3 pyrC Dihydroorotase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1SX20 9.24e-137 395 55 1 340 3 pyrC Dihydroorotase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q5LQ43 1.52e-136 395 55 1 342 3 pyrC Dihydroorotase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q4ZPJ8 2e-136 394 54 0 339 3 pyrC Dihydroorotase Pseudomonas syringae pv. syringae (strain B728a)
A6WK08 2.19e-136 394 55 0 340 3 pyrC Dihydroorotase Shewanella baltica (strain OS185)
Q1IE05 2.55e-136 394 54 0 339 3 pyrC Dihydroorotase Pseudomonas entomophila (strain L48)
A3D7V9 3.39e-136 394 55 0 340 3 pyrC Dihydroorotase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B1KEK5 3.59e-136 394 55 2 340 3 pyrC Dihydroorotase Shewanella woodyi (strain ATCC 51908 / MS32)
C5CMK6 3.66e-136 394 55 1 340 3 pyrC Dihydroorotase Variovorax paradoxus (strain S110)
A1WC79 4.44e-136 394 56 1 335 3 pyrC Dihydroorotase Acidovorax sp. (strain JS42)
Q87XM1 6.64e-136 393 54 0 339 3 pyrC Dihydroorotase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B8CT15 1.32e-135 392 55 2 340 3 pyrC Dihydroorotase Shewanella piezotolerans (strain WP3 / JCM 13877)
B6ER91 1.33e-135 392 54 1 338 3 pyrC Dihydroorotase Aliivibrio salmonicida (strain LFI1238)
C1DQV1 1.53e-135 392 53 0 342 3 pyrC Dihydroorotase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A9M2W6 1.97e-135 392 55 2 342 3 pyrC Dihydroorotase Neisseria meningitidis serogroup C (strain 053442)
Q92SC7 2.9e-135 391 54 1 342 3 pyrC Dihydroorotase Rhizobium meliloti (strain 1021)
A4VIU5 3.2e-135 391 53 0 342 3 pyrC Dihydroorotase Stutzerimonas stutzeri (strain A1501)
Q9JVD6 4.28e-135 391 55 2 342 3 pyrC Dihydroorotase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F9Y1 1.26e-134 390 55 2 342 3 pyrC Dihydroorotase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9K0D1 1.29e-134 390 55 2 342 3 pyrC Dihydroorotase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B7UVV3 1.43e-134 390 54 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain LESB58)
Q02QZ8 1.9e-134 389 54 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain UCBPP-PA14)
P72170 2.31e-134 389 54 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q28RK3 2.49e-134 389 54 1 342 3 pyrC Dihydroorotase Jannaschia sp. (strain CCS1)
A6V1R9 2.94e-134 389 53 0 339 3 pyrC Dihydroorotase Pseudomonas aeruginosa (strain PA7)
B4RJT2 4.94e-134 388 54 2 342 3 pyrC Dihydroorotase Neisseria gonorrhoeae (strain NCCP11945)
Q8UI99 5.46e-134 388 53 1 343 3 pyrC Dihydroorotase Agrobacterium fabrum (strain C58 / ATCC 33970)
B0TRS6 7.57e-134 388 55 2 340 3 pyrC Dihydroorotase Shewanella halifaxensis (strain HAW-EB4)
B7VQP0 7.62e-134 388 54 1 339 3 pyrC Dihydroorotase Vibrio atlanticus (strain LGP32)
B9JQV9 7.97e-134 388 53 1 342 3 pyrC Dihydroorotase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A1KSU5 1e-133 387 55 2 339 3 pyrC Dihydroorotase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A3QAV2 1.13e-133 387 54 1 339 3 pyrC Dihydroorotase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0VNK6 1.38e-133 387 54 0 341 3 pyrC Dihydroorotase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A8FZC6 1.52e-133 387 54 2 340 3 pyrC Dihydroorotase Shewanella sediminis (strain HAW-EB3)
A8H7J4 1.59e-133 387 55 2 340 3 pyrC Dihydroorotase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8D7M3 2.43e-133 387 52 1 335 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D9C1 2.43e-133 387 52 1 335 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q0AB36 3.6e-133 386 53 1 343 3 pyrC Dihydroorotase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1S9L6 5.62e-133 385 54 1 339 3 pyrC Dihydroorotase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A1K3T5 6.71e-133 385 52 1 342 3 pyrC Dihydroorotase Azoarcus sp. (strain BH72)
A6U5N6 2.05e-132 384 57 1 321 3 pyrC Dihydroorotase Sinorhizobium medicae (strain WSM419)
B1XWS5 2.07e-132 384 54 1 340 3 pyrC Dihydroorotase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
P57416 2.51e-132 384 52 1 335 3 pyrC Dihydroorotase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q11IA4 2.61e-132 384 53 1 342 3 pyrC Dihydroorotase Chelativorans sp. (strain BNC1)
Q6FD29 3.73e-132 384 53 1 339 3 pyrC Dihydroorotase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3AYG9 1.1e-131 382 57 2 335 3 pyrC Dihydroorotase Synechococcus sp. (strain CC9902)
B0CF78 2.58e-131 381 53 0 339 3 pyrC Dihydroorotase Acaryochloris marina (strain MBIC 11017)
A6VXW9 8.17e-131 380 54 2 340 3 pyrC Dihydroorotase Marinomonas sp. (strain MWYL1)
C1D672 9.04e-131 380 52 1 342 3 pyrC Dihydroorotase Laribacter hongkongensis (strain HLHK9)
Q5P6Y5 1.25e-130 380 51 1 341 3 pyrC Dihydroorotase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C3MF80 9.98e-130 377 56 1 321 3 pyrC Dihydroorotase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B1XI96 1.16e-129 377 52 0 340 3 pyrC Dihydroorotase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
C5BNK6 1.19e-129 377 53 1 340 3 pyrC Dihydroorotase Teredinibacter turnerae (strain ATCC 39867 / T7901)
B9J8H5 3.83e-129 376 52 1 341 3 pyrC Dihydroorotase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q2KCZ6 4.47e-129 376 52 1 343 3 pyrC Dihydroorotase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q12NL3 1.24e-128 374 52 0 341 3 pyrC Dihydroorotase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B0JQJ1 1.58e-128 374 51 0 339 3 pyrC Dihydroorotase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q82WF3 1.68e-128 374 51 1 342 3 pyrC Dihydroorotase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B0VAC1 3.28e-128 374 52 1 339 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AYE)
A3M3K3 3.28e-128 374 52 1 339 3 pyrC Dihydroorotase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWF6 3.28e-128 374 52 1 339 3 pyrC Dihydroorotase Acinetobacter baumannii (strain ACICU)
B7I9G6 3.28e-128 374 52 1 339 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AB0057)
B7GX48 3.28e-128 374 52 1 339 3 pyrC Dihydroorotase Acinetobacter baumannii (strain AB307-0294)
P74438 3.57e-128 373 52 1 339 3 pyrC Dihydroorotase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O04904 7.29e-128 374 53 2 346 1 PYR4 Dihydroorotase, mitochondrial Arabidopsis thaliana
B3Q0A1 7.8e-128 373 52 1 342 3 pyrC Dihydroorotase Rhizobium etli (strain CIAT 652)
A9NA67 8.33e-128 372 52 0 339 3 pyrC Dihydroorotase Coxiella burnetii (strain RSA 331 / Henzerling II)
B0VKW9 1.48e-127 372 51 1 339 3 pyrC Dihydroorotase Acinetobacter baumannii (strain SDF)
B5ZNS1 1.88e-127 372 51 1 342 3 pyrC Dihydroorotase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q0AFI1 3.62e-127 371 50 1 341 3 pyrC Dihydroorotase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q15YC5 1.88e-126 369 53 3 342 3 pyrC Dihydroorotase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q163V6 3.14e-126 369 53 0 330 3 pyrC Dihydroorotase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A1WV00 1.23e-125 367 51 0 340 3 pyrC Dihydroorotase Halorhodospira halophila (strain DSM 244 / SL1)
Q1MM16 1.81e-125 367 51 1 342 3 pyrC Dihydroorotase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q5QWC6 2.24e-125 366 50 0 340 3 pyrC Dihydroorotase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A4WPB7 4.8e-124 363 50 1 342 3 pyrC Dihydroorotase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q3J872 7.34e-124 362 51 0 341 3 pyrC Dihydroorotase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q0JJD1 1.21e-122 362 50 2 339 2 PYRC Dihydroorotase, mitochondrial Oryza sativa subsp. japonica
Q1GYZ0 4.9e-114 337 50 2 341 3 pyrC Dihydroorotase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9S3S1 3.07e-112 328 75 0 200 3 pyrC Dihydroorotase (Fragment) Serratia marcescens
Q9UTI0 3.23e-59 197 35 8 346 3 ura2 Probable dihydroorotase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7VIJ1 6.66e-57 191 35 8 347 3 pyrC Dihydroorotase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
P31301 6.31e-51 177 31 13 394 2 PYR3 Dihydroorotase Ustilago maydis (strain 521 / FGSC 9021)
Q17W17 7.52e-51 175 30 6 344 3 pyrC Dihydroorotase Helicobacter acinonychis (strain Sheeba)
Q1CTU5 1.39e-50 174 30 6 344 3 pyrC Dihydroorotase Helicobacter pylori (strain HPAG1)
B6JLG3 3.44e-50 174 30 7 346 3 pyrC Dihydroorotase Helicobacter pylori (strain P12)
B5Z6V2 4.3e-50 173 30 6 344 3 pyrC Dihydroorotase Helicobacter pylori (strain G27)
P56465 1.02e-49 172 30 6 344 3 pyrC Dihydroorotase Helicobacter pylori (strain ATCC 700392 / 26695)
B2UTP7 1.17e-49 172 30 6 344 3 pyrC Dihydroorotase Helicobacter pylori (strain Shi470)
Q9ZLQ0 2.5e-49 171 29 6 344 3 pyrC Dihydroorotase Helicobacter pylori (strain J99 / ATCC 700824)
P20051 1.89e-42 154 32 12 356 1 URA4 Dihydroorotase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P96081 6.37e-07 54 23 14 340 3 pyrC Dihydroorotase Thermus aquaticus
Q5SK67 9.23e-06 50 22 13 332 1 pyrC Dihydroorotase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08210
Feature type CDS
Gene pyrC
Product dihydroorotase
Location 1792488 - 1793540 (strand: 1)
Length 1053 (nucleotides) / 350 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_490
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0418 Nucleotide transport and metabolism (F) F Dihydroorotase

Protein Sequence

MTTAQPITLTIRRPDDWHVHFRDDDMLKTVVPYTSRYFGRAIVMPNLVPPITTIEAARRYRDRIKAAIPSGDKFEPLMTCYLTDSTLPSEVEQGFLQGVFTACKLYPANATTNSSHGVSDINKIYPILSVMEKIGMPLLIHGEVTASDIDIFDREARFIDNVMAPVRKQFPALKIVFEHITTKEAAQYVLEGNEFLGATITPQHLMFNRNHMLVGGVKPHLYCLPILKRNVHQEALRQAVASGHSRFFLGTDSAPHLQHRKESSCGCAGVFNAPTALAAYASVFKELNALSHFEAFCSLNGPRFYGLPVNEGTITLTEKSVTAPAEIMSGDEALIPFLANEDIHWDISIN

Flanking regions ( +/- flanking 50bp)

CAATCCAATCGTTGATCTTTCGATTTTCCTAAGACACACGGAGCCGGTATATGACCACTGCACAACCTATCACCCTCACTATTCGCCGTCCTGATGATTGGCATGTTCACTTTCGTGATGATGACATGCTAAAAACCGTTGTTCCTTATACCAGTCGTTATTTTGGCAGAGCTATCGTAATGCCAAATCTTGTTCCCCCGATCACCACCATTGAAGCCGCCCGTCGTTATCGTGATCGCATAAAAGCAGCTATTCCAAGTGGCGATAAATTCGAACCATTAATGACCTGCTATTTAACGGATAGCACTCTGCCATCAGAAGTTGAACAAGGTTTTTTACAAGGCGTATTTACTGCTTGTAAACTTTATCCCGCCAATGCGACGACAAATTCTAGCCATGGTGTTTCCGATATCAATAAAATCTATCCTATTCTTAGTGTGATGGAAAAAATAGGTATGCCATTGCTTATTCATGGGGAAGTTACTGCATCAGATATCGATATTTTTGATAGAGAAGCTCGTTTTATTGATAACGTGATGGCTCCCGTTCGCAAACAATTTCCTGCCTTAAAAATTGTTTTTGAACATATCACCACCAAAGAAGCGGCACAGTATGTCTTAGAGGGAAATGAATTTCTTGGTGCAACTATTACACCACAACACTTAATGTTTAACCGTAATCATATGCTTGTCGGTGGTGTGAAACCGCATTTGTACTGTTTACCTATCCTTAAGCGTAATGTACACCAAGAGGCATTAAGACAAGCCGTTGCATCAGGCCATTCGCGTTTCTTCTTAGGTACTGACTCCGCACCTCATTTACAACATCGCAAAGAATCATCTTGTGGATGCGCTGGCGTGTTTAACGCCCCCACCGCTTTAGCAGCTTATGCTAGCGTATTTAAAGAGCTCAATGCCCTTTCTCACTTTGAAGCCTTCTGTTCACTCAATGGCCCACGTTTTTATGGTTTACCGGTTAATGAAGGCACTATTACCTTAACGGAAAAATCCGTTACTGCACCTGCAGAAATTATGAGTGGTGATGAAGCATTAATCCCCTTCTTAGCAAATGAAGATATTCATTGGGATATTAGTATCAATTAATCATTAGTGACTTGATATCTTCTTTTTATGCACCATATAACCCCTTATCT