Homologs in group_363

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13015 FBDBKF_13015 45.2 Morganella morganii S1 copA copper-exporting P-type ATPase CopA
EHELCC_06330 EHELCC_06330 45.2 Morganella morganii S2 copA copper-exporting P-type ATPase CopA
NLDBIP_06650 NLDBIP_06650 45.2 Morganella morganii S4 copA copper-exporting P-type ATPase CopA
LHKJJB_03530 LHKJJB_03530 45.2 Morganella morganii S3 copA copper-exporting P-type ATPase CopA
HKOGLL_07005 HKOGLL_07005 45.2 Morganella morganii S5 copA copper-exporting P-type ATPase CopA
F4V73_RS16200 F4V73_RS16200 44.2 Morganella psychrotolerans copA copper-exporting P-type ATPase CopA
PMI_RS10710 PMI_RS10710 43.8 Proteus mirabilis HI4320 copA copper-exporting P-type ATPase CopA

Distribution of the homologs in the orthogroup group_363

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_363

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P58341 0.0 1095 68 1 805 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
P58341 1.47e-11 72 56 0 64 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
Q9X5X3 0.0 1082 66 3 826 1 actP Copper-transporting P-type ATPase Sinorhizobium medicae (strain WSM419)
P58342 0.0 1062 67 2 807 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
P58342 9.52e-11 69 55 0 65 3 actP2 Copper-transporting ATPase 2 Rhizobium meliloti (strain 1021)
O32220 0.0 687 46 6 817 1 copA Copper-exporting P-type ATPase Bacillus subtilis (strain 168)
Q8NUQ9 0.0 676 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MW2)
Q6G6B7 0.0 676 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MSSA476)
Q7A3E6 0.0 675 45 13 821 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain N315)
Q99R80 0.0 675 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVY3 0.0 675 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH9)
A6U4T8 0.0 675 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain JH1)
A7X6S1 0.0 675 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z3F8 0.0 674 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300 / TCH1516)
A6QK47 0.0 674 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain Newman)
Q5HCZ3 0.0 674 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain COL)
Q2FV64 0.0 674 45 13 821 1 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDV0 0.0 674 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain USA300)
Q6GDP1 0.0 671 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain MRSA252)
Q2YWA3 0.0 669 45 13 821 3 copA Copper-exporting P-type ATPase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8CN02 0.0 669 43 12 821 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CN02 1.03e-06 56 38 1 73 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL56 0.0 669 43 12 821 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HL56 1.03e-06 56 38 1 73 3 copA Copper-exporting P-type ATPase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4A0G1 0.0 663 44 11 825 3 copA Copper-exporting P-type ATPase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P37279 0.0 660 48 10 745 3 pacS Probable copper-transporting ATPase PacS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4L970 0.0 649 43 11 822 3 copA Copper-exporting P-type ATPase Staphylococcus haemolyticus (strain JCSC1435)
P73241 0.0 646 45 7 755 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73241 6.73e-07 57 38 0 62 1 pacS Probable copper-transporting ATPase PacS Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5ZWR1 0.0 620 48 6 665 1 copA Copper-exporting P-type ATPase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q9ZHC7 0.0 607 48 3 668 1 silP Silver exporting P-type ATPase Salmonella typhimurium
P32113 0.0 603 44 11 751 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
P32113 4.3e-07 57 45 1 57 1 copA Probable copper-importing P-type ATPase A Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
O29777 0.0 601 45 12 745 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O29777 7.85e-05 50 41 2 81 1 copA Probable copper-exporting P-type ATPase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8ZR95 0.0 600 41 10 846 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR95 1.75e-06 55 44 2 70 1 copA Copper-exporting P-type ATPase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z8S4 0.0 598 41 9 847 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8Z8S4 1.84e-06 55 44 2 70 3 copA Copper-exporting P-type ATPase Salmonella typhi
Q8ZCA7 0.0 591 43 5 746 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q8ZCA7 5.62e-10 67 36 5 133 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q8ZCA7 0.000205 48 42 1 68 3 copA Copper-exporting P-type ATPase Yersinia pestis
Q8XD24 0.0 588 40 8 847 3 copA Copper-exporting P-type ATPase Escherichia coli O157:H7
Q59385 0.0 577 40 8 847 1 copA Copper-exporting P-type ATPase Escherichia coli (strain K12)
Q9KPZ7 0.0 567 42 7 768 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KPZ7 1.03e-06 56 43 1 74 3 copA Copper-exporting P-type ATPase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9X5V3 0.0 547 49 2 625 1 actP Copper-transporting P-type ATPase Rhizobium leguminosarum bv. viciae
P9WPS3 1.78e-179 538 49 8 605 1 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS2 1.78e-179 538 49 8 605 3 ctpV Probable copper-exporting P-type ATPase V Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9SH30 2.44e-175 534 37 14 856 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
Q9SH30 1.4e-15 85 30 3 169 1 HMA5 Probable copper-transporting ATPase HMA5 Arabidopsis thaliana
A3AWA4 3.18e-175 534 38 14 853 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
A3AWA4 3.67e-16 87 36 4 156 2 HMA5 Copper-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q6H7M3 2.13e-171 524 38 13 832 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
Q6H7M3 9.29e-10 66 34 5 150 1 HMA4 Copper-transporting ATPase HMA4 Oryza sativa subsp. japonica
Q9S7J8 4.32e-160 495 37 14 863 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
Q9S7J8 4.47e-13 77 37 4 141 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
A0A0P0X004 2.96e-159 493 37 15 861 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
A0A0P0X004 4.82e-09 63 33 3 148 2 HMA9 Cation-transporting ATPase HMA5 Oryza sativa subsp. japonica
Q64446 7.88e-157 498 37 22 879 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64446 4.86e-05 51 25 3 166 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64446 0.00048 47 22 3 157 1 Atp7b Copper-transporting ATPase 2 Mus musculus
Q64535 2.97e-155 493 36 19 872 1 Atp7b Copper-transporting ATPase 2 Rattus norvegicus
Q9XT50 5.32e-153 488 36 21 883 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 1.66e-07 58 29 4 164 2 ATP7B Copper-transporting ATPase 2 Ovis aries
Q9XT50 1.2e-05 53 25 4 148 2 ATP7B Copper-transporting ATPase 2 Ovis aries
P35670 5.34e-152 485 36 21 870 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P35670 5.57e-09 63 29 4 175 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
P35670 5.67e-05 50 38 1 70 1 ATP7B Copper-transporting ATPase 2 Homo sapiens
O32619 9.36e-151 462 36 11 751 3 copA Copper-transporting ATPase Helicobacter felis (strain ATCC 49179 / CCUG 28539 / NCTC 12436 / CS1)
Q59467 4.49e-147 453 34 14 757 3 copA Copper-transporting ATPase Helicobacter pylori
O30085 1.8e-146 450 39 10 672 1 copB Copper-exporting P-type ATPase B Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P9WPU1 3.69e-145 449 39 15 768 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU1 1.03e-05 53 36 1 79 1 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU0 3.69e-145 449 39 15 768 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPU0 1.03e-05 53 36 1 79 3 ctpA Copper-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O08462 5.61e-145 448 34 14 762 3 copA Copper-transporting ATPase Helicobacter pylori
P49015 5.52e-142 458 33 16 906 2 ATP7A Copper-transporting ATPase 1 (Fragment) Cricetulus griseus
P77871 8.29e-142 439 33 14 762 3 copA Copper-transporting ATPase Helicobacter pylori
Q9ZM69 1.26e-141 439 34 14 762 3 copA Copper-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
B9DFX7 4.05e-141 442 35 17 822 1 PAA2 Copper-transporting ATPase PAA2, chloroplastic Arabidopsis thaliana
P55989 1.62e-138 431 34 13 762 3 copA Copper-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
P38995 2.06e-137 436 34 26 893 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38995 7.58e-10 66 25 3 151 1 CCC2 Copper-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9SZC9 8.89e-136 430 35 16 780 1 PAA1 Copper-transporting ATPase PAA1, chloroplastic Arabidopsis thaliana
P46840 1.03e-133 419 37 15 757 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
P46840 2.01e-05 52 42 3 85 3 ctpB Cation-transporting P-type ATPase B Mycobacterium leprae (strain TN)
P77868 1.55e-133 417 36 15 741 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77868 5.68e-06 53 35 3 91 3 HI_0290 Probable cation-transporting ATPase HI_0290 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37386 6.64e-132 416 33 19 834 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus
P37385 7.3e-132 415 35 13 784 3 synA Probable copper-transporting ATPase SynA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q64430 1.29e-130 428 32 20 912 1 Atp7a Copper-transporting ATPase 1 Mus musculus
Q64430 3.89e-06 54 27 5 174 1 Atp7a Copper-transporting ATPase 1 Mus musculus
P70705 2.61e-130 427 32 20 908 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P70705 1.49e-05 52 24 5 174 1 Atp7a Copper-transporting ATPase 1 Rattus norvegicus
P07893 1.43e-129 409 35 13 784 3 synA Probable copper-transporting ATPase SynA Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
O59666 1.12e-127 407 34 20 862 3 ccc2 Copper-transporting ATPase ccc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P9WPT8 1.77e-125 397 38 15 759 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPT8 0.000263 48 38 2 77 3 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59947 1.77e-125 397 38 15 759 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P59947 0.000263 48 38 2 77 3 ctpB Cation-transporting P-type ATPase B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPT9 2.09e-125 397 38 15 756 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT9 0.000617 47 38 2 77 1 ctpB Cation-transporting P-type ATPase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q6GIX1 2.63e-124 393 33 16 765 3 cadA Probable cadmium-transporting ATPase Staphylococcus aureus (strain MRSA252)
Q5HKB0 4.21e-124 391 34 7 615 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P20021 2.47e-123 391 33 17 755 1 cadA Cadmium-transporting ATPase Staphylococcus aureus
P46839 1.35e-122 390 38 15 762 3 ctpA Copper-exporting P-type ATPase Mycobacterium leprae (strain TN)
Q8CQF7 3.12e-122 386 35 9 616 3 copB Probable copper-transporting P-type ATPase B Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A8YZ02 7.14e-122 385 34 7 615 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300 / TCH1516)
Q2FKI2 7.14e-122 385 34 7 615 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain USA300)
Q69HU0 1.15e-121 385 34 7 615 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus
Q4LAB1 2.29e-121 384 35 9 616 3 copB Probable copper-transporting P-type ATPase B Staphylococcus haemolyticus (strain JCSC1435)
Q6GIX4 2.94e-121 384 34 7 615 3 copB Probable copper-transporting P-type ATPase B Staphylococcus aureus (strain MRSA252)
P05425 4.38e-121 385 37 10 620 1 copB Copper-exporting P-type ATPase B Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
P30336 1.02e-120 384 33 20 760 3 cadA Probable cadmium-transporting ATPase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P58414 1.33e-117 375 32 18 743 3 cadA Probable cadmium-transporting ATPase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q60048 2.36e-113 364 33 20 767 1 cadA Probable cadmium-transporting ATPase Listeria monocytogenes
O31688 5.54e-102 332 37 5 520 1 zosA Zinc-transporting ATPase Bacillus subtilis (strain 168)
Q59998 3.88e-98 324 31 20 768 1 ziaA Zinc-transporting ATPase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q04656 4.32e-96 332 32 13 645 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 4.12e-46 182 46 3 211 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
Q04656 6.21e-06 53 26 4 156 1 ATP7A Copper-transporting ATPase 1 Homo sapiens
P18398 1.13e-93 313 32 16 756 3 fixI Nitrogen fixation protein FixI Rhizobium meliloti (strain 1021)
Q59207 4.13e-91 306 32 16 755 3 fixI Nitrogen fixation protein FixI Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O33533 6e-91 306 31 15 757 3 fixI Nitrogen fixation protein FixI Rhizobium leguminosarum bv. viciae
Q9CCL1 7e-91 305 35 9 555 3 ctpC Manganese-exporting P-type ATPase Mycobacterium leprae (strain TN)
O32219 2.9e-90 303 29 17 760 1 cadA Cadmium, zinc and cobalt-transporting ATPase Bacillus subtilis (strain 168)
P9WPT5 1.25e-89 301 34 12 622 1 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT4 1.25e-89 301 34 12 622 3 ctpC Manganese-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A503 1.25e-89 301 34 12 622 3 ctpC Manganese-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B2HEM2 7.06e-89 300 34 15 630 1 ctpC Zinc-exporting P-type ATPase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q3YW59 1.16e-87 296 32 19 768 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
Q3YW59 0.000304 48 38 1 76 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Shigella sonnei (strain Ss046)
P37617 3.01e-85 290 31 20 768 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
P37617 0.000354 48 37 2 80 1 zntA Zinc/cadmium/lead-transporting P-type ATPase Escherichia coli (strain K12)
A3BF39 8.18e-84 293 35 11 512 1 HMA2 Cadmium/zinc-transporting ATPase HMA2 Oryza sativa subsp. japonica
P9WPT7 6e-82 279 35 9 553 2 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT6 6e-82 279 35 9 553 3 ctpJ Probable cation-transporting P-type ATPase J Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9SZW4 1.13e-81 285 33 10 544 2 HMA2 Cadmium/zinc-transporting ATPase HMA2 Arabidopsis thaliana
P38360 2.79e-81 287 28 22 818 1 PCA1 P-type cation-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q59465 1.58e-80 276 27 15 717 1 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain ATCC 700392 / 26695)
A0R3A7 4.39e-80 274 35 10 554 1 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9ZL53 2.47e-78 270 27 14 717 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter pylori (strain J99 / ATCC 700824)
P0CW78 1.59e-77 270 31 12 557 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
O64474 2.75e-74 267 31 14 590 1 HMA4 Putative cadmium/zinc-transporting ATPase HMA4 Arabidopsis thaliana
Q9RQB4 6.97e-72 252 31 12 522 3 cadA Cadmium, zinc and cobalt-transporting ATPase Helicobacter felis
P9WPT3 4.25e-70 247 34 10 551 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPT2 4.25e-70 247 34 10 551 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63686 4.25e-70 247 34 10 551 3 ctpD Probable cobalt/nickel-exporting P-type ATPase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8H384 2.54e-67 245 34 9 551 1 HMA3 Cadmium/zinc-transporting ATPase HMA3 Oryza sativa subsp. japonica
P9WPS7 1.82e-60 222 35 11 602 1 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS6 1.82e-60 222 35 11 602 3 ctpG Probable cation-transporting ATPase G Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63690 1.82e-60 222 35 11 602 3 ctpG Probable cation-transporting ATPase G Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B7JRB8 3.54e-55 206 31 16 565 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH820)
C3LF99 8.96e-55 204 31 16 565 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus anthracis (strain CDC 684 / NRRL 3495)
A0RA13 1.7e-54 204 31 16 565 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis (strain Al Hakam)
Q6HN78 3.95e-54 203 30 16 565 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EYK0 1.81e-52 198 31 15 536 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain 03BB102)
B7HWG1 2.28e-52 197 31 15 536 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain AH187)
A9VFM1 2.51e-52 197 29 12 538 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus mycoides (strain KBAB4)
A7GLG4 3.69e-52 197 31 13 528 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8YPE9 3.99e-52 197 30 7 489 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q4LAI2 1.61e-51 195 31 11 501 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus haemolyticus (strain JCSC1435)
Q9RZP0 2.62e-51 194 34 12 476 3 kdpB Potassium-transporting ATPase ATP-binding subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B7II09 4.49e-51 194 31 13 516 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain G9842)
B7HDF9 1.07e-50 193 31 13 516 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain B4264)
Q8KU73 1.12e-50 192 28 15 577 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterococcus faecalis (strain ATCC 700802 / V583)
A0AM16 1.41e-50 192 31 14 544 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5HK64 1.57e-50 192 30 12 531 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GKN3 1.57e-50 192 30 12 531 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain MRSA252)
P0A008 1.57e-50 192 30 12 531 1 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain N315)
P0A007 1.57e-50 192 30 12 531 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8R8I6 1.95e-50 192 30 16 551 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q81HQ0 2.22e-50 192 31 13 516 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q63FR0 5.43e-50 191 31 13 516 3 kdpB Potassium-transporting ATPase ATP-binding subunit Bacillus cereus (strain ZK / E33L)
B2V2P3 9.35e-50 190 32 11 484 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Alaska E43 / Type E3)
P0CW77 1.07e-49 187 31 6 385 5 HMA3 Putative inactive cadmium/zinc-transporting ATPase HMA3 Arabidopsis thaliana
B2TMJ2 1.73e-49 189 32 11 484 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium botulinum (strain Eklund 17B / Type B)
Q9R6X1 1.86e-49 189 31 12 495 3 kdpB Potassium-transporting ATPase ATP-binding subunit Anabaena sp. (strain L31)
O32328 2.44e-49 189 29 11 546 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q71W90 4.51e-49 188 31 15 545 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain F2365)
C1KZN5 4.51e-49 188 31 15 545 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4b (strain CLIP80459)
B8DAW1 4.86e-49 188 31 15 545 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serotype 4a (strain HCC23)
Q927G0 5.93e-49 187 30 12 543 3 kdpB1 Potassium-transporting ATPase ATP-binding subunit 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9A7X7 7.7e-49 187 34 8 430 3 kdpB Potassium-transporting ATPase ATP-binding subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8Y3Z7 2.58e-48 186 31 15 545 3 kdpB Potassium-transporting ATPase ATP-binding subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q0TRT3 6.02e-48 185 32 8 442 3 kdpB Potassium-transporting ATPase ATP-binding subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q57RN0 9.16e-48 184 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella choleraesuis (strain SC-B67)
P57700 9.77e-48 184 28 14 564 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q93MV5 1.5e-47 183 31 7 478 3 kdpB Potassium-transporting ATPase ATP-binding subunit Myxococcus xanthus
A6T6D8 2.51e-47 183 32 14 522 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q92XJ0 3.75e-47 182 33 8 439 3 kdpB Potassium-transporting ATPase ATP-binding subunit Rhizobium meliloti (strain 1021)
B5XZE9 4.55e-47 182 32 14 522 3 kdpB Potassium-transporting ATPase ATP-binding subunit Klebsiella pneumoniae (strain 342)
B1LLE1 1.45e-46 181 30 11 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SMS-3-5 / SECEC)
Q926K7 2.06e-46 180 30 12 489 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B1IY32 2.87e-46 180 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P59219 3.62e-46 179 31 16 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
A4W860 3.66e-46 179 32 13 500 3 kdpB Potassium-transporting ATPase ATP-binding subunit Enterobacter sp. (strain 638)
P03960 4.02e-46 179 30 12 521 1 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12)
B1X6M8 4.02e-46 179 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / DH10B)
C4ZWH3 4.02e-46 179 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain K12 / MC4100 / BW2952)
P73867 4.12e-46 179 30 13 557 3 kdpB Potassium-transporting ATPase ATP-binding subunit Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B6HYQ5 4.63e-46 179 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain SE11)
A7ZJ80 4.63e-46 179 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
B7M5L3 5.18e-46 179 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O8 (strain IAI1)
B7LAA4 5.18e-46 179 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain 55989 / EAEC)
B7N9U0 5.48e-46 179 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LKR7 6.74e-46 179 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5R670 7.1e-46 179 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8FJV4 7.12e-46 178 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJY9 7.12e-46 178 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UKX6 7.12e-46 178 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7MPK0 7.33e-46 178 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O81 (strain ED1a)
B4SZB1 7.82e-46 178 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella newport (strain SL254)
A9MUE0 9.09e-46 178 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FNE0 9.09e-46 178 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella dublin (strain CT_02021853)
B4TQ22 9.17e-46 178 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella schwarzengrund (strain CVM19633)
B4TBA6 9.89e-46 178 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella heidelberg (strain SL476)
B5QWE9 9.89e-46 178 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella enteritidis PT4 (strain P125109)
P57699 1.19e-45 178 29 13 576 3 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R9M0 1.19e-45 178 29 13 576 2 kdpB Potassium-transporting ATPase ATP-binding subunit Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B5BCA4 1.29e-45 178 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain AKU_12601)
Q5PCJ7 1.29e-45 178 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7ZXV8 1.58e-45 177 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O9:H4 (strain HS)
Q97BF6 1.61e-45 177 28 13 533 3 kdpB Potassium-transporting ATPase ATP-binding subunit Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q98GX6 1.66e-45 177 31 13 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B5YQN9 1.9e-45 177 29 12 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9F9 1.9e-45 177 29 12 540 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O157:H7
Q8ZQW2 1.94e-45 177 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9X8Z9 2.22e-45 177 32 10 483 3 kdpB Potassium-transporting ATPase ATP-binding subunit Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B7NMQ0 2.3e-45 177 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q324L0 2.69e-45 177 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 4 (strain Sb227)
Q3Z4A6 2.74e-45 177 30 12 521 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella sonnei (strain Ss046)
B5EZE3 3.46e-45 176 31 10 485 3 kdpB Potassium-transporting ATPase ATP-binding subunit Salmonella agona (strain SL483)
Q72TM6 5.55e-45 176 30 16 511 3 kdpB Potassium-transporting ATPase ATP-binding subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P57698 5.59e-45 176 32 16 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8YSD5 1.05e-44 175 30 15 543 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8U9D9 1.11e-44 175 30 11 544 3 kdpB Potassium-transporting ATPase ATP-binding subunit Agrobacterium fabrum (strain C58 / ATCC 33970)
Q47H39 1.34e-44 175 32 14 491 3 kdpB Potassium-transporting ATPase ATP-binding subunit Dechloromonas aromatica (strain RCB)
Q1REM0 1.84e-44 174 30 10 500 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli (strain UTI89 / UPEC)
A1A8W1 1.84e-44 174 30 10 500 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O1:K1 / APEC
B7MFW2 1.84e-44 174 30 10 500 3 kdpB Potassium-transporting ATPase ATP-binding subunit Escherichia coli O45:K1 (strain S88 / ExPEC)
A8GB61 3.63e-44 174 30 10 528 3 kdpB Potassium-transporting ATPase ATP-binding subunit Serratia proteamaculans (strain 568)
B4U8E4 6.3e-44 173 28 11 523 3 kdpB Potassium-transporting ATPase ATP-binding subunit Hydrogenobaculum sp. (strain Y04AAS1)
Q7N6W6 6.33e-44 173 28 12 542 3 kdpB Potassium-transporting ATPase ATP-binding subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8XU11 6.85e-44 173 29 14 575 3 kdpB Potassium-transporting ATPase ATP-binding subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2TTJ7 1.01e-43 172 29 11 526 3 kdpB Potassium-transporting ATPase ATP-binding subunit Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
C4LDL7 1.25e-43 172 28 11 546 3 kdpB Potassium-transporting ATPase ATP-binding subunit Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q9M3H5 1.97e-43 172 31 12 482 2 HMA1 Probable cadmium/zinc-transporting ATPase HMA1, chloroplastic Arabidopsis thaliana
B2VJK3 9.61e-43 169 29 10 519 3 kdpB Potassium-transporting ATPase ATP-binding subunit Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q8PPC9 1.4e-42 169 32 11 478 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas axonopodis pv. citri (strain 306)
Q8NVI2 2.75e-42 168 30 12 478 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MW2)
Q6G7N3 2.75e-42 168 30 12 478 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain MSSA476)
A8Z4X9 4.32e-42 167 30 12 478 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain USA300 / TCH1516)
A6QIS1 4.32e-42 167 30 12 478 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain Newman)
Q5HEC4 4.32e-42 167 30 12 478 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain COL)
Q2YUH7 4.57e-42 167 30 12 478 3 kdpB Potassium-transporting ATPase ATP-binding subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
P63684 5.01e-42 167 30 12 478 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain N315)
P63683 5.01e-42 167 30 12 478 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A1JQS2 5.94e-42 167 30 10 486 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P9WPU3 8.46e-42 167 29 14 554 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPU2 8.46e-42 167 29 14 554 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63682 8.46e-42 167 29 14 554 3 kdpB Potassium-transporting ATPase ATP-binding subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6GEZ7 1.4e-41 166 30 12 478 3 kdpB2 Potassium-transporting ATPase ATP-binding subunit 2 Staphylococcus aureus (strain MRSA252)
Q8PCM1 3.64e-41 164 31 12 505 3 kdpB Potassium-transporting ATPase ATP-binding subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A4TL06 4.54e-41 164 29 11 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis (strain Pestoides F)
Q1CKH2 4.54e-41 164 29 11 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3X3 4.54e-41 164 29 11 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD97 4.54e-41 164 29 11 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis
B2KA78 4.54e-41 164 29 11 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C586 4.54e-41 164 29 11 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pestis bv. Antiqua (strain Antiqua)
B1JR96 5.21e-41 164 29 10 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFQ9 5.21e-41 164 29 10 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q667S4 5.66e-41 164 29 10 524 3 kdpB Potassium-transporting ATPase ATP-binding subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
Q58623 1.47e-40 164 30 17 549 3 MJ1226 Putative cation-transporting ATPase MJ1226 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A4SZG8 3.11e-40 162 28 12 527 3 kdpB Potassium-transporting ATPase ATP-binding subunit Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
P78036 4.55e-36 150 26 21 637 3 pacL Probable cation-transporting P-type ATPase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
A0R3Y2 6.1e-35 146 28 15 545 1 ctpE Calcium-transporting ATPase CtpE Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P54679 2.63e-34 145 26 14 557 1 patB Probable plasma membrane ATPase Dictyostelium discoideum
P20649 1.36e-32 139 25 16 591 1 AHA1 ATPase 1, plasma membrane-type Arabidopsis thaliana
P19456 4.9e-32 137 25 16 587 1 AHA2 ATPase 2, plasma membrane-type Arabidopsis thaliana
P19657 5.29e-32 137 26 12 549 1 PMA2 Plasma membrane ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P05030 6.17e-32 137 26 13 517 1 PMA1 Plasma membrane ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q43128 3.66e-31 135 25 11 560 2 AHA10 ATPase 10, plasma membrane-type Arabidopsis thaliana
Q7XPY2 4.13e-31 135 26 15 526 2 Os04g0656100 Plasma membrane ATPase Oryza sativa subsp. japonica
Q9M2A0 9.73e-31 134 26 14 531 2 AHA8 ATPase 8, plasma membrane-type Arabidopsis thaliana
P20431 1.28e-30 133 26 15 533 1 AHA3 ATPase 3, plasma membrane-type Arabidopsis thaliana
P28877 1.79e-30 132 25 11 557 1 PMA1 Plasma membrane ATPase 1 Candida albicans
Q03194 3.23e-30 132 26 15 546 2 PMA4 Plasma membrane ATPase 4 Nicotiana plumbaginifolia
Q08436 1.23e-29 130 25 11 562 1 PMA3 Plasma membrane ATPase 3 Nicotiana plumbaginifolia
P83970 2.42e-29 129 26 15 526 2 ha1 Plasma membrane ATPase Triticum aestivum
P22180 2.5e-29 129 25 12 562 2 LHA1 Plasma membrane ATPase 1 Solanum lycopersicum
Q42556 3.35e-29 129 24 19 588 2 AHA9 ATPase 9, plasma membrane-type Arabidopsis thaliana
P07038 5.72e-29 128 26 15 554 1 pma-1 Plasma membrane ATPase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9SH76 7.8e-29 127 24 14 533 2 AHA6 ATPase 6, plasma membrane-type Arabidopsis thaliana
Q08435 1.59e-28 126 25 12 562 2 PMA1 Plasma membrane ATPase 1 Nicotiana plumbaginifolia
Q9SU58 1.88e-28 126 25 14 564 2 AHA4 ATPase 4, plasma membrane-type Arabidopsis thaliana
Q9LV11 1.31e-27 124 24 12 562 1 AHA11 ATPase 11, plasma membrane-type Arabidopsis thaliana
P35597 4.04e-27 121 24 14 525 3 exp7 Probable cation-transporting ATPase exp7 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P9WPT1 7.44e-27 120 26 13 554 1 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A505 7.44e-27 120 26 13 554 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9SJB3 8.2e-27 121 24 15 546 2 AHA5 ATPase 5, plasma membrane-type Arabidopsis thaliana
P9WPT0 8.63e-27 120 26 13 554 3 ctpE Calcium-transporting ATPase CtpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8Z8E5 4.71e-26 117 33 5 265 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
Q8Z8E5 8.73e-09 62 39 3 104 5 kdpB Putative potassium-transporting ATPase ATP-binding subunit Salmonella typhi
P24545 5.04e-26 118 25 11 517 3 None Plasma membrane ATPase Zygosaccharomyces rouxii
P11718 1.18e-25 117 26 14 523 2 H1A Probable proton ATPase 1A Leishmania donovani
P09627 1.96e-25 116 25 13 580 1 pma1 Plasma membrane ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P12522 3.5e-25 116 26 14 523 2 H1B Probable proton ATPase 1B Leishmania donovani
P28876 3.95e-25 115 26 14 579 1 pma2 Plasma membrane ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P49380 1.91e-24 113 24 10 516 1 PMA1 Plasma membrane ATPase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
O34431 1.91e-23 110 25 20 627 1 yloB Calcium-transporting ATPase Bacillus subtilis (strain 168)
Q07421 2.88e-23 109 24 16 626 3 PMA1 Plasma membrane ATPase Ajellomyces capsulatus
Q9T0E0 1.14e-22 107 26 16 491 3 At4g11730 Putative ATPase, plasma membrane-like Arabidopsis thaliana
P54211 3.43e-22 106 24 15 574 2 PMA1 Plasma membrane ATPase Dunaliella bioculata
P36640 9.74e-22 105 23 15 580 1 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZTB2 9.74e-22 105 23 15 580 2 mgtA Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain 14028s / SGSC 2262)
Q73E41 5.55e-20 99 36 2 170 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73E41 2.48e-16 87 26 4 280 1 BCE_0519 Calcium-transporting ATPase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
P54210 1.48e-19 98 25 17 572 2 DHA1 Plasma membrane ATPase Dunaliella acidophila
O22218 1.79e-19 97 35 3 179 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
O22218 8.68e-09 63 24 5 223 1 ACA4 Calcium-transporting ATPase 4, plasma membrane-type Arabidopsis thaliana
Q9M2L4 1.86e-19 97 36 3 179 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9M2L4 1.41e-08 62 25 7 225 1 ACA11 Putative calcium-transporting ATPase 11, plasma membrane-type Arabidopsis thaliana
Q9LU41 4.74e-19 96 33 4 190 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
Q9LU41 8.79e-08 60 32 2 110 2 ACA9 Calcium-transporting ATPase 9, plasma membrane-type Arabidopsis thaliana
O43108 6.22e-19 95 33 4 195 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O43108 9.48e-15 82 25 10 350 3 PMR1 Calcium-transporting ATPase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q8Y8Q5 7.27e-19 95 31 2 172 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8Q5 8.21e-15 82 26 6 280 1 lmo0841 Calcium-transporting ATPase lmo0841 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q65X71 3.89e-18 93 36 4 174 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
Q65X71 1.87e-09 65 27 7 237 3 ACA6 Probable calcium-transporting ATPase 6, plasma membrane-type Oryza sativa subsp. japonica
P54678 4.5e-18 93 23 18 570 1 patA Calcium-transporting ATPase PAT1 Dictyostelium discoideum
P57709 8.12e-18 92 36 3 160 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
P57709 7.31e-14 79 24 6 276 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Bos taurus
Q64566 8.41e-18 92 35 3 164 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q64566 1.17e-13 79 24 6 277 2 Atp2c1 Calcium-transporting ATPase type 2C member 1 Rattus norvegicus
Q80XR2 8.69e-18 92 31 6 229 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
Q80XR2 9.33e-13 75 24 6 253 1 Atp2c1 Calcium-transporting ATPase type 2C member 1 Mus musculus
P98194 8.78e-18 92 31 6 228 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
P98194 1.47e-13 78 24 6 277 1 ATP2C1 Calcium-transporting ATPase type 2C member 1 Homo sapiens
Q5R5K5 8.92e-18 92 31 6 228 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q5R5K5 1.55e-13 78 24 6 277 2 ATP2C1 Calcium-transporting ATPase type 2C member 1 Pongo abelii
Q9CFU9 1.12e-17 91 31 2 172 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q9CFU9 2.37e-14 81 27 8 290 1 yoaB Calcium-transporting ATPase 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q4WHC8 2.1e-17 91 34 2 168 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WHC8 6.66e-05 50 22 4 269 2 pmrA Calcium-transporting ATPase pmrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q7X8B5 3.21e-17 90 33 4 187 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q7X8B5 4.84e-06 54 29 2 112 1 ACA5 Calcium-transporting ATPase 5, plasma membrane-type Oryza sativa subsp. japonica
Q9HDW7 3.36e-17 90 30 6 250 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9HDW7 3.28e-08 61 25 6 241 3 pmc1 Calcium-transporting ATPase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P22036 3.97e-17 90 31 3 189 1 mgtB Magnesium-transporting ATPase, P-type 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9LY77 2.29e-16 87 32 4 190 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
Q9LY77 0.000545 47 26 4 166 2 ACA12 Calcium-transporting ATPase 12, plasma membrane-type Arabidopsis thaliana
P23980 2.49e-16 87 26 10 377 3 LHA2 Plasma membrane ATPase 2 (Fragment) Solanum lycopersicum
Q8RUN1 2.75e-16 87 33 3 180 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q8RUN1 1.39e-12 75 26 7 264 2 ACA1 Calcium-transporting ATPase 1, plasma membrane-type Oryza sativa subsp. japonica
Q9SZR1 2.81e-16 87 31 4 190 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q9SZR1 3.23e-08 61 25 5 229 1 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Arabidopsis thaliana
Q7XEK4 3.49e-16 87 31 6 239 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q7XEK4 4.13e-06 54 24 5 244 2 ACA7 Calcium-transporting ATPase 7, plasma membrane-type Oryza sativa subsp. japonica
Q9LIK7 3.86e-16 87 31 5 208 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q9LIK7 2.8e-11 71 27 4 238 3 ACA13 Putative calcium-transporting ATPase 13, plasma membrane-type Arabidopsis thaliana
Q8R4C1 3.89e-16 87 27 6 275 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q8R4C1 7.47e-15 82 33 3 161 2 Atp2c2 Calcium-transporting ATPase type 2C member 2 Rattus norvegicus
Q9LF79 4.04e-16 87 31 4 190 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
Q9LF79 7.39e-08 60 30 3 140 1 ACA8 Calcium-transporting ATPase 8, plasma membrane-type Arabidopsis thaliana
P54209 6.08e-16 86 32 2 181 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
P54209 8.89e-08 59 24 6 269 2 CA1 Cation-transporting ATPase CA1 Dunaliella bioculata
Q4WND5 8.55e-16 85 28 3 233 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WND5 1.55e-11 72 24 5 318 2 srcA Endoplasmic reticulum calcium ATPase srcA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P13586 1.01e-15 85 31 6 220 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13586 6.4e-11 70 24 11 358 1 PMR1 Calcium-transporting ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P37367 1.02e-15 85 33 9 223 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37367 1.26e-13 79 27 7 315 3 pma1 Cation-transporting ATPase pma1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P37278 1.19e-15 85 32 3 180 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37278 2.86e-14 80 28 6 264 1 pacL Calcium-transporting ATPase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O75185 1.34e-15 85 32 4 193 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
O75185 2.71e-12 74 25 4 273 1 ATP2C2 Calcium-transporting ATPase type 2C member 2 Homo sapiens
O13398 1.62e-15 85 29 5 222 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
O13398 0.000167 49 23 10 293 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Schwanniomyces occidentalis
P22700 1.76e-15 84 29 3 201 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
P22700 8.41e-08 60 23 8 309 1 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila melanogaster
A7L9Z8 1.8e-15 84 27 6 274 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
A7L9Z8 1.59e-14 81 34 4 161 1 Atp2c2 Calcium-transporting ATPase type 2C member 2 Mus musculus
P0ABB8 2.04e-15 84 33 3 162 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB8 1.39e-07 59 23 6 263 1 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli (strain K12)
P0ABB9 2.04e-15 84 33 3 162 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
P0ABB9 1.39e-07 59 23 6 263 3 mgtA Magnesium-transporting ATPase, P-type 1 Escherichia coli O157:H7
Q08853 3.22e-15 84 32 3 177 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
Q08853 8.31e-09 63 24 6 265 3 ATP6 Calcium-transporting ATPase Plasmodium falciparum (isolate K1 / Thailand)
Q2RAS0 3.66e-15 84 35 3 165 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2RAS0 1.08e-10 69 25 6 258 3 ACA8 Probable calcium-transporting ATPase 8, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 4.21e-15 83 35 3 165 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
Q2QY12 9.26e-11 69 25 6 258 3 ACA9 Probable calcium-transporting ATPase 9, plasma membrane-type Oryza sativa subsp. japonica
O13397 5.34e-15 83 30 3 180 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Schwanniomyces occidentalis
Q7XB51 6.27e-15 83 28 1 184 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q7XB51 1.48e-12 75 27 10 284 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Physcomitrium patens
Q2QMX9 7.85e-15 82 30 11 269 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
Q2QMX9 2.02e-05 52 25 8 260 2 ACA10 Calcium-transporting ATPase 10, plasma membrane-type Oryza sativa subsp. japonica
P22189 1.1e-14 82 30 3 172 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P22189 7.01e-06 53 24 8 291 1 cta3 Sodium/potassium exporting P-type ATPase cta3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
J9VQQ3 1.16e-14 82 32 3 182 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VQQ3 4.25e-09 64 25 8 246 3 PMC1 Calcium-transporting ATPase 2 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q9YGL9 1.16e-14 82 30 2 172 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q9YGL9 1.87e-09 65 23 5 269 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Gallus gallus
Q6ATV4 1.7e-14 81 34 5 177 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q6ATV4 4.13e-06 54 24 7 291 2 ACA3 Calcium-transporting ATPase 3, plasma membrane-type Oryza sativa subsp. japonica
Q292Q0 1.8e-14 81 28 3 201 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
Q292Q0 2.3e-07 58 23 8 306 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Drosophila pseudoobscura pseudoobscura
O81108 1.82e-14 81 31 5 184 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
O81108 7.43e-07 57 26 6 225 1 ACA2 Calcium-transporting ATPase 2, plasma membrane-type Arabidopsis thaliana
P47317 1.98e-14 81 25 9 274 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47317 4.69e-14 80 32 4 164 3 pacL Probable cation-transporting P-type ATPase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q13733 1.98e-14 81 28 6 242 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q13733 1.25e-08 62 27 7 239 1 ATP1A4 Sodium/potassium-transporting ATPase subunit alpha-4 Homo sapiens
Q7PPA5 2.13e-14 81 28 4 220 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q7PPA5 1.34e-07 59 24 8 305 3 SERCA Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Anopheles gambiae
Q9XES1 2.33e-14 81 28 3 186 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
Q9XES1 1.09e-06 56 25 10 297 2 ECA4 Calcium-transporting ATPase 4, endoplasmic reticulum-type Arabidopsis thaliana
P92939 2.49e-14 81 28 3 186 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
P92939 1.05e-06 56 25 10 297 1 ECA1 Calcium-transporting ATPase 1, endoplasmic reticulum-type Arabidopsis thaliana
Q64578 2.63e-14 80 30 2 180 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q64578 1.04e-06 56 27 11 284 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Rattus norvegicus
Q93084 2.71e-14 80 30 2 179 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
Q93084 4.96e-07 57 24 6 269 1 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Homo sapiens
P35316 2.85e-14 80 31 2 176 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
P35316 8.58e-08 60 26 10 310 2 None Calcium-transporting ATPase sarcoplasmic/endoplasmic reticulum type Artemia franciscana
O77696 3.38e-14 80 29 3 196 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
O77696 2.51e-07 58 24 5 269 2 ATP2A3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Sus scrofa
P38929 3.48e-14 80 31 4 169 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38929 2.49e-06 55 21 5 258 1 PMC1 Calcium-transporting ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O64806 3.68e-14 80 31 5 184 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
O64806 7.18e-07 57 25 5 257 3 ACA7 Putative calcium-transporting ATPase 7, plasma membrane-type Arabidopsis thaliana
Q9WV27 3.8e-14 80 27 6 242 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9WV27 6.01e-13 76 28 9 269 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Mus musculus
Q9LY32 3.86e-14 80 26 3 245 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
Q9LY32 4.43e-14 80 30 6 211 2 AHA7 ATPase 7, plasma membrane-type Arabidopsis thaliana
Q37145 4.02e-14 80 31 4 171 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
Q37145 5.01e-06 54 25 7 264 1 ACA1 Calcium-transporting ATPase 1 Arabidopsis thaliana
O14983 4.08e-14 80 30 2 179 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
O14983 2.68e-06 55 25 10 298 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Homo sapiens
P9WPS9 4.18e-14 80 30 4 218 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS9 6.86e-13 76 28 8 301 1 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS8 4.18e-14 80 30 4 218 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS8 6.86e-13 76 28 8 301 2 ctpF Probable cation-transporting ATPase F Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63688 4.18e-14 80 30 4 218 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63688 6.86e-13 76 28 8 301 3 ctpF Probable cation-transporting ATPase F Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O59868 4.54e-14 80 24 4 263 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59868 7.98e-14 79 31 6 218 1 pmr1 Calcium-transporting ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q42883 4.79e-14 80 29 4 178 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
Q42883 7.25e-12 73 25 7 320 2 LCA1 Calcium-transporting ATPase, endoplasmic reticulum-type Solanum lycopersicum
P04191 5.01e-14 80 30 2 179 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P04191 6.8e-07 57 24 10 298 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Oryctolagus cuniculus
P17326 6.35e-14 79 27 6 212 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
P17326 9.66e-14 79 28 8 269 1 None Sodium/potassium-transporting ATPase subunit alpha-A Artemia franciscana
Q8R429 7.4e-14 79 29 2 180 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q8R429 9.78e-07 56 27 11 284 1 Atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Mus musculus
Q64518 8.22e-14 79 30 2 179 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64518 1.14e-06 56 24 6 269 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Mus musculus
Q64568 8.45e-14 79 31 5 193 1 Atp2b3 Plasma membrane calcium-transporting ATPase 3 Rattus norvegicus
P54708 9.76e-14 79 27 5 239 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
P54708 1.47e-08 62 23 10 295 1 Atp12a Potassium-transporting ATPase alpha chain 2 Rattus norvegicus
Q9Z1W8 9.92e-14 79 27 5 239 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
Q9Z1W8 3.65e-07 57 23 7 282 1 Atp12a Potassium-transporting ATPase alpha chain 2 Mus musculus
B9QMJ0 1.03e-13 79 30 4 204 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
B9QMJ0 0.000361 48 23 7 269 1 ATP4 P-type sodium-transporting ATPase4 Toxoplasma gondii (strain ATCC 50861 / VEG)
Q03669 1.14e-13 79 29 3 188 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q03669 8.46e-08 60 26 11 292 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Gallus gallus
Q16720 1.15e-13 79 31 5 193 1 ATP2B3 Plasma membrane calcium-transporting ATPase 3 Homo sapiens
P18596 1.38e-13 78 30 2 172 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
P18596 7.09e-07 57 24 6 269 1 Atp2a3 Sarcoplasmic/endoplasmic reticulum calcium ATPase 3 Rattus norvegicus
Q9TV52 1.54e-13 78 27 5 239 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
Q9TV52 1.02e-09 66 24 6 269 2 ATP12A Potassium-transporting ATPase alpha chain 2 Oryctolagus cuniculus
P70083 1.88e-13 78 29 2 179 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P70083 1.27e-06 56 24 10 304 2 atp2a1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Makaira nigricans
P54707 2.07e-13 78 27 6 239 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P54707 5.17e-09 63 27 10 269 1 ATP12A Potassium-transporting ATPase alpha chain 2 Homo sapiens
P13585 2.15e-13 78 30 2 179 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P13585 6.07e-07 57 24 10 311 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Gallus gallus
P35317 2.21e-13 78 29 7 258 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P35317 1.25e-08 62 33 1 95 2 None Sodium/potassium-transporting ATPase subunit alpha Hydra vulgaris
P28774 2.61e-13 77 27 4 200 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P28774 9.17e-13 75 29 8 265 2 None Sodium/potassium-transporting ATPase subunit alpha-B Artemia franciscana
P11507 2.92e-13 77 28 3 188 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P11507 2.16e-07 58 24 11 319 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Rattus norvegicus
P16615 2.94e-13 77 29 3 188 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
P16615 1.82e-07 58 24 11 319 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Homo sapiens
Q01896 2.95e-13 77 28 4 216 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01896 6.26e-12 73 25 10 295 1 ENA2 Sodium/potassium exporting P-type ATPase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O55143 2.97e-13 77 28 3 188 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
O55143 2.14e-07 58 24 11 319 1 Atp2a2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Mus musculus
Q0VCY0 3.03e-13 77 29 2 179 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
Q0VCY0 1.69e-06 55 26 11 284 1 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Bos taurus
P20647 3.13e-13 77 29 3 188 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
P20647 2.29e-07 58 24 11 319 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Oryctolagus cuniculus
O46674 3.2e-13 77 28 3 188 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
O46674 1.08e-07 59 24 11 319 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Canis lupus familiaris
Q12691 3.21e-13 77 28 4 216 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12691 5.85e-12 73 25 10 295 1 ENA5 Sodium/potassium exporting P-type ATPase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q00779 3.54e-13 77 28 3 188 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q00779 2.28e-07 58 24 11 319 2 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Felis catus
Q9SY55 3.57e-13 77 27 2 179 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q9SY55 1.42e-06 55 25 8 244 1 ECA3 Calcium-transporting ATPase 3, endoplasmic reticulum-type Arabidopsis thaliana
Q64392 4.31e-13 77 26 6 245 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q64392 3.96e-08 60 26 10 266 2 ATP12A Potassium-transporting ATPase alpha chain 2 Cavia porcellus
Q9R0K7 4.61e-13 77 29 3 193 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Mus musculus
P11506 4.63e-13 77 29 3 193 1 Atp2b2 Plasma membrane calcium-transporting ATPase 2 Rattus norvegicus
Q6RWA9 4.69e-13 77 26 3 199 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q6RWA9 1.38e-09 65 27 10 287 2 None Sodium/potassium-transporting ATPase subunit alpha Taenia solium
Q01814 5.54e-13 77 29 3 193 1 ATP2B2 Plasma membrane calcium-transporting ATPase 2 Homo sapiens
O23087 5.61e-13 76 28 4 202 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
O23087 3.96e-12 73 23 9 330 1 ECA2 Calcium-transporting ATPase 2, endoplasmic reticulum-type Arabidopsis thaliana
P11607 5.63e-13 76 28 3 188 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
P11607 2.58e-07 58 24 11 319 1 ATP2A2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 Sus scrofa
Q5RCD8 6.51e-13 76 26 4 199 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q5RCD8 1.8e-09 65 24 6 262 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Pongo abelii
Q92105 6.66e-13 76 29 2 179 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
Q92105 4.77e-06 54 24 12 313 2 ATP2A1 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 Pelophylax lessonae
G5E829 7.73e-13 76 29 3 193 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Mus musculus
P11505 8.21e-13 76 29 3 193 1 Atp2b1 Plasma membrane calcium-transporting ATPase 1 Rattus norvegicus
Q92126 8.52e-13 76 26 4 221 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
Q92126 2.06e-09 65 25 9 272 2 atp4a Potassium-transporting ATPase alpha chain 1 Xenopus laevis
P13587 9.1e-13 76 27 4 216 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P13587 5.75e-12 73 25 10 295 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q64541 1e-12 75 26 3 199 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
Q64541 6.17e-12 73 27 9 270 1 Atp1a4 Sodium/potassium-transporting ATPase subunit alpha-4 Rattus norvegicus
P50993 1.07e-12 75 26 4 199 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
P50993 2.17e-09 65 24 6 262 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Homo sapiens
Q64542 1.1e-12 75 31 5 193 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Rattus norvegicus
P06686 1.18e-12 75 26 4 199 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
P06686 3.88e-09 64 26 6 257 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Rattus norvegicus
Q6PIE5 1.18e-12 75 26 4 199 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6PIE5 3.88e-09 64 26 6 257 1 Atp1a2 Sodium/potassium-transporting ATPase subunit alpha-2 Mus musculus
Q6Q477 1.42e-12 75 31 4 193 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
Q6Q477 0.000694 47 25 4 135 1 Atp2b4 Plasma membrane calcium-transporting ATPase 4 Mus musculus
Q92036 1.67e-12 75 26 6 222 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
Q92036 5.74e-09 63 24 10 300 2 ATP12A Potassium-transporting ATPase alpha chain 2 Rhinella marina
A0A143ZZK9 1.85e-12 75 30 3 176 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
A0A143ZZK9 2.21e-05 52 23 7 264 1 ATP4 P-type sodium-transporting ATPase4 Plasmodium falciparum (isolate 3D7)
P23220 1.91e-12 75 29 3 193 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Sus scrofa
D3K0R6 1.92e-12 75 31 4 193 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Bos taurus
P20020 1.96e-12 75 29 3 193 1 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Homo sapiens
D2WKD8 1.96e-12 75 26 4 199 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
D2WKD8 3.27e-09 64 24 6 262 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Sus scrofa
C1L360 1.96e-12 75 29 7 265 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
C1L360 9.09e-11 69 29 4 178 1 ENA1 Sodium/potassium exporting P-type ATPase 1 Marchantia polymorpha
A2VDL6 2.01e-12 75 26 4 199 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
A2VDL6 3.3e-09 64 24 6 262 1 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Bos taurus
P24797 2.02e-12 75 26 4 202 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P24797 3.24e-10 67 24 6 262 2 ATP1A2 Sodium/potassium-transporting ATPase subunit alpha-2 Gallus gallus
P05025 2.73e-12 74 24 3 210 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P05025 4.6e-12 73 27 6 262 1 None Sodium/potassium-transporting ATPase subunit alpha Tetronarce californica
P24798 2.96e-12 74 26 4 199 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P24798 2.77e-09 64 24 6 262 2 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Gallus gallus
P13607 3e-12 74 26 3 200 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P13607 1.26e-11 72 28 8 260 1 Atpalpha Sodium/potassium-transporting ATPase subunit alpha Drosophila melanogaster
P06687 3.26e-12 74 26 4 199 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
P06687 1.94e-09 65 23 7 267 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Rattus norvegicus
Q6PIC6 3.26e-12 74 26 4 199 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
Q6PIC6 1.94e-09 65 23 7 267 1 Atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Mus musculus
P13637 3.29e-12 74 26 4 199 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
P13637 1.89e-09 65 23 7 267 1 ATP1A3 Sodium/potassium-transporting ATPase subunit alpha-3 Homo sapiens
Q92123 3.54e-12 74 26 3 199 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
Q92123 1.05e-08 62 27 8 265 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Xenopus laevis
P23634 3.83e-12 74 30 4 193 1 ATP2B4 Plasma membrane calcium-transporting ATPase 4 Homo sapiens
P58312 3.86e-12 73 28 9 270 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
P58312 2.26e-11 71 25 4 211 2 atp1a3 Sodium/potassium-transporting ATPase subunit alpha-3 Oreochromis mossambicus
Q98SH2 3.92e-12 73 29 4 197 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
Q98SH2 0.000525 47 30 3 113 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Gallus gallus
P18907 4.97e-12 73 25 3 199 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
P18907 7e-11 70 27 8 265 3 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Equus caballus
Q8VDN2 5.01e-12 73 25 3 199 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
Q8VDN2 1.22e-10 69 26 7 258 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Mus musculus
P06685 5.1e-12 73 25 3 199 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P06685 1.4e-10 68 26 7 258 1 Atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Rattus norvegicus
P19156 5.39e-12 73 25 2 199 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P19156 1.14e-09 65 25 9 272 1 ATP4A Potassium-transporting ATPase alpha chain 1 Sus scrofa
P35315 5.67e-12 73 30 2 168 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P35315 1.31e-10 68 27 6 256 3 TBA1 Probable calcium-transporting ATPase Trypanosoma brucei brucei
P09626 5.92e-12 73 25 2 199 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P09626 3.02e-09 64 25 9 272 1 Atp4a Potassium-transporting ATPase alpha chain 1 Rattus norvegicus
P05023 5.95e-12 73 25 3 199 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P05023 1.28e-10 68 26 8 265 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Homo sapiens
P50996 5.97e-12 73 25 2 199 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P50996 7.26e-09 63 25 9 272 2 ATP4A Potassium-transporting ATPase alpha chain 1 Canis lupus familiaris
P20648 6.29e-12 73 25 2 199 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
P20648 8.7e-10 66 25 10 273 1 ATP4A Potassium-transporting ATPase alpha chain 1 Homo sapiens
Q08DA1 6.31e-12 73 25 3 199 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
Q08DA1 1.41e-10 68 26 8 265 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Bos taurus
P27112 6.45e-12 73 25 2 199 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
P27112 3.29e-09 64 25 10 273 1 ATP4A Potassium-transporting ATPase alpha chain 1 Oryctolagus cuniculus
Q64436 6.51e-12 73 25 2 199 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q64436 5.03e-09 63 26 8 246 1 Atp4a Potassium-transporting ATPase alpha chain 1 Mus musculus
Q5RDR3 6.53e-12 73 25 3 199 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
Q5RDR3 1.63e-10 68 26 8 265 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Pongo abelii
P04074 6.7e-12 73 25 3 199 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
P04074 1.3e-10 68 26 8 265 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Ovis aries
Q9N0Z6 8.51e-12 72 26 3 196 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9N0Z6 2.72e-11 71 26 7 262 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Oryctolagus cuniculus
Q9YH26 9.27e-12 72 25 3 199 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
Q9YH26 1.03e-08 62 25 6 262 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Oreochromis mossambicus
P30714 1.38e-11 72 26 3 199 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P30714 9.52e-10 66 26 8 265 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Rhinella marina
P09572 1.51e-11 72 25 3 199 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P09572 1.96e-09 65 25 7 262 2 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Gallus gallus
P25489 1.93e-11 71 24 4 221 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P25489 1.81e-07 58 26 7 265 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Catostomus commersonii
P05024 4.02e-11 70 25 3 199 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
P05024 1.52e-10 68 26 8 265 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Sus scrofa
G5EFR6 4.73e-11 70 30 3 193 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
G5EFR6 9.5e-05 50 21 5 265 1 mca-1 Plasma membrane calcium-transporting ATPase mca-1 Caenorhabditis elegans
P58165 7.93e-11 69 28 4 194 2 atp2b2 Plasma membrane calcium-transporting ATPase 2 (Fragment) Oreochromis mossambicus
P50997 1.36e-10 68 26 8 265 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
P50997 9.35e-10 66 24 3 199 1 ATP1A1 Sodium/potassium-transporting ATPase subunit alpha-1 Canis lupus familiaris
Q92030 4.98e-10 67 26 3 196 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
Q92030 1.88e-09 65 26 6 262 2 atp1a1 Sodium/potassium-transporting ATPase subunit alpha-1 Anguilla anguilla
P9WPS5 6.53e-10 67 33 7 225 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS5 4.08e-06 54 26 5 213 1 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPS4 9.56e-10 66 33 7 225 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPS4 4.4e-06 54 26 5 213 3 ctpI Probable cation-transporting ATPase I Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O53114 2.9e-09 64 33 4 177 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
O53114 3.57e-07 58 26 5 228 3 ctpI Probable cation-transporting ATPase I Mycobacterium leprae (strain TN)
Q00804 4.81e-09 63 27 3 193 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
Q00804 0.000444 47 30 3 113 2 ATP2B1 Plasma membrane calcium-transporting ATPase 1 Oryctolagus cuniculus
Q5XF90 1.74e-08 62 24 3 229 1 Atp13a4 Probable cation-transporting ATPase 13A4 Mus musculus
Q4VNC1 3.57e-08 61 23 4 264 1 ATP13A4 Probable cation-transporting ATPase 13A4 Homo sapiens
Q5ZKB7 3.86e-08 61 22 5 312 2 ATP13A4 Probable cation-transporting ATPase 13A4 Gallus gallus
O74431 8.25e-08 60 25 13 306 3 SPCC1672.11c Probable cation-transporting ATPase C1672.11c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q21286 9.26e-08 59 25 12 300 2 catp-5 Cation-transporting ATPase catp-5 Caenorhabditis elegans
P17239 2.62e-07 57 42 0 80 1 merA Mercuric reductase Acidithiobacillus ferrooxidans
P17239 0.001 46 37 0 61 1 merA Mercuric reductase Acidithiobacillus ferrooxidans
Q58378 4.9e-07 55 32 2 117 1 patS Soluble P-type ATPase-like phosphatase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8CN01 3.23e-06 48 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL55 3.23e-06 48 39 1 61 3 copZ Copper chaperone CopZ Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q54465 5.64e-06 53 43 1 71 3 merA Mercuric reductase Shewanella putrefaciens
Q9NQ11 5.64e-06 53 24 7 324 1 ATP13A2 Polyamine-transporting ATPase 13A2 Homo sapiens
Q27533 1.38e-05 52 21 6 295 3 W08D2.5 Probable cation-transporting ATPase W08D2.5 Caenorhabditis elegans
Q5XF89 3.03e-05 51 22 10 299 1 Atp13a3 Polyamine-transporting ATPase 13A3 Mus musculus
O32221 0.000156 43 38 1 63 1 copZ Copper chaperone CopZ Bacillus subtilis (strain 168)
Q95JN5 0.000192 48 23 12 339 2 ATP13A3 Polyamine-transporting ATPase 13A3 Macaca fascicularis
Q9H7F0 0.000198 48 23 12 339 1 ATP13A3 Polyamine-transporting ATPase 13A3 Homo sapiens
Q79ZY4 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MW2)
A8Z3F9 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6B6 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MSSA476)
Q7A3E5 0.000246 43 38 1 62 1 copZ Copper chaperone CopZ Staphylococcus aureus (strain N315)
Q99R79 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QK48 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Newman)
Q5HCZ2 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain COL)
A5IVY4 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain JH9)
Q2FV63 0.000246 43 38 1 62 1 copZ Copper chaperone CopZ Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDU9 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain USA300)
A6U4T9 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain JH1)
A7X6S3 0.000246 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GDP0 0.000269 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain MRSA252)
P0C885 0.000269 43 38 1 62 3 copZ Copper chaperone CopZ Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q52109 0.000388 47 35 0 64 3 merA Mercuric reductase Acinetobacter calcoaceticus
Q51772 0.000397 47 34 2 94 3 merA Mercuric reductase Pseudomonas fluorescens
Q51772 0.000425 47 33 0 71 3 merA Mercuric reductase Pseudomonas fluorescens
P94702 0.000405 47 35 0 64 3 merA Mercuric reductase Enterobacter agglomerans
P13113 0.000713 42 40 2 65 1 merP Mercuric transport protein periplasmic component Serratia marcescens
Q51770 0.000794 42 40 2 65 3 merP Mercuric transport protein periplasmic component Pseudomonas fluorescens
Q4VNC0 0.00086 47 20 5 285 1 ATP13A5 Probable cation-transporting ATPase 13A5 Homo sapiens
P90747 0.001 46 29 3 118 3 catp-8 Probable manganese-transporting ATPase catp-8 Caenorhabditis elegans

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04945
Feature type CDS
Gene -
Product heavy metal translocating P-type ATPase
Location 1051231 - 1053717 (strand: 1)
Length 2487 (nucleotides) / 828 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_363
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00122 E1-E2 ATPase
PF00403 Heavy-metal-associated domain
PF00702 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2217 Inorganic ion transport and metabolism (P) P Cation-transporting P-type ATPase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K17686 P-type Cu+ transporter [EC:7.2.2.8] Platinum drug resistance
MAPK signaling pathway - plant
Mineral absorption		 -

Protein Sequence

MNTTPSSSSSSGRLSLSVEGMTCASCVGRVEKALKTVPGVNNAIVNLATERADITFAGDIDAPAAIRAIEGAGYNVTMETTEFAIEEMTCASCVGRVEKALANVPGVSEATVNLATERARVRHTAEVTFADLDAAVTQAGYKARRLSDSGTTANDQAEIRREKEDRSLRRALLTAAVFTLPVFIIEMGSHFIPGVHGWVTNTLGQQLNWYIQFVLATIVLFGPGMRFYRKGFPALLRGAPDMNSLVAVGTAAAYLFSVVSTFIPQILPAGTANIYYEAAVVIVTLILLGRTLEARAKGKTSQAIKRLVGLQPKTARVLRDGKTVEIALSDVMTDDIVLVRPGEKIPVDGEVTEGASYVDESMITGEPVPVSKETGSQVVGGTINKTGAFSFRVTKIGANTVLAQIIRLVEEAQGSKLPIQAMVDKITMWFVPAVMAGALITFLIWLFVGPDPALAFALINAVAVLIIACPCAMGLATPTSIMVGTGRAAEMGILFRKGEALQALRDVSVVALDKTGTLTKGRPELTDLVPADGFEYNEVLALVAAIETRSEHPIAEAIVVAAEEQGLTLAPIGNFAAVPGFGVSADVGGRTVSVGADRFMTQLGLDISRLLPDAKRLGEQGKSPLYAAIDGKLAAIIAVADPIKDTTPEAIRTLHALGLKVAMITGDNAATAAAIAKQLGIDEVAAEVLPDGKVAALKKFRSNGAKVAFVGDGINDAPALAEADVGLAIGTGTDVAIEAADVVLMSGDLRGVGDAIALSRATIRNIKQNLFWAFAYNALLIPVAAGLLYPVNGTLLSPMIAAAAMALSSVFVLANALRLKRFQVPVKN

Flanking regions ( +/- flanking 50bp)

AGGGAAAGGTTAAGCTTCTTATCAGACAATTTATTCCAGAGGGAAAAACCATGAATACAACTCCATCCTCATCTTCATCATCCGGACGGCTGAGCTTATCCGTTGAAGGCATGACCTGCGCATCCTGTGTTGGTCGCGTTGAAAAAGCACTGAAAACCGTTCCGGGTGTCAATAATGCCATTGTTAACCTGGCAACGGAGCGGGCAGATATTACCTTTGCCGGTGATATCGATGCGCCTGCGGCTATCCGTGCCATTGAAGGCGCAGGGTATAACGTCACAATGGAAACCACAGAATTTGCCATTGAAGAAATGACCTGTGCATCCTGCGTCGGGCGCGTTGAAAAAGCGCTGGCAAATGTCCCGGGTGTTTCCGAGGCAACCGTAAACCTGGCAACAGAGCGCGCCCGGGTGCGTCACACTGCGGAGGTAACATTTGCTGACCTGGATGCGGCGGTCACACAAGCGGGCTATAAAGCCCGGCGTTTGTCTGACAGCGGAACAACCGCAAATGATCAGGCAGAGATCCGCCGGGAAAAAGAAGACCGTTCATTGCGCCGCGCACTTCTGACAGCCGCTGTTTTCACCCTGCCCGTTTTTATCATTGAAATGGGCTCACACTTTATTCCGGGCGTACACGGCTGGGTTACAAATACACTCGGGCAACAGCTGAACTGGTATATTCAGTTCGTGCTCGCCACCATCGTGTTATTTGGTCCCGGAATGCGTTTTTACCGCAAAGGATTTCCGGCATTGCTGCGCGGCGCACCGGATATGAACTCACTGGTTGCGGTGGGTACCGCAGCGGCATATCTCTTTTCCGTTGTATCCACCTTTATTCCGCAGATTTTACCGGCGGGAACCGCCAATATTTATTATGAAGCAGCCGTCGTGATAGTGACACTGATCCTGCTCGGACGTACCCTGGAAGCTCGTGCCAAAGGAAAAACATCACAGGCAATCAAACGCCTGGTCGGGCTTCAGCCGAAAACGGCACGGGTATTGCGTGACGGAAAAACAGTTGAAATCGCACTCAGTGACGTAATGACTGACGATATTGTTCTTGTGCGCCCCGGGGAGAAAATTCCGGTTGACGGCGAGGTAACTGAAGGTGCTTCTTATGTCGATGAGAGCATGATCACCGGTGAACCGGTTCCGGTGTCAAAAGAAACCGGCTCACAAGTCGTCGGCGGAACCATTAATAAAACCGGTGCATTCAGCTTTCGCGTCACTAAAATTGGTGCGAATACAGTACTGGCGCAAATCATCCGGTTAGTCGAAGAAGCACAGGGCTCGAAATTACCTATCCAGGCGATGGTTGATAAAATCACCATGTGGTTTGTTCCGGCGGTTATGGCAGGCGCGTTAATCACCTTCCTCATCTGGTTATTTGTCGGGCCGGACCCGGCACTGGCATTCGCGCTGATTAATGCAGTGGCTGTTCTGATCATTGCCTGCCCGTGTGCAATGGGACTGGCGACACCGACCTCCATTATGGTGGGAACCGGTCGCGCCGCTGAGATGGGAATTTTGTTCCGCAAAGGGGAAGCATTACAGGCACTGCGCGATGTCAGCGTGGTTGCGCTTGATAAAACCGGTACCCTGACCAAAGGTCGCCCTGAACTGACCGACCTCGTACCGGCGGATGGGTTTGAATACAATGAAGTGCTTGCCCTGGTGGCTGCCATTGAAACCCGCTCAGAACACCCTATTGCAGAGGCAATTGTGGTGGCAGCAGAGGAACAAGGACTGACACTGGCACCAATCGGGAATTTCGCCGCCGTACCGGGCTTTGGTGTTTCTGCTGATGTCGGCGGGCGCACGGTTTCTGTCGGCGCAGACCGGTTTATGACTCAGCTGGGTCTGGATATCAGCCGTTTATTACCCGACGCTAAGCGTCTTGGTGAACAAGGTAAAAGTCCGCTTTATGCCGCAATTGACGGAAAGCTGGCAGCGATTATTGCAGTGGCTGACCCGATTAAAGACACAACACCGGAAGCTATCCGCACCCTGCATGCTCTGGGGCTGAAAGTTGCAATGATCACCGGTGACAATGCAGCAACAGCAGCGGCAATCGCCAAACAACTGGGTATTGATGAAGTGGCGGCGGAAGTTCTGCCTGACGGCAAAGTGGCAGCACTGAAGAAATTCCGCAGTAATGGTGCGAAAGTGGCATTTGTCGGTGATGGTATTAACGATGCGCCGGCACTTGCCGAAGCCGATGTTGGTCTTGCTATCGGAACCGGAACTGATGTGGCAATTGAAGCGGCAGATGTGGTGCTGATGTCAGGCGATTTACGCGGTGTTGGTGATGCGATTGCATTAAGCCGGGCGACAATCCGTAACATCAAACAGAATCTGTTCTGGGCGTTCGCGTACAACGCCCTGCTCATCCCTGTTGCGGCGGGTCTGTTGTATCCGGTCAACGGAACATTATTGTCCCCGATGATCGCCGCAGCCGCAATGGCGCTCTCCAGTGTCTTTGTTCTGGCTAATGCGTTACGCCTGAAACGTTTTCAGGTCCCTGTCAAAAACTGATTTATTATGATGCGTTATTCCGCCGTGTAATCAACTGCACGGTGGAATGT