Homologs in group_391

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14950 FBDBKF_14950 27.4 Morganella morganii S1 putP Na+/proline symporter
EHELCC_11295 EHELCC_11295 27.4 Morganella morganii S2 putP Na+/proline symporter
NLDBIP_11640 NLDBIP_11640 27.4 Morganella morganii S4 putP Na+/proline symporter
LHKJJB_11500 LHKJJB_11500 27.4 Morganella morganii S3 putP Na+/proline symporter
HKOGLL_10110 HKOGLL_10110 27.4 Morganella morganii S5 putP Na+/proline symporter
PMI_RS09590 PMI_RS09590 23.9 Proteus mirabilis HI4320 - sodium/sugar symporter
PMI_RS14715 PMI_RS14715 26.5 Proteus mirabilis HI4320 - sodium:solute symporter

Distribution of the homologs in the orthogroup group_391

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_391

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q5E733 1.88e-16 85 23 12 389 3 nanT Sodium/sialic acid symporter NanT Aliivibrio fischeri (strain ATCC 700601 / ES114)
P96169 1.77e-14 79 23 12 384 1 sglT Sodium/glucose cotransporter Vibrio parahaemolyticus
B4EZY7 1.45e-11 70 25 9 278 1 siaT Sodium/sialic acid symporter SiaT Proteus mirabilis (strain HI4320)
O06493 7.86e-11 67 21 13 452 1 opuE Osmoregulated proline transporter OpuE Bacillus subtilis (strain 168)
Q7T384 9.4e-11 67 23 13 460 1 slc5a12 Sodium-coupled monocarboxylate transporter 2 Danio rerio
P16256 1.59e-10 67 26 19 464 1 panF Sodium/pantothenate symporter Escherichia coli (strain K12)
Q92911 4.79e-10 65 23 12 440 1 SLC5A5 Sodium/iodide cotransporter Homo sapiens
Q7A0H2 4.01e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain MW2)
Q6G831 4.01e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain MSSA476)
Q7A4Q7 4.01e-09 62 23 12 382 1 putP Sodium/proline symporter Staphylococcus aureus (strain N315)
Q99SY5 4.01e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEM0 4.01e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain COL)
A5IU69 4.01e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH9)
Q2FWY7 4.01e-09 62 23 12 382 1 putP Sodium/proline symporter Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U307 4.01e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH1)
A7X430 4.01e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q3ZMH1 4.4e-09 62 25 16 389 1 slc5a8 Sodium-coupled monocarboxylate transporter 1 Danio rerio
A8Z2R6 4.66e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300 / TCH1516)
Q2FFJ3 4.66e-09 62 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300)
Q6GFF5 6.97e-09 61 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain MRSA252)
Q2YU74 7.22e-09 61 23 13 380 3 putP Sodium/proline symporter Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7SYH5 1.62e-08 60 23 15 450 2 slc5a8 Sodium-coupled monocarboxylate transporter 1 Xenopus laevis
Q5BL81 1.96e-08 60 23 18 495 2 slc5a8 Sodium-coupled monocarboxylate transporter 1 Xenopus tropicalis
Q4L7L6 2.66e-08 60 23 10 371 3 putP Sodium/proline symporter Staphylococcus haemolyticus (strain JCSC1435)
A6QID0 2.68e-08 60 23 12 382 3 putP Sodium/proline symporter Staphylococcus aureus (strain Newman)
Q9XT77 2.72e-08 60 23 20 485 2 SLC5A6 Sodium-dependent multivitamin transporter Oryctolagus cuniculus
Q63008 2.86e-08 60 24 16 457 1 Slc5a5 Sodium/iodide cotransporter Rattus norvegicus
P83740 7.05e-08 58 24 12 459 2 CG32669 Putative sodium-dependent multivitamin transporter Drosophila melanogaster
A7MBD8 7.39e-08 58 23 12 453 2 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Bos taurus
Q8BYF6 7.54e-08 58 23 14 434 1 Slc5a8 Sodium-coupled monocarboxylate transporter 1 Mus musculus
O70247 1.93e-07 57 22 19 479 1 Slc5a6 Sodium-dependent multivitamin transporter Rattus norvegicus
Q9NY91 8.54e-07 55 22 16 480 1 SLC5A4 Probable glucose sensor protein SLC5A4 Homo sapiens
P44963 1.09e-06 54 26 11 318 3 panF Sodium/pantothenate symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P53792 1.39e-06 54 25 18 406 1 Slc5a2 Sodium/glucose cotransporter 2 Rattus norvegicus
Q5HN32 1.42e-06 54 23 13 377 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q53584 1.57e-06 54 22 13 382 3 putP Sodium/proline symporter Staphylococcus aureus
Q5U4D8 1.65e-06 54 22 18 443 1 Slc5a6 Sodium-dependent multivitamin transporter Mus musculus
Q8CNP2 1.67e-06 54 23 12 373 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8K0E3 2.36e-06 53 23 16 471 1 Slc5a11 Sodium/myo-inositol cotransporter 2 Mus musculus
Q1EHB4 3.18e-06 53 21 10 412 1 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Homo sapiens
Q9Y289 4.93e-06 52 23 14 383 1 SLC5A6 Sodium-dependent multivitamin transporter Homo sapiens
Q8WWX8 4.97e-06 52 23 12 397 1 SLC5A11 Sodium/myo-inositol cotransporter 2 Homo sapiens
P94392 6.99e-06 52 24 18 443 1 putP High-affinity proline transporter PutP Bacillus subtilis (strain 168)
Q99PN0 9.09e-06 52 24 16 457 1 Slc5a5 Sodium/iodide cotransporter Mus musculus
Q923I7 1.02e-05 52 24 15 405 1 Slc5a2 Sodium/glucose cotransporter 2 Mus musculus
D3ZIS0 1.35e-05 51 19 10 397 3 Slc5a4 Solute carrier family 5 member 4 Rattus norvegicus
Q28728 1.37e-05 51 22 12 398 1 SLC5A11 Sodium/myo-inositol cotransporter 2 Oryctolagus cuniculus
Q8N695 1.37e-05 51 22 16 476 1 SLC5A8 Sodium-coupled monocarboxylate transporter 1 Homo sapiens
Q49YU6 1.55e-05 51 22 11 379 3 putP2 Sodium/proline symporter 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4A070 1.76e-05 50 24 12 350 3 putP1 Sodium/proline symporter 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P39599 1.81e-05 50 23 16 394 3 ywcA Uncharacterized symporter YwcA Bacillus subtilis (strain 168)
B7LMN9 3.96e-05 50 22 9 398 3 actP Cation/acetate symporter ActP Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5Z1C8 3.96e-05 50 22 9 398 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5T7 3.96e-05 50 22 9 398 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7
B7NG10 4.03e-05 50 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1LPN2 4.06e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli (strain SMS-3-5 / SECEC)
Q0T9Y2 4.06e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NSM7 4.06e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P31639 4.14e-05 50 25 18 405 1 SLC5A2 Sodium/glucose cotransporter 2 Homo sapiens
Q1R3J9 4.24e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli (strain UTI89 / UPEC)
A1AIQ8 4.24e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O1:K1 / APEC
B7MSH6 4.24e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O81 (strain ED1a)
B7MJT5 4.24e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UPN5 4.24e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83P94 6.06e-05 49 22 9 394 3 actP Cation/acetate symporter ActP Shigella flexneri
Q91ZP4 0.000122 48 21 13 400 2 Slc5a4b Solute carrier family 5 member 4B Mus musculus
Q31TS7 0.000123 48 22 9 398 3 actP Cation/acetate symporter ActP Shigella boydii serotype 4 (strain Sb227)
B2TXA0 0.000131 48 22 9 394 3 actP Cation/acetate symporter ActP Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A8AN31 0.000152 48 22 9 394 3 actP Cation/acetate symporter ActP Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q49B93 0.00017 48 21 12 439 1 Slc5a12 Sodium-coupled monocarboxylate transporter 2 Mus musculus
A8A7G7 0.00017 47 22 9 398 3 actP Cation/acetate symporter ActP Escherichia coli O9:H4 (strain HS)
B7M7Y0 0.00017 47 22 9 398 3 actP Cation/acetate symporter ActP Escherichia coli O8 (strain IAI1)
B6I5T5 0.000197 47 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli (strain SE11)
P32705 0.000197 47 22 9 394 1 actP Cation/acetate symporter ActP Escherichia coli (strain K12)
B1IUI4 0.000197 47 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XCV3 0.000197 47 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / DH10B)
C5A160 0.000197 47 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / MC4100 / BW2952)
B7LB16 0.000197 47 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli (strain 55989 / EAEC)
A7ZUU1 0.000197 47 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O139:H28 (strain E24377A / ETEC)
B5R937 0.000219 47 22 9 394 3 actP Cation/acetate symporter ActP Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8Z1R2 0.000224 47 22 10 395 3 actP Cation/acetate symporter ActP Salmonella typhi
Q8FAZ0 0.000226 47 22 9 394 3 actP Cation/acetate symporter ActP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q57GV4 0.000232 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella choleraesuis (strain SC-B67)
B4T1W9 0.000234 47 22 9 394 3 actP Cation/acetate symporter ActP Salmonella newport (strain SL254)
B2VKE4 0.000243 47 22 11 411 3 actP Cation/acetate symporter ActP Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P13866 0.000253 47 22 15 403 1 SLC5A1 Sodium/glucose cotransporter 1 Homo sapiens
B5QZ97 0.000253 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella enteritidis PT4 (strain P125109)
B5FRF0 0.000253 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella dublin (strain CT_02021853)
A9MGK8 0.000253 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q9ET37 0.000254 47 22 12 399 1 Slc5a4a Solute carrier family 5 member 4A Mus musculus
Q8ZKF8 0.000258 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TRK2 0.000258 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella schwarzengrund (strain CVM19633)
B5BJZ5 0.000258 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain AKU_12601)
A9N1R2 0.000258 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJ05 0.000258 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TEB2 0.000258 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella heidelberg (strain SL476)
B5F2E9 0.000258 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella agona (strain SL483)
C0Q552 0.000307 47 22 9 398 3 actP Cation/acetate symporter ActP Salmonella paratyphi C (strain RKS4594)
Q9Z1F2 0.000412 46 30 3 118 1 Slc5a11 Sodium/myo-inositol cotransporter 2 Rattus norvegicus
A1JIK1 0.000584 46 23 14 411 3 actP Cation/acetate symporter ActP Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P53794 0.0006 46 21 17 485 1 SLC5A3 Sodium/myo-inositol cotransporter Homo sapiens
A0PJK1 0.000717 45 21 13 406 1 SLC5A10 Sodium/mannose cotransporter SLC5A10 Homo sapiens
A7FNG3 0.000744 45 22 13 426 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JNK6 0.000804 45 22 13 426 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FN0 0.000804 45 22 13 426 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K137 0.000804 45 22 13 426 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4TS08 0.001 45 22 12 384 3 actP Cation/acetate symporter ActP Yersinia pestis (strain Pestoides F)
Q1CE35 0.001 45 22 12 384 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Nepal516)
A9R563 0.001 45 22 12 384 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJ73 0.001 45 22 12 384 3 actP Cation/acetate symporter ActP Yersinia pestis
Q1C0M8 0.001 45 22 12 384 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Antiqua)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04925
Feature type CDS
Gene -
Product sodium:solute symporter family protein
Location 1046182 - 1047672 (strand: 1)
Length 1491 (nucleotides) / 496 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_391
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00474 Sodium:solute symporter family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0591 Amino acid transport and metabolism (E) E Na+/proline symporter

Protein Sequence

MQMLDWITLSLFFVIMIGIGLNAYRRVKGTNDFYVAGGGLPWWLAGISHHVSGYSGVVFTGYAALAYASGFNLYVWWALNVTIACLLGAWLIVPRWARLRNALQVQSPTEYLKIRYDIKTQQLIAWLGVLLKLLDTAGKYAAIGVLFYGFTGLPVIYGVLISGTVAMIYVTVGGLWADTMNDFFQFLVGIAAGVIMFFIVQSQLGDIGTNYLDMWDKLPAGNSDWFNGQYSPLFFASFAFVCFLSYNGGTWNLASRFIASPDGKQARRAMMLSASLYLVWPLILFAPMWAAPLLLPDVPHSEQTQIYSMLTLKYLPAGFVGVILASMFAATLSMVASDANAISSVLSRDILPLISKRVKRANGETPLWMARVVTFTFTLCTMILALNQEHFGGIIGLIVVWFGGLIGPASIPMVLGLLPFYKHCGPKIAISSMLIGLAVFAGTKLFVTAPSMALSVGGPVFCSLVFFTLAAIIARRNPVKPEVEELMHKLSRDGEH

Flanking regions ( +/- flanking 50bp)

AACGTATTTCCTGATGATGTTGATAAAAATAACGACAAGGAATCAATAAGATGCAAATGCTGGATTGGATAACACTCTCACTTTTCTTCGTGATTATGATAGGTATCGGCCTGAATGCTTACCGCCGGGTGAAAGGTACAAACGATTTTTATGTTGCCGGCGGCGGGCTGCCCTGGTGGCTGGCCGGGATTTCGCATCATGTGTCCGGGTATTCAGGTGTGGTGTTTACCGGTTATGCCGCCCTTGCCTATGCGTCCGGCTTTAACCTGTATGTGTGGTGGGCGCTGAACGTGACTATCGCGTGCCTGCTTGGTGCCTGGCTTATCGTGCCCCGCTGGGCGCGGCTGCGTAATGCATTACAGGTGCAGTCACCGACTGAATACCTGAAAATCCGTTATGATATTAAAACCCAGCAGTTGATCGCCTGGCTCGGTGTGTTACTGAAATTACTGGATACCGCCGGAAAATATGCGGCAATCGGTGTGCTGTTCTACGGTTTCACGGGGCTCCCGGTTATTTACGGTGTGCTGATTTCCGGTACTGTTGCGATGATTTATGTCACTGTCGGCGGGCTGTGGGCGGATACCATGAATGATTTCTTCCAGTTCCTGGTTGGTATCGCGGCAGGTGTGATTATGTTTTTTATCGTGCAGTCACAATTGGGCGATATCGGCACTAACTATCTGGATATGTGGGATAAACTTCCGGCGGGTAACAGTGACTGGTTTAATGGTCAGTACAGTCCGTTGTTCTTTGCCAGCTTCGCATTTGTCTGTTTCCTCAGTTATAACGGCGGCACCTGGAACCTCGCCTCCCGTTTTATCGCTTCACCGGATGGCAAACAAGCCCGCCGCGCTATGATGCTTTCCGCCTCACTTTATCTTGTCTGGCCGTTGATCCTGTTTGCGCCTATGTGGGCTGCCCCGCTGCTTCTCCCTGATGTGCCGCATTCAGAACAGACTCAGATTTATTCGATGCTGACACTGAAATATTTACCGGCCGGGTTTGTCGGGGTGATCCTCGCATCCATGTTTGCCGCAACACTCTCGATGGTGGCATCTGATGCTAATGCCATCAGTTCTGTGCTCTCGCGGGATATTCTGCCGCTGATCTCAAAAAGAGTGAAACGGGCTAATGGTGAAACACCACTCTGGATGGCACGGGTTGTCACATTCACCTTTACACTCTGCACCATGATCCTGGCTCTGAATCAGGAGCATTTCGGCGGCATTATCGGACTTATCGTCGTGTGGTTCGGCGGATTAATTGGTCCGGCCTCTATCCCGATGGTATTAGGTCTTCTGCCGTTCTATAAGCATTGCGGACCTAAAATTGCCATCAGCTCCATGTTGATAGGTCTGGCTGTTTTTGCCGGGACCAAACTGTTTGTAACGGCACCATCAATGGCGCTGTCAGTCGGCGGACCGGTCTTCTGCTCCCTGGTGTTCTTCACGCTGGCAGCCATTATCGCCCGCAGAAACCCGGTAAAACCGGAAGTGGAAGAACTTATGCACAAACTGAGCCGCGACGGGGAACATTAAGATGGGGTTATCACCGCAACAGCGCGAACAGTGCCGTACTCTGTGGCAAC