Homologs in group_82

Help

11 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02425 FBDBKF_02425 93.5 Morganella morganii S1 malX Phosphotransferase system IIB components
FBDBKF_04790 FBDBKF_04790 54.6 Morganella morganii S1 malX Phosphotransferase system IIB components
EHELCC_02895 EHELCC_02895 93.5 Morganella morganii S2 malX Phosphotransferase system IIB components
EHELCC_06080 EHELCC_06080 54.6 Morganella morganii S2 malX Phosphotransferase system IIB components
NLDBIP_00565 NLDBIP_00565 93.5 Morganella morganii S4 malX Phosphotransferase system IIB components
NLDBIP_06400 NLDBIP_06400 54.6 Morganella morganii S4 malX Phosphotransferase system IIB components
LHKJJB_01470 LHKJJB_01470 93.5 Morganella morganii S3 malX Phosphotransferase system IIB components
LHKJJB_03280 LHKJJB_03280 54.6 Morganella morganii S3 malX Phosphotransferase system IIB components
HKOGLL_01510 HKOGLL_01510 93.5 Morganella morganii S5 malX Phosphotransferase system IIB components
HKOGLL_06755 HKOGLL_06755 54.6 Morganella morganii S5 malX Phosphotransferase system IIB components
F4V73_RS09260 F4V73_RS09260 54.4 Morganella psychrotolerans malX maltose/glucose-specific PTS transporter subunit IIBC

Distribution of the homologs in the orthogroup group_82

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_82

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P19642 0.0 849 78 1 528 1 malX PTS system maltose-specific EIICB component Escherichia coli (strain K12)
P20166 3.31e-109 344 38 12 532 1 ptsG PTS system glucose-specific EIICBA component Bacillus subtilis (strain 168)
Q7CCJ4 1.23e-104 331 38 11 513 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL73 1.23e-104 331 38 11 513 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VRH0 1.23e-104 331 38 11 513 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis
Q7A807 1.83e-103 328 38 12 514 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain N315)
Q99X32 1.83e-103 328 38 12 514 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IP58 1.83e-103 328 38 12 514 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH9)
A6TXX3 1.83e-103 328 38 12 514 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH1)
A7WXI2 1.83e-103 328 38 12 514 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L945 4.91e-103 327 38 12 514 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus haemolyticus (strain JCSC1435)
Q4A0C4 5.59e-101 322 37 11 514 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8NYM1 5.73e-100 319 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z0F5 5.73e-100 319 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6GCT7 5.73e-100 319 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QDH3 5.73e-100 319 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HJI3 5.73e-100 319 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain COL)
Q2G1G8 5.73e-100 319 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK73 5.73e-100 319 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300)
Q2YUZ1 1.13e-99 318 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GKB7 1.14e-99 318 37 13 524 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q8NUS2 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z3D6 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6D6 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QK27 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HD13 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain COL)
A5IVW5 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH9)
Q2FV87 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDW8 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300)
A6U4R9 1.26e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH1)
Q7A3G4 1.3e-95 308 37 11 523 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain N315)
Q99R97 1.3e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X6P1 1.3e-95 308 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q57071 2.67e-95 307 38 15 534 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus carnosus (strain TM300)
Q6GDR0 3.42e-95 307 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q2YWC1 5.62e-95 306 37 11 523 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q53922 1.86e-93 303 37 13 535 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus carnosus (strain TM300)
P37439 9.24e-85 274 35 14 518 1 ptsG PTS system glucose-specific EIICB component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P69786 1e-83 271 35 14 517 1 ptsG PTS system glucose-specific EIICB component Escherichia coli (strain K12)
P69787 1e-83 271 35 14 517 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69788 1e-83 271 35 14 517 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O157:H7
Q89AG6 7.93e-83 269 35 14 517 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P39816 6.18e-82 271 35 14 518 2 gamP PTS system glucosamine-specific EIICBA component Bacillus subtilis (strain 168)
P57437 2.32e-75 249 34 16 521 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9AGA7 3.79e-72 243 32 15 566 4 aglA PTS system alpha-glucoside-specific EIICB component Klebsiella pneumoniae
C7NB69 1.27e-71 241 32 11 537 3 Lebu_1527 PTS system alpha-glucoside-specific EIICB component Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b)
Q8K9J0 2.11e-71 239 36 18 518 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P54715 6.48e-70 236 31 13 537 1 malP PTS system maltose-specific EIICB component Bacillus subtilis (strain 168)
O06900 7.41e-66 225 31 12 534 4 malB PTS system alpha-glucoside-specific EIICB component Fusobacterium mortiferum
P09323 1.06e-63 223 33 11 523 1 nagE PTS system N-acetylglucosamine-specific EIICBA component Escherichia coli (strain K12)
P45604 4.61e-62 218 34 12 519 3 nagE PTS system N-acetylglucosamine-specific EIICBA component Klebsiella pneumoniae
O34521 1.06e-58 204 31 12 520 1 nagP PTS system N-acetylglucosamine-specific EIICB component Bacillus subtilis (strain 168)
P35595 1.44e-54 199 28 15 565 3 exp5 PTS system glucose-specific EIICBA component Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9S2H4 1.66e-52 187 31 10 433 1 nagE2 PTS system N-acetylglucosamine-specific EIIC component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P31452 1.47e-41 156 34 7 381 1 glvC Phosphotransferase IIC component GlvC Escherichia coli (strain K12)
P75569 9.89e-33 137 34 6 255 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75569 2.17e-29 126 31 6 270 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47315 3.8e-29 125 32 5 252 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47315 5.81e-26 116 31 7 266 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P42015 4.16e-25 109 40 6 171 3 ptsG PTS system glucose-specific EIICBA component (Fragment) Geobacillus stearothermophilus
P69790 1.46e-18 86 40 5 140 3 glvB Phosphotransferase enzyme IIB component GlvB Shigella flexneri
P69789 1.46e-18 86 40 5 140 3 glvB Phosphotransferase enzyme IIB component GlvB Escherichia coli (strain K12)
Q9CKN5 4.16e-09 62 41 0 68 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Pasteurella multocida (strain Pm70)
Q31Y50 7.38e-09 61 40 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella boydii serotype 4 (strain Sb227)
Q32DC5 1.16e-08 61 40 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella dysenteriae serotype 1 (strain Sd197)
P77272 1.17e-08 61 40 3 87 1 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain K12)
Q1R8U3 1.3e-08 60 40 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain UTI89 / UPEC)
Q83QN3 1.34e-08 60 40 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella flexneri
Q8XBJ1 1.34e-08 60 40 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O157:H7
Q8FFA9 1.38e-08 60 40 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q6GKB4 2.17e-08 60 39 4 86 3 SAR0193 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MRSA252)
Q2YV12 2.17e-08 60 39 4 86 3 SAB0132 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A1Y1 2.48e-08 60 43 3 72 3 MW0166 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MW2)
Q6GCT4 2.48e-08 60 43 3 72 3 SAS0167 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MSSA476)
Q7A804 2.48e-08 60 43 3 72 1 SA0186 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain N315)
Q99X29 2.48e-08 60 43 3 72 3 SAV0192 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJI0 2.48e-08 60 43 3 72 3 SACOL0178 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain COL)
Q2G1G5 2.48e-08 60 43 3 72 3 SAOUHSC_00158 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK70 2.48e-08 60 43 3 72 1 murP PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain USA300)
Q9S2H6 3.64e-08 53 42 1 71 1 nagF PTS system N-acetylglucosamine-specific EIIB component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7N9D9 3.79e-08 59 32 3 84 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9KVD9 9.64e-08 58 32 2 86 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q49ZN7 9.14e-07 55 40 3 72 3 SSP0594 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CNB2 1.15e-06 54 35 4 87 3 SE_1890 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLT2 1.15e-06 54 35 4 87 3 SERP1900 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P40739 1.35e-06 54 38 0 63 3 bglP PTS system beta-glucoside-specific EIIBCA component Bacillus subtilis (strain 168)
Q5E5T6 1.53e-06 54 42 2 63 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87FD5 1.65e-06 54 31 2 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P24241 1.99e-06 54 34 0 82 3 ascF PTS system arbutin-, cellobiose-, and salicin-specific EIIBC component Escherichia coli (strain K12)
Q9KF90 2.69e-06 53 40 0 70 3 bglP PTS system beta-glucoside-specific EIIBCA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P05306 7.52e-06 52 36 1 74 1 sacP PTS system sucrose-specific EIIBC component Bacillus subtilis (strain 168)
Q4L8H5 1.78e-05 51 36 3 72 3 SH0741 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus haemolyticus (strain JCSC1435)
Q45298 2.44e-05 50 39 1 71 3 ptsG PTS system glucose-specific EIIBCA component Corynebacterium glutamicum
Q46072 3.2e-05 50 39 1 71 4 ptsM PTS system mannose-specific EIIBCA component Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P39794 3.3e-05 50 30 2 102 2 treP PTS system trehalose-specific EIIBC component Bacillus subtilis (strain 168)
P26207 4.73e-05 50 39 1 82 3 arbF PTS system beta-glucoside-specific EIIBCA component Dickeya chrysanthemi
Q7MBS2 5.24e-05 49 28 1 77 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain YJ016)
Q8D4Z3 5.34e-05 49 28 1 77 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain CMCP6)
P51184 6.03e-05 49 32 1 82 3 scrA PTS system sucrose-specific EIIBC component Staphylococcus xylosus
P15400 6.63e-05 49 33 2 80 1 sacX Probable PTS system sucrose-specific EIIBC component Bacillus subtilis (strain 168)
Q797S1 0.00016 48 42 2 61 3 ybbF Putative PTS system EIIBC component YbbF Bacillus subtilis (strain 168)
P08722 0.000233 47 36 1 83 1 bglF PTS system beta-glucoside-specific EIIBCA component Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04800
Feature type CDS
Gene malX
Product maltose/glucose-specific PTS transporter subunit IIBC
Location 1017910 - 1019532 (strand: -1)
Length 1623 (nucleotides) / 540 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_82
Orthogroup size 12
N. genomes 6

Actions

Genomic region

Domains

PF00367 phosphotransferase system, EIIB
PF02378 Phosphotransferase system, EIIC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1263 Carbohydrate transport and metabolism (G) G Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02791 maltose/glucose PTS system EIICB component [EC:2.7.1.199 2.7.1.208] Glycolysis / Gluconeogenesis
Starch and sucrose metabolism
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Phosphotransferase system (PTS)		 -

Protein Sequence

MSSQPKQKVTLWEFFQGLGKTFMLPVALLSFCGIMLGIGSSLSSRDVLTLLPFLDHTAFQLVFTWMSKVGSFAFSFLPVMFAIAIPLGLARENKGVAAFAGFVGFTVFNLATNFYLTATGVLPTTDPLILKAHNIQNIIGIQSIDSGILGAVIVGIIVYMLHERFNTIRLPDALAFFGGTRFVPIITTLVLGLCGLLVPLIWPWFAMGINGLGKLIHSAGAFGPMIFGSGERLLLPFGLHHILVALIRFTEAGGTMDVCGNTVNGALTIFQAQLSCPDTQGFAASATQFLSQGKMPAFLGGLPGAALAMYHCAHPENRHKIKGLLISGVVACVIGGTTEPLEFLFLFVAPFLYLIHAILTGLGFTVMAVTGVTIGNTDGNLIDFVVFGILHGIQTKWYMVPVVAFIWFASYYAIFRFAITRFNIKTPGRDTEIKAGDKAPVITGSAGKSGYNVPAILQALGGKENIISLDNCITRLRMSVHDMSKVDDAQLKALRAIGVVHLNDHNLQVVIGPQVQSVKDELDQLMKSAPDSAQPVVQNA

Flanking regions ( +/- flanking 50bp)

ACGAACCTGCAGTTTGAATGAATAAGAGTATAATAATTACAGGATACGGTATGAGTAGCCAACCAAAACAAAAAGTCACGCTCTGGGAATTTTTCCAGGGACTTGGCAAAACATTTATGCTGCCTGTCGCACTGCTCTCATTTTGCGGGATCATGCTCGGGATAGGCAGTTCGCTCAGCAGCCGTGATGTTCTCACCCTGCTGCCGTTCCTTGACCACACTGCATTCCAGCTGGTTTTCACCTGGATGAGTAAAGTCGGCTCATTTGCCTTCAGCTTTTTGCCGGTGATGTTTGCTATCGCCATTCCGCTGGGTCTGGCGCGTGAGAATAAAGGTGTCGCTGCATTTGCGGGCTTTGTCGGCTTTACGGTATTCAACCTTGCCACCAACTTTTATCTGACGGCAACCGGCGTATTACCCACAACCGACCCGCTGATACTTAAAGCACACAATATTCAGAATATCATTGGTATTCAGTCAATTGACAGCGGAATTCTGGGCGCAGTGATTGTCGGTATCATTGTTTATATGCTGCATGAGCGCTTTAATACCATCCGCCTGCCGGATGCGCTCGCATTCTTCGGCGGTACCCGGTTTGTGCCGATTATCACTACCCTGGTGCTGGGTTTATGTGGTTTATTGGTGCCGCTTATCTGGCCGTGGTTCGCAATGGGGATCAACGGATTAGGTAAGCTTATTCACAGTGCGGGTGCATTCGGTCCGATGATTTTCGGCTCCGGCGAACGGTTGTTACTGCCTTTCGGCCTGCACCATATTCTTGTCGCACTTATCCGCTTTACTGAAGCCGGCGGCACAATGGATGTGTGCGGTAATACCGTTAACGGCGCGCTGACTATCTTCCAGGCACAGCTTTCCTGCCCGGATACACAGGGTTTCGCGGCAAGTGCCACTCAGTTCCTTTCTCAGGGAAAGATGCCCGCTTTCCTCGGCGGTCTGCCTGGTGCGGCGTTAGCTATGTATCACTGCGCACATCCTGAAAACCGTCATAAAATTAAAGGATTACTGATTTCCGGTGTGGTTGCCTGTGTGATTGGCGGCACCACAGAACCGCTGGAATTCCTGTTCCTGTTTGTCGCACCGTTCCTGTATCTTATCCATGCGATCCTGACCGGTCTTGGCTTCACAGTGATGGCTGTCACCGGGGTGACTATTGGTAATACAGACGGTAACCTGATTGATTTTGTGGTCTTCGGGATCCTGCACGGCATTCAGACTAAGTGGTATATGGTGCCGGTTGTCGCCTTTATCTGGTTTGCCTCTTACTATGCGATTTTCCGTTTCGCCATTACCCGCTTTAATATCAAAACCCCAGGTCGTGACACAGAAATCAAAGCGGGTGATAAAGCGCCTGTCATCACCGGCTCAGCGGGTAAATCCGGTTATAATGTCCCTGCTATCCTTCAGGCTCTCGGCGGCAAAGAGAATATTATTTCACTGGATAACTGTATCACCCGCCTGCGGATGTCAGTTCATGATATGAGCAAAGTTGATGATGCACAGCTTAAAGCGCTGCGGGCAATCGGGGTTGTTCATCTTAATGACCATAATTTACAGGTTGTTATTGGTCCGCAGGTTCAGTCTGTCAAAGATGAACTGGATCAACTGATGAAATCTGCGCCTGACAGCGCACAACCTGTAGTTCAAAATGCGTGATAATACAAAATACTTGATAGTTCAAAACGCCTGATATTCCTCACCGCACT