Homologs in group_2520

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02190 FBDBKF_02190 91.0 Morganella morganii S1 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
EHELCC_02660 EHELCC_02660 91.0 Morganella morganii S2 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
NLDBIP_00800 NLDBIP_00800 91.0 Morganella morganii S4 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
LHKJJB_01235 LHKJJB_01235 91.0 Morganella morganii S3 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
HKOGLL_01275 HKOGLL_01275 91.0 Morganella morganii S5 lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA

Distribution of the homologs in the orthogroup group_2520

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2520

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q2PBM0 0.0 715 67 1 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus luminescens
B1JLQ0 0.0 711 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EY9 0.0 711 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3G1 0.0 711 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FMJ7 0.0 711 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q2PBM3 0.0 709 66 1 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus temperata
A4TQL5 0.0 707 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
Q1CN15 0.0 707 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R074 0.0 707 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
Q0WJP9 0.0 707 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q1C138 0.0 707 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
Q7N2D9 0.0 707 66 1 518 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JJ55 0.0 702 68 2 519 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P77257 0.0 664 66 1 497 1 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain K12)
B1XEA1 0.0 664 66 1 497 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain K12 / DH10B)
B1IRU7 0.0 660 66 1 497 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1LFA2 0.0 658 66 1 497 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli (strain SMS-3-5 / SECEC)
A8A066 0.0 657 66 1 497 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli O9:H4 (strain HS)
Q83L12 0.0 655 65 1 497 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Shigella flexneri
Q0T4L9 0.0 655 65 1 497 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Shigella flexneri serotype 5b (strain 8401)
Q8XAY7 0.0 652 65 1 497 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Escherichia coli O157:H7
P0C886 0.0 643 63 1 510 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella choleraesuis (strain SC-B67)
A9MZG1 0.0 642 63 1 510 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJE7 0.0 642 63 1 510 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZKQ4 0.0 640 63 1 510 1 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z2X5 0.0 639 63 1 510 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Salmonella typhi
A6TEB8 0.0 597 61 1 496 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WER4 0.0 589 62 1 493 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Enterobacter sp. (strain 638)
A7ZLX1 1.96e-140 411 66 0 306 5 lsrA Putative autoinducer 2 import ATP-binding protein LsrA homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
A7ZLX1 3.85e-11 68 24 3 252 5 lsrA Putative autoinducer 2 import ATP-binding protein LsrA homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1AVD3 1.91e-119 364 40 7 520 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8RD43 3e-114 350 38 8 508 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD43 5.43e-11 68 23 5 230 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3MB44 1.38e-113 349 40 6 510 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3MB44 5.68e-17 87 24 5 269 3 rbsA Ribose import ATP-binding protein RbsA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q825P1 3.44e-113 347 38 6 498 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q92W60 1.36e-112 346 38 5 503 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q92W60 2.03e-10 66 26 5 248 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q1J3P2 1.53e-112 345 38 5 496 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q1J3P2 4.82e-08 59 26 5 227 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q13FD9 1.82e-111 343 40 7 512 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q13FD9 7.53e-15 80 27 4 250 3 Bxeno_C1272 Putative ribose/galactose/methyl galactoside import ATP-binding protein Paraburkholderia xenovorans (strain LB400)
Q1M360 1.15e-110 341 38 6 504 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M360 2.12e-12 73 26 6 249 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q4KDI2 1.17e-110 341 40 7 507 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KDI2 3.2e-13 75 26 3 226 3 PFL_2594 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9CL63 3.57e-110 340 38 7 508 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q0TPX5 4.3e-110 339 35 6 509 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8CK44 7.69e-110 339 38 6 498 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8XJX3 1.01e-109 338 35 6 509 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain 13 / Type A)
Q0SSJ0 1.78e-109 338 35 6 509 3 rbsA Ribose import ATP-binding protein RbsA Clostridium perfringens (strain SM101 / Type A)
Q6HNE7 2.55e-109 337 36 6 501 3 rbsA Ribose import ATP-binding protein RbsA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81V36 2.55e-109 337 36 6 501 3 rbsA Ribose import ATP-binding protein RbsA Bacillus anthracis
Q5KUX3 4.52e-109 337 39 9 508 3 rbsA Ribose import ATP-binding protein RbsA Geobacillus kaustophilus (strain HTA426)
Q2SMT0 7.11e-109 337 38 7 502 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q2SMT0 2.94e-10 66 26 8 255 3 HCH_01167 Putative ribose/galactose/methyl galactoside import ATP-binding protein Hahella chejuensis (strain KCTC 2396)
Q6DB87 9.44e-109 336 37 6 507 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q63FX9 1.23e-108 335 36 6 501 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ZK / E33L)
Q9K6J9 1.54e-108 335 38 7 500 3 rbsA Ribose import ATP-binding protein RbsA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8Y003 2.59e-108 335 38 6 503 3 RSc1242 Putative ribose/galactose/methyl galactoside import ATP-binding protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y003 1.15e-12 73 26 5 259 3 RSc1242 Putative ribose/galactose/methyl galactoside import ATP-binding protein Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8ENB3 3.12e-108 334 37 5 502 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENB3 3.41e-14 78 26 4 240 3 rbsA Ribose import ATP-binding protein RbsA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q87ZE0 3.82e-108 335 38 6 504 3 PSPTO_3489 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q81HW8 4.36e-108 334 37 6 501 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0S9A4 5.09e-108 334 37 9 515 3 rbsA Ribose import ATP-binding protein RbsA Rhodococcus jostii (strain RHA1)
Q73DH7 7.58e-108 333 36 6 501 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5KYQ7 1.36e-107 333 38 8 501 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 2.65e-14 79 26 5 229 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q1GHE5 1.59e-107 333 38 8 510 3 rbsA Ribose import ATP-binding protein RbsA Ruegeria sp. (strain TM1040)
Q92TS8 1.69e-107 333 39 8 511 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q92TS8 2.69e-11 69 25 3 225 3 RB1420 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium meliloti (strain 1021)
Q9KAG5 2.45e-107 333 37 8 511 3 BH2322 Putative ribose/galactose/methyl galactoside import ATP-binding protein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0BG60 2.71e-107 333 38 5 501 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BG60 1.19e-12 73 27 6 253 3 Bamb_1305 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q9CF44 3.4e-107 332 38 5 500 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. lactis (strain IL1403)
Q02XM9 3.75e-107 332 37 5 498 3 rbsA Ribose import ATP-binding protein RbsA Lactococcus lactis subsp. cremoris (strain SK11)
Q82CM5 7.26e-107 332 38 7 525 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9RDI1 7.61e-107 332 39 7 524 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q48GY7 1.46e-106 331 37 6 512 3 PSPPH_3184 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q664G2 5.03e-106 329 39 7 506 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8X5Q4 8.73e-106 328 38 5 502 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Escherichia coli O157:H7
Q1CDJ0 9.59e-106 328 39 7 506 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG00 9.59e-106 328 39 7 506 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q1C1B8 9.59e-106 328 39 7 506 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1BX03 2.53e-105 328 38 8 501 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
Q1BX03 3.75e-12 72 27 6 253 3 Bcen_0943 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia orbicola (strain AU 1054)
A0K6Q0 2.53e-105 328 38 8 501 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
A0K6Q0 3.75e-12 72 27 6 253 3 Bcen2424_1425 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia cenocepacia (strain HI2424)
Q39HA1 3.8e-105 327 37 4 501 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39HA1 4.82e-12 72 26 3 222 3 Bcep18194_A4569 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1AXG5 4.76e-105 326 39 7 504 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AXG5 5.42e-18 90 26 5 244 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1MAA2 4.88e-105 327 38 7 510 3 RL4654 Putative ribose/galactose/methyl galactoside import ATP-binding protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MAA2 1.19e-12 73 26 3 225 3 RL4654 Putative ribose/galactose/methyl galactoside import ATP-binding protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2K353 1.64e-104 325 38 7 510 3 RHE_CH03989 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K353 3.96e-12 72 26 3 222 3 RHE_CH03989 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P04983 3.28e-104 324 37 7 509 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
Q0TAW0 3.28e-104 324 37 7 509 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9KN37 3.86e-104 324 37 6 505 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KN37 5.9e-16 84 29 6 231 3 rbsA Ribose import ATP-binding protein RbsA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q3YVK8 4.43e-104 324 37 7 509 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
Q65E55 4.68e-104 323 36 5 502 3 rbsA Ribose import ATP-binding protein RbsA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5WC31 5.07e-104 324 36 5 498 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 5.84e-13 74 25 3 232 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q1R4I3 5.86e-104 323 37 6 509 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q8UBN2 7.18e-104 323 38 8 515 3 Atu2819 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q57HW1 7.5e-104 323 38 9 507 3 rbsA Ribose import ATP-binding protein RbsA Salmonella choleraesuis (strain SC-B67)
Q8FBS3 7.66e-104 323 37 7 509 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q891M1 1.4e-103 323 34 4 504 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 8.64e-14 77 25 3 226 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q6LH11 1.58e-103 323 36 5 504 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q6LH11 1.14e-15 83 30 8 240 3 rbsA Ribose import ATP-binding protein RbsA Photobacterium profundum (strain SS9)
Q13LX0 1.99e-103 323 37 9 522 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q8NR12 2.37e-103 323 37 7 523 3 rbsA Ribose import ATP-binding protein RbsA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8XAW7 2.97e-103 322 37 7 509 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q8ZKV9 3.27e-103 322 38 9 507 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PJX5 6.16e-103 321 38 9 507 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q329G7 9.23e-103 320 38 6 501 3 rbsA Ribose import ATP-binding protein RbsA Shigella dysenteriae serotype 1 (strain Sd197)
Q8UAK2 1.51e-102 320 37 6 511 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UAK2 3.6e-11 69 25 5 229 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
P36947 2.34e-102 319 36 7 502 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
P36947 9.73e-16 83 26 3 238 3 rbsA Ribose import ATP-binding protein RbsA Bacillus subtilis (strain 168)
Q8E7N9 2.45e-102 319 35 4 498 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q8E7N9 1.17e-12 73 26 5 252 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype III (strain NEM316)
Q1ARR5 2.51e-102 319 36 5 504 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1ARR5 1.56e-13 76 27 6 251 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8Z2R4 2.65e-102 319 38 9 507 3 rbsA Ribose import ATP-binding protein RbsA Salmonella typhi
Q4QN44 2.75e-102 319 37 5 505 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
Q4QN44 6.96e-10 65 26 8 264 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain 86-028NP)
Q3K3R2 3e-102 319 35 4 498 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K3R2 4.59e-13 75 26 5 252 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q4ZRC6 3.89e-102 320 37 6 504 3 Psyr_3264 Putative ribose/galactose/methyl galactoside import ATP-binding protein Pseudomonas syringae pv. syringae (strain B728a)
Q8U9B0 5.31e-102 318 37 6 503 3 Atu3818 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8E281 2.26e-101 317 35 4 498 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E281 5.12e-12 71 25 5 252 3 rbsA Ribose import ATP-binding protein RbsA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q5E4V6 3.17e-101 317 37 6 504 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E4V6 1.01e-16 86 29 7 239 3 rbsA Ribose import ATP-binding protein RbsA Aliivibrio fischeri (strain ATCC 700601 / ES114)
P44735 4.44e-101 316 36 4 505 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44735 3.51e-10 65 26 8 264 3 rbsA Ribose import ATP-binding protein RbsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q399X3 8.57e-101 316 38 9 520 3 Bcep18194_B0624 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q21TR5 1.08e-100 315 40 9 505 3 Rfer_3129 Putative ribose/galactose/methyl galactoside import ATP-binding protein Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q87H79 2.24e-100 314 36 7 507 3 rbsA Ribose import ATP-binding protein RbsA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1BQ82 3.1e-100 314 40 11 517 3 Bcen_3328 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia orbicola (strain AU 1054)
A0B297 3.1e-100 314 40 11 517 3 Bcen2424_5039 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Burkholderia cenocepacia (strain HI2424)
Q2K204 3.66e-100 314 38 10 508 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K204 5.72e-11 68 26 6 251 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1BWN5 3.7e-100 314 39 13 529 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia orbicola (strain AU 1054)
A0K718 3.7e-100 314 39 13 529 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia cenocepacia (strain HI2424)
Q3JHZ1 5.27e-100 314 39 9 503 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q3JHZ1 1.35e-12 73 28 6 231 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia pseudomallei (strain 1710b)
Q39GY8 6.74e-100 313 38 13 528 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9WXX0 1.08e-99 313 35 6 515 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q63P06 1.33e-99 313 39 9 503 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q63P06 4.18e-13 75 28 6 231 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia pseudomallei (strain K96243)
Q2T8T6 1.89e-99 312 38 10 503 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T8T6 7.33e-12 71 27 6 231 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8D7T7 2.4e-99 311 35 4 505 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain CMCP6)
Q7MEV1 3.27e-99 311 36 4 505 3 rbsA Ribose import ATP-binding protein RbsA Vibrio vulnificus (strain YJ016)
Q9CP98 5.24e-99 311 36 7 508 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q9CP98 3.97e-10 65 24 4 245 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Pasteurella multocida (strain Pm70)
Q0B775 1.92e-98 310 38 9 517 3 Bamb_4447 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BFU0 4.75e-98 309 37 11 530 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q9X051 5.75e-98 309 35 10 531 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X051 6.87e-18 90 26 5 269 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1M5X4 1.52e-97 307 35 5 502 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 3.91e-17 87 29 5 237 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M5X4 5.73e-13 74 26 4 244 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2NUD6 1.03e-96 305 34 6 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Sodalis glossinidius (strain morsitans)
Q2NUD6 2.79e-12 72 23 5 246 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Sodalis glossinidius (strain morsitans)
Q2K0S7 2.02e-96 305 35 6 504 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K0S7 1.88e-12 73 26 4 244 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q0BGD7 2.29e-96 305 38 8 504 3 Bamb_1228 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8U949 2.66e-96 304 37 9 512 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92UI2 6.89e-96 303 35 7 510 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q92UI2 2.15e-15 82 29 5 252 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium meliloti (strain 1021)
Q03CA4 7.14e-96 303 36 8 502 3 rbsA Ribose import ATP-binding protein RbsA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q92S10 9.23e-96 302 34 6 510 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q92S10 1.46e-10 67 27 5 239 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium meliloti (strain 1021)
Q8RBQ1 1.61e-95 302 34 6 504 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RBQ1 6.64e-16 84 27 4 231 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RBQ1 1.46e-12 73 25 7 250 3 TTE0763 Putative ribose/galactose/methyl galactoside import ATP-binding protein Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q11C01 7.21e-95 300 35 6 509 3 rbsA Ribose import ATP-binding protein RbsA Chelativorans sp. (strain BNC1)
Q2SJ99 1.5e-94 299 36 7 517 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q2SJ99 3.17e-12 72 27 5 226 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q7NA79 2.07e-94 299 36 7 508 3 rbsA Ribose import ATP-binding protein RbsA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1BGC0 2.19e-94 299 37 7 506 3 Bcen_6474 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia orbicola (strain AU 1054)
A0KE25 2.19e-94 299 37 7 506 3 Bcen2424_6709 Putative ribose/galactose/methyl galactoside import ATP-binding protein 3 Burkholderia cenocepacia (strain HI2424)
Q2KAW9 2.69e-94 299 35 5 509 3 RHE_CH01212 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6BEX0 7.13e-94 298 35 8 509 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
Q6BEX0 8.63e-12 71 26 4 247 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
Q6BEX0 3.53e-10 65 24 5 233 1 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli (strain K12)
P63299 8.11e-94 297 35 8 509 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
P63299 9.1e-12 70 26 4 247 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
P63299 3.56e-10 65 24 5 233 3 ytfR Galactofuranose transporter ATP-binding protein YtfR Escherichia coli O157:H7
Q7NTN6 1.05e-93 297 36 7 513 3 rbsA Ribose import ATP-binding protein RbsA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P32721 1.42e-93 297 34 7 515 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
P32721 5.46e-08 58 24 5 256 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
Q6LUY1 4.01e-93 296 35 7 514 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LUY1 6.75e-11 68 26 4 221 3 xylG Xylose import ATP-binding protein XylG Photobacterium profundum (strain SS9)
Q6LK34 4.55e-93 295 36 7 510 3 mglA1 Galactose/methyl galactoside import ATP-binding protein MglA 1 Photobacterium profundum (strain SS9)
Q6LK34 4.41e-11 68 24 4 226 3 mglA1 Galactose/methyl galactoside import ATP-binding protein MglA 1 Photobacterium profundum (strain SS9)
Q31YV7 6.94e-93 295 33 6 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella boydii serotype 4 (strain Sb227)
Q31YV7 7.39e-14 77 24 6 271 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella boydii serotype 4 (strain Sb227)
Q322L1 1.87e-92 294 36 10 498 3 araG Arabinose import ATP-binding protein AraG Shigella boydii serotype 4 (strain Sb227)
Q0TGT7 2.06e-92 294 36 10 498 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3JNJ9 4.52e-92 293 35 9 498 3 araG Arabinose import ATP-binding protein AraG Burkholderia pseudomallei (strain 1710b)
Q3Z057 4.91e-92 293 34 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella sonnei (strain Ss046)
Q3Z057 1.43e-13 76 24 6 271 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella sonnei (strain Ss046)
P0AAG9 4.91e-92 293 34 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri
P0AAG9 1.43e-13 76 24 6 271 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri
Q0T2X5 4.91e-92 293 34 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri serotype 5b (strain 8401)
Q0T2X5 2.31e-13 75 24 6 271 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Shigella flexneri serotype 5b (strain 8401)
P0AAG8 4.91e-92 293 34 7 506 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain K12)
P0AAG8 1.43e-13 76 24 6 271 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain K12)
P0AAF3 4.95e-92 293 36 10 498 1 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain K12)
P0AAF4 4.95e-92 293 36 10 498 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF5 4.95e-92 293 36 10 498 3 araG Arabinose import ATP-binding protein AraG Escherichia coli O157:H7
Q32HC7 5.06e-92 293 36 10 498 3 araG Arabinose import ATP-binding protein AraG Shigella dysenteriae serotype 1 (strain Sd197)
Q63QQ7 5.78e-92 293 35 9 498 3 araG Arabinose import ATP-binding protein AraG Burkholderia pseudomallei (strain K96243)
Q66C83 7.37e-92 292 33 9 511 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66C83 1.96e-12 73 24 3 224 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGT1 7.37e-92 292 33 9 511 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CGT1 1.96e-12 73 24 3 224 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CHQ3 7.37e-92 292 33 9 511 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis
Q7CHQ3 1.96e-12 73 24 3 224 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis
Q1C9V1 7.37e-92 292 33 9 511 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C9V1 1.96e-12 73 24 3 224 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Yersinia pestis bv. Antiqua (strain Antiqua)
Q6VMN4 7.41e-92 292 34 8 514 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q6VMN4 2.89e-10 66 23 8 253 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8FFU7 8.38e-92 292 34 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FFU7 1.55e-13 76 24 6 271 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFU2 8.38e-92 292 34 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TFU2 1.55e-13 76 24 6 271 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RAN8 9.71e-92 292 36 10 498 3 araG Arabinose import ATP-binding protein AraG Escherichia coli (strain UTI89 / UPEC)
Q3Z2S7 1.22e-91 292 36 10 498 3 araG Arabinose import ATP-binding protein AraG Shigella sonnei (strain Ss046)
Q2RGX2 1.26e-91 292 35 8 510 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RGX2 1.7e-14 79 26 9 234 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q8X5D9 1.53e-91 291 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O157:H7
Q8X5D9 1.11e-13 77 24 6 271 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli O157:H7
Q0TQU8 2.61e-91 291 35 10 503 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TQU8 5.52e-16 84 23 5 243 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q2SZC2 2.93e-91 291 36 10 499 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8XKQ2 4.7e-91 291 35 10 503 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q8XKQ2 4.75e-16 84 23 5 243 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
P23924 5.68e-91 290 33 8 506 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23924 3.36e-14 78 25 8 267 1 mglA Galactose/methyl galactoside import ATP-binding protein MglA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8UA86 5.82e-91 290 34 6 505 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA86 1.55e-16 85 28 3 236 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q987E7 9.74e-91 290 36 8 500 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q987E7 2.12e-13 76 26 4 223 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q83KP2 1.13e-90 289 36 10 498 3 araG Arabinose import ATP-binding protein AraG Shigella flexneri
Q663Y5 1.22e-90 290 35 8 518 3 xylG Xylose import ATP-binding protein XylG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CDC0 1.22e-90 290 35 8 518 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CFR2 1.22e-90 290 35 8 518 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis
Q1C0D5 1.22e-90 290 35 8 518 3 xylG Xylose import ATP-binding protein XylG Yersinia pestis bv. Antiqua (strain Antiqua)
Q6LG59 1.27e-90 289 33 8 503 3 mglA2 Galactose/methyl galactoside import ATP-binding protein MglA 2 Photobacterium profundum (strain SS9)
Q6LG59 4.92e-11 68 23 4 224 3 mglA2 Galactose/methyl galactoside import ATP-binding protein MglA 2 Photobacterium profundum (strain SS9)
Q8D4H4 1.33e-90 289 33 8 505 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain CMCP6)
Q8D4H4 5.79e-10 65 22 5 229 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain CMCP6)
Q1R9S4 1.72e-90 289 33 7 506 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain UTI89 / UPEC)
Q1R9S4 1.73e-13 76 24 6 271 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Escherichia coli (strain UTI89 / UPEC)
Q7MG07 1.85e-90 289 33 8 505 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain YJ016)
Q7MG07 5.84e-10 65 22 5 229 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio vulnificus (strain YJ016)
Q62GY9 2.28e-90 288 35 9 498 3 araG Arabinose import ATP-binding protein AraG Burkholderia mallei (strain ATCC 23344)
Q3J3V9 2.72e-90 288 36 12 500 3 rbsA Ribose import ATP-binding protein RbsA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q164K3 2.75e-90 288 34 6 503 3 rbsA Ribose import ATP-binding protein RbsA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0ST95 2.98e-90 288 34 10 503 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q0ST95 3.5e-15 81 22 5 243 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain SM101 / Type A)
Q7UU57 3.41e-90 288 35 7 509 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UU57 4.88e-13 75 24 6 253 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UU57 7.97e-11 68 26 4 224 3 rbsA Ribose import ATP-binding protein RbsA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q65WJ1 8.71e-90 287 33 8 506 3 araG Arabinose import ATP-binding protein AraG Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q39BJ8 1.22e-89 287 34 9 513 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39BJ8 3.64e-14 78 25 3 239 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BIE1 1.65e-89 286 35 8 503 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q896Y2 1.98e-89 286 33 9 516 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q896Y2 8.53e-15 80 25 4 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q896Y2 1.53e-13 76 25 4 228 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium tetani (strain Massachusetts / E88)
Q73KK2 3.31e-89 285 33 7 500 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q39JR1 3.36e-89 285 35 10 501 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39JR1 2.03e-15 82 25 4 240 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1JUP7 3.45e-89 286 34 8 507 3 araG Arabinose import ATP-binding protein AraG Azospirillum brasilense
Q1JUP7 1.22e-12 73 24 3 235 3 araG Arabinose import ATP-binding protein AraG Azospirillum brasilense
Q13U53 5.88e-89 285 34 8 523 3 araG Arabinose import ATP-binding protein AraG Paraburkholderia xenovorans (strain LB400)
Q13U53 3.08e-16 85 28 5 229 3 araG Arabinose import ATP-binding protein AraG Paraburkholderia xenovorans (strain LB400)
Q2SW38 6.24e-89 285 35 10 523 3 xylG Xylose import ATP-binding protein XylG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0B1U4 1.06e-88 285 35 10 527 3 xylG Xylose import ATP-binding protein XylG Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8REE1 1.21e-88 284 32 8 511 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8REE1 1.59e-12 73 23 5 241 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q3K8M7 1.5e-88 284 34 8 515 3 araG Arabinose import ATP-binding protein AraG Pseudomonas fluorescens (strain Pf0-1)
Q1BG93 1.63e-88 284 36 10 519 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
A0KE53 1.63e-88 284 36 10 519 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
Q87FK7 1.89e-88 284 34 8 496 3 araG Arabinose import ATP-binding protein AraG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q92MP8 2.34e-88 283 38 9 509 3 R02565 Putative ribose/galactose/methyl galactoside import ATP-binding protein 1 Rhizobium meliloti (strain 1021)
Q9KSD1 2.98e-88 283 32 8 503 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KSD1 3.81e-11 68 23 5 229 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1BJW2 5.54e-88 283 34 10 508 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
Q1BJW2 2.75e-12 72 23 3 235 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia orbicola (strain AU 1054)
A0B3Z7 5.54e-88 283 34 10 508 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
A0B3Z7 2.75e-12 72 23 3 235 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia cenocepacia (strain HI2424)
Q398W2 8.59e-88 282 37 8 509 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q48IS7 8.83e-88 282 35 9 516 3 araG Arabinose import ATP-binding protein AraG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6DB03 1.54e-87 281 35 11 522 3 xylG Xylose import ATP-binding protein XylG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1BZA2 1.69e-87 281 34 8 497 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia orbicola (strain AU 1054)
Q1BZA2 9.71e-15 80 26 5 223 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia orbicola (strain AU 1054)
A0K4E8 1.69e-87 281 34 8 497 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia cenocepacia (strain HI2424)
A0K4E8 9.71e-15 80 26 5 223 3 araG1 Arabinose import ATP-binding protein AraG 1 Burkholderia cenocepacia (strain HI2424)
Q882I8 2.7e-87 281 35 9 508 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8XVS2 3.77e-87 280 35 7 510 3 araG Arabinose import ATP-binding protein AraG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XVS2 8.4e-14 77 27 7 241 3 araG Arabinose import ATP-binding protein AraG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0B5V4 4.25e-87 280 34 9 508 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B5V4 8.51e-13 74 24 3 239 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q6D4W8 5.41e-87 280 34 7 505 3 araG Arabinose import ATP-binding protein AraG Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4ZTW1 6.15e-87 280 34 9 516 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. syringae (strain B728a)
P44884 7.81e-87 280 31 8 508 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44884 6.38e-12 71 22 4 255 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QM77 7.81e-87 280 31 8 508 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain 86-028NP)
Q4QM77 6.38e-12 71 22 4 255 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Haemophilus influenzae (strain 86-028NP)
Q13RB6 2.41e-86 278 34 9 522 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
Q66AF5 3.39e-86 278 36 11 513 3 araG Arabinose import ATP-binding protein AraG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CIX6 3.39e-86 278 36 11 513 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WER5 3.39e-86 278 36 11 513 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis
Q1C7J0 3.39e-86 278 36 11 513 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Antiqua)
Q88J90 7.02e-86 277 35 10 516 3 rbsA Ribose import ATP-binding protein RbsA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q56342 7.13e-86 276 32 7 505 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q8G847 9.31e-86 277 34 8 497 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 1.15e-14 80 25 4 224 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q83J33 1.32e-85 276 35 11 513 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q28P50 1.51e-85 276 32 5 508 3 rbsA Ribose import ATP-binding protein RbsA Jannaschia sp. (strain CCS1)
Q9S472 1.82e-85 276 34 10 516 3 araG L-arabinose transport ATP-binding protein AraG Geobacillus stearothermophilus
Q9S472 4.3e-08 59 25 5 236 3 araG L-arabinose transport ATP-binding protein AraG Geobacillus stearothermophilus
Q1R528 8.71e-85 274 35 11 513 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q1R528 1.69e-11 70 27 6 233 3 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain UTI89 / UPEC)
Q576H3 8.9e-85 274 33 8 507 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q576H3 9.6e-15 80 28 6 257 3 xylG Xylose import ATP-binding protein XylG Brucella abortus biovar 1 (strain 9-941)
Q2YJE7 8.9e-85 274 33 8 507 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q2YJE7 9.6e-15 80 28 6 257 3 xylG Xylose import ATP-binding protein XylG Brucella abortus (strain 2308)
Q1BPL3 1.31e-84 274 36 6 504 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia orbicola (strain AU 1054)
A0B1M7 1.31e-84 274 36 6 504 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia cenocepacia (strain HI2424)
Q0B7X0 1.82e-84 273 35 7 512 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q31V51 1.98e-84 273 35 11 513 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q31V51 1.55e-11 70 27 6 233 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8XDM1 1.98e-84 273 35 11 513 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8XDM1 1.55e-11 70 27 6 233 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q9CM08 2.03e-84 273 31 7 504 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Pasteurella multocida (strain Pm70)
Q9CM08 2.28e-10 66 24 9 256 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Pasteurella multocida (strain Pm70)
Q0SY86 2.39e-84 273 35 11 513 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q0SY86 4.32e-12 72 28 8 235 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q8FCE2 2.47e-84 273 35 12 515 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCE2 1.59e-11 70 27 6 233 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 2.47e-84 273 35 12 515 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBN5 1.59e-11 70 27 6 233 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q65UW1 3.31e-84 273 31 8 514 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UW1 3.05e-08 59 22 5 225 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2T4S8 5.19e-84 273 33 6 506 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4S8 5.5e-14 78 26 5 239 3 araG2 Arabinose import ATP-binding protein AraG 2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P37388 5.79e-84 272 35 11 513 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
P37388 4.68e-11 68 26 6 233 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q2SVU4 6.47e-84 272 36 7 509 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8YDN0 1.26e-83 271 32 8 507 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YDN0 2.41e-14 79 28 6 257 3 xylG Xylose import ATP-binding protein XylG Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q0I348 1.85e-83 271 34 9 512 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q0I348 1.47e-13 76 27 6 236 3 xylG Xylose import ATP-binding protein XylG Histophilus somni (strain 129Pt)
Q1MBG4 4.73e-83 270 33 11 503 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MBG4 1.55e-13 76 27 5 228 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
D4GPW3 4.75e-83 271 34 10 539 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GPW3 4.75e-15 81 26 5 230 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GPW3 1.2e-12 73 29 4 247 3 tsgD13 Glucose import ATP-binding protein TsgD13 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q8FUR8 7.27e-83 269 33 8 507 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
Q8FUR8 7.85e-13 74 27 6 257 3 xylG Xylose import ATP-binding protein XylG Brucella suis biovar 1 (strain 1330)
P45046 6.36e-82 266 33 6 505 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45046 3.94e-14 78 27 6 240 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8XPK6 1.19e-81 266 34 10 516 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XPK6 1.08e-14 80 29 6 243 3 xylG Xylose import ATP-binding protein XylG Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q880Z2 2.54e-81 266 35 10 510 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q880Z2 4.03e-14 78 28 4 231 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q62K91 2.89e-81 265 36 8 513 3 rbsA Ribose import ATP-binding protein RbsA Burkholderia mallei (strain ATCC 23344)
Q2K3Y7 1.05e-80 263 32 9 502 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1MHS1 1.43e-80 263 33 8 503 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MHS1 1.44e-11 70 25 10 263 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q5KYS1 1.47e-80 263 32 9 511 3 xylG Xylose import ATP-binding protein XylG Geobacillus kaustophilus (strain HTA426)
Q4ZSF3 8.75e-80 261 34 8 505 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. syringae (strain B728a)
Q4ZSF3 2.37e-14 79 28 4 231 3 xylG Xylose import ATP-binding protein XylG Pseudomonas syringae pv. syringae (strain B728a)
Q48J74 9.32e-80 261 34 10 509 3 xylG Xylose import ATP-binding protein XylG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48J74 5.66e-13 74 27 4 231 3 xylG Xylose import ATP-binding protein XylG Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1QYT1 1.22e-79 260 34 9 488 3 araG Arabinose import ATP-binding protein AraG Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1QYT1 2.69e-14 79 24 4 225 3 araG Arabinose import ATP-binding protein AraG Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q92W56 1.56e-79 260 31 10 519 3 araG Arabinose import ATP-binding protein AraG Rhizobium meliloti (strain 1021)
Q9K7C3 2.46e-79 260 32 7 501 3 araG L-arabinose transport ATP-binding protein AraG Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3KDW2 1.61e-78 258 34 7 516 3 xylG Xylose import ATP-binding protein XylG Pseudomonas fluorescens (strain Pf0-1)
Q3JSI8 1.94e-77 263 36 8 513 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Burkholderia pseudomallei (strain 1710b)
O05253 1.91e-76 253 33 8 497 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 7.88e-14 77 26 6 232 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 1.34e-07 57 25 3 238 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
Q98K15 3.64e-75 249 33 7 500 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98K15 9.53e-08 58 24 3 221 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P77509 8.69e-75 248 34 15 504 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
P77509 4.39e-09 62 26 4 225 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
Q2K9A3 6.47e-73 243 32 8 501 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K9A3 8.04e-08 58 26 8 245 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A2RKA7 3.57e-68 231 32 9 488 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
P55570 3.49e-63 217 33 16 507 3 NGR_a02480 Uncharacterized ABC transporter ATP-binding protein y4mK Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P75516 4.22e-63 219 30 11 559 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75516 2.2e-09 63 25 5 247 3 MPN_258 Putative carbohydrate transport ATP-binding protein MPN_258 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47365 2.4e-60 211 29 10 556 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47365 1.08e-08 61 26 4 228 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9F9B0 1.58e-33 131 31 3 254 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
Q9F9B0 3.93e-09 61 25 7 233 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
P0DTT6 2.62e-32 127 31 3 240 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P0DTT6 3.24e-14 75 23 2 228 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q0S0Z3 3.91e-31 126 32 4 219 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0S0Z3 6.77e-14 76 27 3 204 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0SBZ1 8.61e-31 125 33 4 219 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q0SBZ1 7.38e-13 73 26 3 204 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q8XK20 2.02e-29 125 25 14 513 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 2.37e-11 69 26 5 218 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
A9CKL2 2.41e-29 125 28 21 531 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 2.21e-10 66 29 8 214 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0RYP7 6.56e-29 120 31 4 219 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q0RYP7 1.45e-12 72 26 3 204 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q3KCC5 1.67e-28 119 34 5 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q3KCC5 3.42e-09 62 26 6 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q81CT8 3.4e-28 121 22 15 529 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HI76 3.99e-28 121 23 15 528 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q49WM4 4.75e-28 118 29 4 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49WM4 9.59e-10 63 22 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L5B3 5.61e-28 118 32 8 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q4L5B3 3.12e-07 56 22 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q39GT7 1.1e-27 116 31 3 230 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 8.98e-14 75 29 5 220 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8DUF7 3.54e-27 116 32 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DUF7 1.37e-11 69 23 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q58663 4.81e-27 113 28 1 233 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58663 2.1e-07 55 31 0 86 1 livG Probable branched-chain amino acid transport ATP-binding protein LivG Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8ES39 4.96e-27 117 24 14 505 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 2.1e-10 66 23 2 214 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q04G50 5.96e-27 115 31 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04G50 3.34e-09 62 21 7 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q5JEB0 9.09e-27 114 31 5 222 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JEB0 5.79e-15 79 33 6 208 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8PUE7 1.93e-26 115 25 16 477 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 2.82e-13 75 27 6 225 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q1J6Q6 1.98e-26 114 32 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1J6Q6 4.25e-13 74 23 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 1.98e-26 114 32 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JGY7 4.25e-13 74 23 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 1.98e-26 114 32 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JLT7 4.25e-13 74 23 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 1.98e-26 114 32 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JBV6 4.25e-13 74 23 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XCA4 2.14e-26 114 32 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5XCA4 3.45e-13 74 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ35 2.4e-26 114 32 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ35 3.01e-13 75 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 2.4e-26 114 32 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q48TP4 3.01e-13 75 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 2.4e-26 114 32 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0CZ34 3.01e-13 75 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q7CN92 2.42e-26 114 32 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7CN92 4.95e-13 74 23 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 2.42e-26 114 32 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q99ZS8 4.95e-13 74 23 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
P37624 3.33e-26 116 24 13 502 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q8G838 3.74e-26 116 28 17 499 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 1.37e-12 73 27 8 241 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q1BWI2 3.78e-26 111 30 2 222 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 2.96e-13 73 29 5 222 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q8DZJ0 3.99e-26 113 32 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DZJ0 3.74e-13 74 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 3.99e-26 113 32 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q8E554 3.74e-13 74 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 3.99e-26 113 32 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K0Y6 3.74e-13 74 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P44531 4.07e-26 112 30 3 222 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44531 1.11e-11 69 26 6 207 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23703 4.21e-26 112 32 5 216 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 1.13e-11 69 29 7 210 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q72FW5 5.45e-26 112 31 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72FW5 1.15e-12 73 27 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
O28881 5.79e-26 110 26 2 228 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28881 9.12e-05 47 21 6 227 3 livG Probable branched-chain amino acid transport ATP-binding protein LivG Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q03ZQ0 7.62e-26 112 32 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZQ0 1.09e-10 67 23 4 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q5HQ70 7.74e-26 112 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HQ70 4.93e-09 62 21 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q32EY4 8.93e-26 112 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q32EY4 8.17e-11 67 25 6 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q1RD28 1.01e-25 112 32 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
Q1RD28 1.23e-10 67 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.01e-25 112 32 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
A1AA20 1.23e-10 67 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q92WJ0 1.02e-25 111 30 3 218 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q92WJ0 7.6e-12 70 27 5 222 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8KLG1 1.06e-25 110 32 3 206 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 1.18e-14 78 31 7 207 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8TQW9 1.07e-25 114 24 15 486 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQW9 6.22e-17 87 27 4 226 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8XXY9 1.12e-25 110 31 4 230 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 1.44e-13 75 29 5 223 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8ELR4 1.13e-25 111 28 7 273 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ELR4 9.65e-13 73 20 4 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P69877 1.28e-25 111 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69877 1.24e-10 67 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.28e-25 111 33 6 224 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69874 1.24e-10 67 24 5 204 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.28e-25 111 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69875 1.24e-10 67 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.28e-25 111 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIU8 1.24e-10 67 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.28e-25 111 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
P69876 1.24e-10 67 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q8U4K3 1.34e-25 111 31 5 222 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4K3 2.18e-13 75 29 7 217 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P21410 2.08e-25 110 35 5 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
P21410 3.51e-10 65 27 6 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q3JSQ0 2.15e-25 109 30 3 221 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 3.8e-13 73 29 5 226 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 2.15e-25 109 30 3 221 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 3.8e-13 73 29 5 226 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 2.22e-25 109 30 3 221 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 3.56e-13 73 29 5 226 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q6MCV4 2.4e-25 110 32 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q6MCV4 2.89e-11 68 25 5 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
P96063 2.57e-25 110 34 5 211 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P96063 5.96e-10 64 25 6 210 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5L222 2.63e-25 110 31 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 1.77e-12 72 22 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q1GB17 2.96e-25 110 32 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1GB17 4.55e-10 65 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P94440 3.16e-25 109 28 3 232 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 4.21e-13 73 27 6 221 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P40790 4.2e-25 110 32 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40790 1.61e-10 66 24 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 4.2e-25 110 32 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q57QC8 1.61e-10 66 24 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q87G35 4.52e-25 112 24 16 515 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 1.65e-14 79 25 10 286 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2SVP3 4.63e-25 108 30 3 221 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 1.43e-14 78 30 5 226 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P56344 5.05e-25 106 31 3 217 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P56344 1.76e-09 61 22 5 216 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q8Z7H7 5.09e-25 110 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q8Z7H7 1.8e-10 66 24 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q57SD6 5.26e-25 109 32 6 224 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q57SD6 1.1e-09 63 24 6 210 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q8CPN0 5.33e-25 109 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CPN0 2.81e-08 59 20 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q3Z2Z3 5.39e-25 110 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q3Z2Z3 6.19e-11 67 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 5.39e-25 110 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q31ZK0 6.19e-11 67 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q0T5R2 5.87e-25 109 33 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q0T5R2 2.21e-10 66 24 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q5PMK1 5.87e-25 109 33 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PMK1 1.53e-10 66 24 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q73R11 5.99e-25 111 25 16 504 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q38VW6 6.73e-25 109 31 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q38VW6 8.66e-12 70 22 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q04BG2 6.82e-25 109 32 4 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q04BG2 7e-10 64 22 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1B8V9 7.48e-25 109 30 7 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
Q1B8V9 4.22e-09 62 24 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 7.48e-25 109 30 7 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
A1UG51 4.22e-09 62 24 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q57293 8e-25 108 29 3 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q57293 1.34e-13 75 26 6 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q6F0V4 9.35e-25 108 33 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q6F0V4 1.05e-11 70 24 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q5PFQ7 9.88e-25 108 33 5 211 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PFQ7 5.07e-10 65 25 6 210 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1TXH7 9.88e-25 109 31 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TXH7 7.53e-09 61 24 4 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8Z8W8 1.07e-24 108 33 5 211 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q8Z8W8 5.7e-10 64 25 6 210 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
P9WQM1 1.38e-24 108 32 4 210 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM1 1.59e-10 66 25 6 214 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 1.38e-24 108 32 4 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQM0 1.59e-10 66 25 6 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 1.38e-24 108 32 4 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4W3 1.59e-10 66 25 6 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q14Q07 1.48e-24 108 28 6 287 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 9.55e-10 63 23 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
A3CMQ7 1.58e-24 108 31 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
A3CMQ7 2.11e-13 75 25 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
P45073 1.98e-24 105 28 4 236 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45073 1.43e-18 88 28 5 225 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6LR20 2.23e-24 108 28 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q6LR20 8.35e-08 58 24 5 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q5FA19 2.28e-24 107 35 6 214 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 1.03e-12 73 27 7 231 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q668Q3 2.31e-24 107 32 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668Q3 4.01e-11 68 27 5 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8DPC2 2.38e-24 108 31 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DPC2 3.35e-13 74 23 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 2.38e-24 108 31 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97Q42 3.35e-13 74 23 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 2.38e-24 108 31 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04JW0 3.35e-13 74 23 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1CJS9 2.52e-24 107 32 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJS9 4.01e-11 68 27 5 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 2.52e-24 107 32 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q8ZCM2 4.01e-11 68 27 5 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 2.52e-24 107 32 4 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C607 4.01e-11 68 27 5 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
P31134 2.81e-24 107 29 5 241 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P31134 9.3e-11 67 24 5 224 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q5FL41 2.93e-24 107 31 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5FL41 2.12e-08 59 20 4 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q73XU8 2.97e-24 107 32 4 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73XU8 1.32e-09 63 25 6 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9CM80 3.65e-24 107 28 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q9CM80 1.15e-12 72 26 6 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q57RB2 3.69e-24 110 26 20 521 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q57RB2 3.69e-16 85 28 7 241 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q57RB2 7.46e-10 65 25 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q0AGF4 3.86e-24 107 29 4 251 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0AGF4 5.51e-09 61 25 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q02R79 4.5e-24 107 28 5 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02R79 1.99e-16 84 30 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HY19 4.5e-24 107 28 5 259 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HY19 2.19e-16 84 30 6 219 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5PGP3 4.71e-24 109 26 20 521 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGP3 4.62e-15 81 27 7 241 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGP3 5.9e-10 65 25 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q7NWX3 4.79e-24 107 32 6 223 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 1.36e-12 72 30 7 203 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q03JH1 5.26e-24 107 31 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q03JH1 1.27e-13 76 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
P0A9S9 5.48e-24 104 30 5 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S9 9.65e-12 68 27 5 213 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 5.48e-24 104 30 5 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S7 9.65e-12 68 27 5 213 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 5.48e-24 104 30 5 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
P0A9S8 9.65e-12 68 27 5 213 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
P24693 5.57e-24 103 29 2 230 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P24693 3.08e-10 63 25 3 216 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
Q8ZQM4 5.69e-24 109 26 20 521 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQM4 4.16e-15 81 27 7 241 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQM4 6.96e-10 65 25 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5M397 5.95e-24 107 31 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M397 1.12e-13 76 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q6D4E2 6.04e-24 107 31 5 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4E2 2.22e-09 63 23 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5LYN4 6.18e-24 107 31 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5LYN4 1.15e-13 76 24 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q578K3 6.2e-24 106 29 4 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q578K3 1.18e-10 66 26 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 6.2e-24 106 29 4 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q2YKX3 1.18e-10 66 26 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q8FYU9 6.21e-24 103 30 6 244 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 6.21e-24 103 30 6 244 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8NSN2 6.62e-24 106 32 4 220 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NSN2 1.64e-15 81 26 6 224 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q74K65 6.84e-24 106 30 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74K65 5.2e-11 67 21 4 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q4KC87 7.99e-24 106 33 4 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KC87 1.33e-09 63 26 5 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P25885 8.65e-24 104 27 2 244 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
P25885 2.6e-17 85 28 3 207 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
O85818 8.95e-24 106 29 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
O85818 2.52e-12 72 24 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q9CP06 9.58e-24 106 28 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9CP06 5.41e-12 70 23 7 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q2K8C8 1.05e-23 105 30 6 245 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K8C8 2.71e-10 65 26 4 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7MKU3 1.24e-23 105 27 3 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q7MKU3 2.64e-08 59 24 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 1.24e-23 105 27 3 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8D9J4 2.64e-08 59 24 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
P72335 1.38e-23 104 30 2 206 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 1.47e-12 72 29 4 206 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P33982 1.41e-23 103 28 1 215 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P33982 9.36e-18 87 29 4 211 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q1LKJ2 1.46e-23 104 30 3 227 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 2.27e-12 71 28 5 214 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P45171 1.55e-23 105 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45171 4.45e-13 74 24 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8YCG3 1.64e-23 105 29 4 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YCG3 4.94e-11 67 26 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q0I2Z4 1.72e-23 105 27 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q0I2Z4 4.54e-13 73 27 6 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q88ZJ6 1.89e-23 105 33 6 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZJ6 1.11e-14 79 24 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7N6Z2 1.94e-23 105 33 4 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N6Z2 2.66e-11 68 25 5 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9KS33 1.97e-23 105 28 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KS33 3.14e-09 62 24 5 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0A191 2.08e-23 102 25 2 232 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A191 1.06e-13 74 27 5 204 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A192 2.08e-23 102 25 2 232 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
P0A192 1.06e-13 74 27 5 204 3 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Salmonella typhi
Q8Z864 2.09e-23 107 26 20 521 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8Z864 7.06e-15 81 27 7 241 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8Z864 7.14e-10 65 25 7 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q1QE80 2.1e-23 105 31 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QE80 1.47e-11 69 25 4 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q65S66 2.54e-23 104 28 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65S66 1.82e-13 75 27 6 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q81GC1 2.62e-23 104 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GC1 4.97e-10 64 26 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8GNH6 3.03e-23 103 31 3 205 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 1.54e-12 72 27 7 238 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q7NQN5 3.94e-23 104 30 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NQN5 4.57e-11 68 28 5 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8U6M1 5.7e-23 103 28 7 276 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U6M1 2.7e-11 68 27 4 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6NJ07 5.74e-23 103 30 7 262 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6NJ07 4.17e-14 77 29 6 207 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q7AH43 5.89e-23 103 27 4 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q7AH43 2.34e-13 75 28 5 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
P33916 6.24e-23 105 26 20 507 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 6.18e-11 68 28 9 225 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
Q30V33 6.76e-23 103 29 4 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q30V33 3.21e-14 77 27 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1WVI7 7.68e-23 103 31 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q1WVI7 6.39e-16 82 24 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q4QK57 7.99e-23 103 27 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q4QK57 9.21e-14 76 25 7 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q9X196 8.81e-23 103 29 3 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X196 4.77e-11 68 23 5 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q042G7 9.67e-23 103 31 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q042G7 2.1e-10 66 21 4 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q18AM3 1.07e-22 102 30 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q18AM3 3.27e-10 65 22 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
P74548 1.07e-22 102 34 6 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74548 4.46e-10 65 26 6 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8FVV5 1.09e-22 102 29 4 237 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q8FVV5 4.95e-10 64 26 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q87PH3 1.1e-22 103 28 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87PH3 2.88e-08 59 24 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q82TL6 1.17e-22 102 29 5 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82TL6 1.73e-10 66 24 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7A169 1.17e-22 102 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q7A169 9.86e-06 51 20 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 1.17e-22 102 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GAB5 9.86e-06 51 20 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 1.17e-22 102 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q6GHY6 9.86e-06 51 20 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 1.17e-22 102 30 4 238 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q7A679 9.86e-06 51 20 3 195 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 1.17e-22 102 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99V03 9.86e-06 51 20 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 1.17e-22 102 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q5HGY5 9.86e-06 51 20 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 1.17e-22 102 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YX74 9.86e-06 51 20 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 1.17e-22 102 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2G2A7 9.86e-06 51 20 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 1.17e-22 102 30 4 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q2FHY1 9.86e-06 51 20 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
O86751 1.2e-22 102 35 5 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O86751 1.46e-12 72 32 7 193 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9I6T2 1.27e-22 102 29 3 214 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6T2 1.91e-09 63 25 8 228 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6HLQ9 1.34e-22 102 29 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HLQ9 8.26e-10 63 26 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
P14788 1.4e-22 102 34 8 218 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14788 4.86e-11 67 25 6 229 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5E586 1.41e-22 102 28 3 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E586 1.23e-09 63 25 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1DDP4 1.42e-22 102 29 5 229 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q1DDP4 1.71e-10 65 28 5 208 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q6D2F6 1.42e-22 102 32 5 212 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D2F6 3.14e-11 68 27 5 193 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O28882 1.43e-22 99 29 3 208 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O28882 0.000136 47 23 7 206 3 livF Probable branched-chain amino acid transport ATP-binding protein LivF Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8PSR0 1.45e-22 104 24 16 541 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PSR0 1.09e-16 86 28 4 210 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q63E84 1.47e-22 102 29 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q63E84 7.08e-10 64 26 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 1.47e-22 102 29 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73BM0 7.08e-10 64 26 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 1.47e-22 102 29 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
A0RBB0 7.08e-10 64 26 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q03PF2 1.52e-22 102 30 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PF2 6.5e-15 80 26 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q4W575 1.74e-22 102 34 6 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 7.48e-12 70 26 7 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.74e-22 102 34 6 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 7.48e-12 70 26 7 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P21629 1.79e-22 100 29 4 253 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P21629 1.63e-13 73 27 5 210 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1TAI4 1.8e-22 102 30 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1TAI4 3.08e-06 53 23 5 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q57BC2 1.83e-22 99 30 6 244 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 1.83e-22 99 30 6 244 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q830W6 1.86e-22 102 29 6 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q830W6 2.22e-14 78 22 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q81TH8 2.33e-22 101 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q81TH8 1.2e-09 63 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q0SFY5 2.58e-22 101 28 5 256 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
Q0SFY5 4.94e-10 64 30 5 209 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
P37009 2.71e-22 101 28 4 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P37009 1.63e-12 72 27 6 204 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q60AI1 2.83e-22 102 30 3 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q60AI1 1.19e-10 67 25 3 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1M7W6 3.1e-22 100 31 5 221 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 1.84e-12 71 27 3 208 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2YAD6 3.81e-22 101 31 7 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2YAD6 6.61e-10 64 27 4 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
D4GSY7 3.98e-22 99 28 6 243 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GSY7 1.72e-06 53 24 6 232 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q13ZJ1 4.44e-22 100 29 5 232 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 2.64e-11 68 31 6 222 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q6LKD4 5.34e-22 100 27 3 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q6LKD4 1.08e-13 75 27 8 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
A3DDF6 5.47e-22 100 30 4 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DDF6 3.32e-07 56 23 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q03A07 5.73e-22 100 30 6 243 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03A07 9.25e-12 70 26 6 215 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P26050 6.67e-22 99 29 2 205 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 3.33e-10 65 28 5 212 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1MA70 7.08e-22 100 32 4 194 3 modC Molybdenum import ATP-binding protein ModC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MA70 9.32e-07 54 27 7 197 3 modC Molybdenum import ATP-binding protein ModC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8NR42 7.21e-22 98 30 5 218 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NR42 4.34e-10 63 28 8 217 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P22731 7.26e-22 97 24 2 230 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
P22731 3.62e-14 75 27 5 209 1 livF High-affinity branched-chain amino acid transport ATP-binding protein LivF Escherichia coli (strain K12)
O86311 7.32e-22 99 30 3 222 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O86311 3.13e-08 58 29 8 222 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q897I2 7.44e-22 101 23 9 392 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 1.32e-14 79 29 3 205 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q1MQ44 7.5e-22 100 30 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q1MQ44 2.42e-10 65 26 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q9KLQ5 8.09e-22 100 27 3 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLQ5 2.99e-14 77 28 5 200 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2K2X0 8.96e-22 100 32 5 196 3 modC Molybdenum import ATP-binding protein ModC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K2X0 1e-05 51 26 6 195 3 modC Molybdenum import ATP-binding protein ModC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O52618 9.95e-22 99 31 3 206 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 3.12e-12 71 28 3 203 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q82JY6 1.01e-21 99 31 10 286 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82JY6 5.87e-11 67 30 5 195 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q609Q1 1.03e-21 99 32 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 5.31e-10 64 26 5 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P16678 1.03e-21 97 32 5 227 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
P16678 1.83e-10 65 25 6 226 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
Q93DX8 1.08e-21 98 30 6 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q93DX8 3.03e-12 70 26 4 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q46ZU5 1.1e-21 99 30 4 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46ZU5 7.97e-10 63 27 5 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q93D97 1.14e-21 102 22 16 526 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93D97 1.59e-06 54 25 6 221 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P0A193 1.16e-21 97 29 5 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A193 3.37e-11 67 27 5 213 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 1.16e-21 97 29 5 255 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
P0A194 3.37e-11 67 27 5 213 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
Q8PHQ3 1.23e-21 98 33 4 212 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q8PHQ3 7.86e-08 57 36 1 86 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q7NIW1 1.44e-21 99 33 3 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7NIW1 8.74e-10 63 26 6 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04560
Feature type CDS
Gene lsrA
Product autoinducer 2 ABC transporter ATP-binding protein LsrA
Location 963472 - 965049 (strand: -1)
Length 1578 (nucleotides) / 525 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2520
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1129 Carbohydrate transport and metabolism (G) G ABC-type sugar transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10558 AI-2 transport system ATP-binding protein ABC transporters
Quorum sensing		 -

Protein Sequence

MSGKQHPVQPLLTARGIAKQFSGVVVLKHIDFTLLPGQVHALLGGNGAGKSTLMKIIAGIEQPDSGTLTLEGQDISHLTPAKAHQLGLYLVPQEPLLFPNLTVQENILFRLPKHQAGKAKLQQMLSALRCNFDLAARAGSLNVADQQLVEIMRGLMRDSRILILDEPTASLTPAETHRLFERIRELQQKGVGIVFISHKIPEIHAIADYLSVMRDGNIALTGPAKQFSTDEIIQAITPEAKKKPLSDTQKLWLDLASARNNPQSGEPVLDVRNACGEGFRHISFVVNPGEVVGLAGVVGAGRTELAETLYGLRPLIAGDIHLNGENLRGVSTEKRLTRGLVCLPEDRQASGLFLDAPLTWNIGALVHNHRGLLVRRAYDDAVLERYRRALNIKFNDGQQLVRTLSGGNQQKILIAKCLEANPSLLIVDEPTRGVDVGARNDIYQLIQSIAQQNVAILLISSDLDEVVALADRVLVMHQGEFVGELQQDEMNVDTIMHMAFGEQRRSTDTKRSETESGPSQEAASC

Flanking regions ( +/- flanking 50bp)

TTCATCACATAACATCCGAGCACAATACCCATAACACCAGAGGTGCCGTTATGTCCGGAAAGCAACACCCTGTTCAGCCACTGCTGACTGCCCGCGGAATAGCCAAACAATTTTCCGGCGTGGTGGTGCTGAAACACATCGACTTCACACTGTTACCGGGACAGGTTCATGCCCTGCTCGGCGGAAACGGCGCGGGTAAATCCACGCTGATGAAAATCATTGCAGGGATTGAGCAGCCGGATAGCGGCACACTGACACTTGAAGGTCAGGACATTTCGCACCTGACACCGGCAAAAGCACACCAGCTCGGGCTGTATCTGGTTCCGCAGGAGCCGCTGCTGTTTCCCAATCTGACCGTGCAGGAAAATATTCTCTTTCGTCTGCCGAAACATCAGGCGGGTAAAGCCAAATTACAGCAGATGCTCAGTGCGCTGCGCTGTAATTTTGACCTTGCTGCCCGCGCGGGCAGCCTGAATGTGGCTGACCAGCAGTTAGTTGAGATTATGCGCGGGCTGATGCGGGACTCACGAATTCTTATCCTGGATGAACCTACCGCCTCACTGACACCGGCTGAAACACACCGCCTGTTTGAGCGCATCCGGGAATTACAGCAAAAAGGGGTCGGGATTGTCTTTATCTCCCATAAAATTCCGGAAATTCATGCCATTGCTGATTATCTGAGTGTAATGCGTGACGGCAATATTGCCCTGACCGGACCGGCTAAACAGTTTTCAACCGATGAAATCATTCAGGCGATCACGCCGGAAGCCAAGAAAAAACCGTTATCTGACACCCAAAAATTATGGCTGGATCTCGCTTCTGCCCGCAATAATCCGCAATCCGGTGAACCGGTGCTGGATGTCCGTAATGCCTGTGGCGAAGGATTCCGCCACATCAGTTTTGTTGTCAACCCAGGGGAAGTGGTCGGGCTGGCCGGCGTCGTTGGCGCCGGCCGGACTGAACTCGCGGAGACATTATATGGTCTGCGCCCGCTGATCGCCGGGGATATTCACCTCAACGGTGAGAATTTACGCGGCGTCAGTACAGAAAAACGCCTGACCCGAGGGCTGGTCTGTTTACCGGAAGATCGCCAGGCATCCGGGCTTTTCCTTGACGCGCCGCTGACCTGGAATATCGGCGCGCTGGTGCATAACCACCGGGGGCTGCTGGTTCGTCGCGCCTATGATGATGCGGTGCTGGAACGCTACCGCCGCGCACTGAATATCAAATTCAATGACGGTCAGCAACTGGTGCGCACCCTTTCCGGCGGAAACCAGCAAAAAATCCTGATAGCAAAATGCCTGGAAGCCAATCCATCCCTGCTGATTGTTGATGAGCCGACGCGTGGCGTGGATGTCGGGGCGCGAAATGATATTTATCAGCTTATACAAAGTATTGCACAGCAAAACGTGGCGATTTTACTTATTTCATCTGATCTGGATGAAGTTGTGGCACTGGCTGACCGCGTGCTGGTTATGCATCAGGGCGAATTTGTCGGTGAACTGCAACAGGATGAAATGAATGTCGATACCATTATGCACATGGCATTTGGTGAGCAGCGCCGCAGCACTGACACAAAAAGGTCCGAAACAGAAAGCGGCCCATCACAGGAGGCGGCATCATGCTGAAATATATACAAAATAACCGTGAAGTGACCGCGCTGCTCGCGATCCTCTGC