Homologs in group_711

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02080 FBDBKF_02080 89.6 Morganella morganii S1 znuC zinc ABC transporter ATP-binding protein ZnuC
EHELCC_02550 EHELCC_02550 89.6 Morganella morganii S2 znuC zinc ABC transporter ATP-binding protein ZnuC
NLDBIP_00910 NLDBIP_00910 89.6 Morganella morganii S4 znuC zinc ABC transporter ATP-binding protein ZnuC
LHKJJB_01125 LHKJJB_01125 89.6 Morganella morganii S3 znuC zinc ABC transporter ATP-binding protein ZnuC
HKOGLL_01165 HKOGLL_01165 89.6 Morganella morganii S5 znuC zinc ABC transporter ATP-binding protein ZnuC
PMI_RS05555 PMI_RS05555 71.4 Proteus mirabilis HI4320 znuC zinc ABC transporter ATP-binding protein ZnuC

Distribution of the homologs in the orthogroup group_711

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_711

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q1CJG3 1.78e-129 370 74 0 237 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 1.78e-129 370 74 0 237 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 1.78e-129 370 74 0 237 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 2.17e-129 370 74 0 237 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6D4A8 9.21e-126 360 70 0 237 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JRI2 4.81e-125 358 75 0 232 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q5PIA5 3.93e-124 356 70 0 237 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 3.93e-124 356 70 0 237 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q8ZNV7 4.61e-123 353 70 0 237 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z5W6 1.45e-122 352 70 0 237 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q32HA3 7.68e-122 350 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2L6 1.16e-121 350 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 1.16e-121 350 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 1.16e-121 350 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 1.16e-121 350 69 0 237 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 1.16e-121 350 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 1.16e-121 350 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 1.16e-121 350 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 1.16e-121 350 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q83KR7 1.09e-119 345 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.09e-119 345 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q7N545 6.14e-116 336 70 0 229 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2NTI7 5.57e-113 328 60 1 269 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
A0KPH6 8.86e-96 285 60 1 228 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q89AJ0 1.49e-95 283 52 0 237 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q4KKK4 3.42e-92 276 58 1 227 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KKA1 6.79e-92 275 54 3 267 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q6LTB1 1e-91 274 52 1 257 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q88RL1 1.26e-91 274 56 1 250 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4ZZS2 5.58e-91 273 54 3 265 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q1IGY7 7.48e-91 272 56 1 251 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q7MMN0 9.73e-91 272 56 0 228 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 9.73e-91 272 56 0 228 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q87RE5 1.51e-89 269 56 0 228 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9HT73 2.41e-89 269 57 0 222 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 2.41e-89 269 57 0 222 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q87UN0 4.15e-89 268 52 2 267 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48PV0 1.42e-88 266 55 2 251 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9KQB8 2.04e-88 266 57 0 229 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5E6M2 2.08e-88 266 54 0 228 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8K9M6 4.25e-88 264 52 0 237 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q21PQ7 1.03e-84 256 53 3 232 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0VTB6 4.74e-84 255 57 1 222 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2SPI3 5.64e-84 254 54 1 225 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
P44692 9.5e-84 254 52 0 225 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5LUR8 2.09e-83 253 51 0 235 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q65UG3 4.05e-83 253 52 0 225 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QND5 9.89e-83 252 52 0 225 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q1MEG2 1.02e-82 253 48 0 233 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q0I4A9 7.43e-82 249 49 2 265 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q8D385 1.16e-81 248 48 0 232 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q2K6Q4 1.27e-80 248 48 0 233 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7VLS9 1.41e-80 246 52 0 225 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P57403 5.46e-80 244 51 0 228 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9CP24 1.67e-79 243 52 0 234 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q160Y9 2.06e-79 243 47 0 227 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3IWB5 4.24e-79 242 49 0 227 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q31I51 4.91e-79 242 46 2 243 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8UF79 6.21e-79 243 47 0 233 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q28VN1 1.26e-78 240 46 0 227 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q92P76 3.37e-78 241 46 0 233 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
A1U776 5.36e-77 237 52 1 225 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q576K0 1.06e-76 238 44 1 256 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 1.06e-76 238 44 1 256 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q8FUU5 4.13e-76 236 44 1 256 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
A0LCH8 6.83e-76 234 49 0 228 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8YDJ8 1.29e-75 235 44 1 256 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A1B9K8 8.57e-75 231 50 1 230 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q1GL85 1.67e-74 230 47 0 226 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q2W4W1 1.06e-73 229 47 5 268 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2SI12 3.21e-72 224 48 0 235 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Hahella chejuensis (strain KCTC 2396)
Q1R155 7.37e-72 223 45 0 233 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0A9E2 3.75e-69 217 47 1 233 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1WXT0 1.83e-68 215 45 2 234 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q11B53 4.1e-66 210 46 0 227 3 znuC Zinc import ATP-binding protein ZnuC Chelativorans sp. (strain BNC1)
Q4UJW5 3e-65 206 40 3 237 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92G36 4.68e-65 206 41 2 234 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q6FFL0 1.09e-63 203 43 3 234 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5E284 2.51e-63 201 44 0 239 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1RGL1 2.72e-63 201 40 2 234 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q4FQ27 1.16e-62 200 45 2 220 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1Q889 2.64e-62 199 41 4 256 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q68Y13 1.7e-61 196 39 3 241 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCC4 1.85e-60 194 39 3 239 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q5HBR8 1.35e-53 177 37 1 220 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 1.35e-53 177 37 1 220 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q2GFZ6 4.23e-53 175 36 2 225 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q3YSK9 1.63e-52 174 37 2 223 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q2GJA5 1.55e-49 166 37 2 217 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q5PB72 3.22e-46 158 35 2 217 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q9WXX8 3e-43 150 34 3 234 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q73GK9 1.42e-39 140 29 4 228 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q5GRS1 4.92e-38 137 30 2 226 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q9XDA6 4.9e-37 134 35 4 222 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P44662 1.19e-35 132 32 7 271 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q926D8 2.38e-35 130 35 4 222 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7AH43 3.42e-33 127 33 4 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
P37009 1.62e-32 125 34 5 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P48334 7.67e-32 120 30 6 233 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
Q9KD30 8.31e-32 120 33 6 219 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q56953 5.19e-30 117 33 5 246 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
Q92AF9 6.51e-30 115 30 5 213 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q55281 2.32e-29 114 32 6 235 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8Y651 2.57e-29 114 30 5 215 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6D734 2.64e-29 116 31 6 236 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O34338 2.82e-29 114 33 6 234 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q9Z8J5 6.57e-29 113 31 4 221 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q7N8B9 1.37e-28 114 32 5 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q57554 1.38e-28 112 29 7 244 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O34946 2.48e-28 111 32 6 213 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q9PKX1 5.14e-28 111 31 5 214 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
O84071 1.28e-27 110 30 5 214 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q6LKD4 1.49e-27 112 28 4 262 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
P96117 5.61e-27 108 32 7 237 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
P0A2U7 7.17e-27 107 30 5 223 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 7.17e-27 107 30 5 223 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2SB47 1.25e-26 107 35 5 219 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
Q65S66 4.07e-26 107 30 2 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1BWL4 4.4e-26 107 37 5 201 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 4.4e-26 107 37 5 201 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q9I6L0 6.31e-26 107 30 6 255 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P74548 9.09e-26 107 31 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5L222 9.1e-26 107 30 5 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q57293 9.47e-26 107 32 4 208 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q21XJ9 1.03e-25 105 34 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q6F0V4 1.61e-25 106 28 5 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q39GW5 1.64e-25 105 35 5 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q03ZQ0 1.77e-25 106 29 8 267 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q6D201 2.07e-25 105 31 7 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0I2Z4 2.13e-25 105 30 3 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q8DZJ0 2.53e-25 106 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 2.53e-25 106 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 2.53e-25 106 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q7NIW1 2.58e-25 105 31 4 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q2SSS4 2.78e-25 105 27 3 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q5X627 3.64e-25 105 30 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q0BFQ0 4.15e-25 104 36 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q7N6Z2 4.26e-25 105 31 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6MU19 4.3e-25 105 27 3 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q9K876 4.82e-25 105 31 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q81LM1 5.03e-25 103 28 5 236 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q8KLG1 5.6e-25 104 35 2 179 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q02Z10 5.62e-25 105 33 8 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
P16676 5.65e-25 105 32 5 230 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q9CGD4 5.78e-25 105 33 8 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q8ELR4 5.91e-25 105 30 7 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8XBJ8 6.58e-25 105 32 5 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q8FFB3 6.72e-25 104 32 5 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7CN92 6.82e-25 105 32 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 6.82e-25 105 32 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q5ZWE4 7.49e-25 104 30 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q7UC29 7.67e-25 104 33 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
P14788 7.79e-25 104 33 3 205 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5XCA4 7.86e-25 105 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q48IB9 7.87e-25 102 35 1 181 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q04G50 8.28e-25 104 31 8 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8D0W8 8.87e-25 104 29 5 260 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
P0CZ35 8.96e-25 104 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 8.96e-25 104 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 8.96e-25 104 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q7VZE5 8.97e-25 104 30 7 277 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q93DX8 1.03e-24 102 31 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
P56344 1.04e-24 101 31 4 224 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q9CM80 1.15e-24 103 31 3 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q03AH0 1.16e-24 104 33 8 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q9HYF9 1.2e-24 102 33 4 212 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02QT6 1.2e-24 102 33 4 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1J6Q6 1.21e-24 104 32 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 1.21e-24 104 32 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 1.21e-24 104 32 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 1.21e-24 104 32 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q668K6 1.39e-24 103 29 5 260 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q881U6 1.58e-24 101 35 1 181 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5WXF0 1.79e-24 103 30 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q0S0X2 2.05e-24 101 35 2 192 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q8Z0H0 2.66e-24 102 31 4 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q03JH1 3.23e-24 103 32 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q14Q07 3.45e-24 102 30 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q5M397 3.46e-24 103 32 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYN4 3.6e-24 103 32 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q9Z810 3.66e-24 100 32 5 217 3 CPn_0542 Probable metal transport system ATP-binding protein CPn_0542/CP_0210/CPj0542/CpB0563 Chlamydia pneumoniae
Q8DIA0 3.85e-24 102 30 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q830W6 3.96e-24 102 31 7 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q8Z4V6 4.11e-24 102 32 5 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q0BUR6 4.36e-24 100 33 3 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A0A0H2VBH0 4.6e-24 104 33 4 195 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 9.63e-12 68 22 7 266 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7W9U5 4.94e-24 102 29 7 277 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P63389 5.01e-24 104 33 4 195 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 1.08e-11 68 22 7 266 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 5.01e-24 104 33 4 195 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 1.08e-11 68 22 7 266 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P40860 5.1e-24 102 32 5 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7WGW1 5.15e-24 102 29 7 277 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8D653 5.2e-24 102 33 6 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q8DUF7 7.44e-24 102 32 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q48CA0 8.03e-24 100 33 3 202 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P44531 8.48e-24 101 30 3 209 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q38VW6 9.99e-24 101 32 7 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q9G4F5 1e-23 101 32 5 233 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q4QK57 1.01e-23 101 27 6 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
O34314 1.09e-23 99 29 6 259 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
P04285 1.12e-23 101 31 6 227 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q87G35 1.17e-23 103 30 8 253 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 9.79e-07 53 25 6 219 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q035B2 1.21e-23 100 31 6 231 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q2SVN0 1.21e-23 100 35 5 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1QE80 1.25e-23 102 32 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4ZLS1 1.35e-23 99 33 3 202 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q8U4L3 1.38e-23 99 35 6 210 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q03PF2 1.52e-23 101 30 4 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q88ZJ6 1.52e-23 101 33 9 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88AS5 1.94e-23 100 31 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P0A193 2.24e-23 98 26 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 2.24e-23 98 26 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
Q8PP41 2.27e-23 98 33 6 210 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q722B1 2.47e-23 100 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q92DL6 2.52e-23 100 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AGP9 2.9e-23 100 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q3JSR6 3.03e-23 100 37 5 191 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q63TW1 3.11e-23 99 37 5 191 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q8Y8T6 3.11e-23 100 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q87UI3 3.24e-23 98 32 3 202 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4K441 3.29e-23 98 33 3 202 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P9WQL3 3.33e-23 100 33 3 198 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 3.33e-23 100 33 3 198 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8RGC8 3.34e-23 100 28 6 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P97027 3.76e-23 98 35 5 177 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
Q88CL2 4.01e-23 99 30 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P42360 4.02e-23 97 28 5 235 1 scaC Manganese import ATP-binding protein ScaC Streptococcus gordonii
Q62K56 4.32e-23 99 37 5 191 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
P55476 4.67e-23 99 33 7 213 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8F6Z1 4.95e-23 99 29 5 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 4.95e-23 99 29 5 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P45171 5.1e-23 99 27 6 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C0SPB4 5.4e-23 98 27 6 233 3 yhaQ Uncharacterized ABC transporter ATP-binding protein YhaQ Bacillus subtilis (strain 168)
Q58429 5.81e-23 97 29 5 202 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q0SK28 5.93e-23 97 34 2 183 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q57243 6.11e-23 97 32 6 198 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P26050 7.1e-23 98 32 5 213 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O34510 7.17e-23 97 29 6 238 3 yfmF Fe(3+)-citrate import ATP-binding protein YfmF Bacillus subtilis (strain 168)
O57872 7.55e-23 97 31 8 231 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q57399 7.79e-23 97 26 4 242 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3K506 8e-23 97 34 3 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
P0A9S9 8.1e-23 97 26 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 8.1e-23 97 26 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 8.1e-23 97 26 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
Q9PJX9 8.12e-23 96 31 5 218 3 TC_0697 Probable metal transport system ATP-binding protein TC_0697 Chlamydia muridarum (strain MoPn / Nigg)
Q5WBL0 8.42e-23 97 30 2 206 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q8XZP8 8.68e-23 99 30 4 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A3CMQ7 8.96e-23 99 29 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q9KL34 9.5e-23 97 31 6 245 3 hmuV Hemin import ATP-binding protein HmuV Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q3KCC5 1.1e-22 98 32 9 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q5JEB0 1.21e-22 98 33 5 207 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O85818 1.28e-22 98 27 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
A3DDF6 1.29e-22 98 29 8 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q65M64 1.3e-22 96 31 6 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9MUN1 1.46e-22 98 29 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9EYM2 2.02e-22 95 33 7 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8U6M1 2.17e-22 97 32 6 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8DPC2 2.2e-22 98 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 2.2e-22 98 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 2.2e-22 98 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P94374 2.25e-22 97 30 7 215 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q44613 2.34e-22 95 34 4 185 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9V2E4 2.4e-22 95 32 7 210 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q1IGL4 2.45e-22 96 33 3 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
P0C0E2 2.54e-22 95 29 4 193 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 2.54e-22 95 29 4 193 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q665B6 2.85e-22 96 32 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q88XV2 2.85e-22 96 34 9 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9HYG4 3.3e-22 95 33 2 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P94440 4.71e-22 96 27 4 239 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q2NHA1 4.96e-22 95 32 7 225 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
P0A9V4 5.08e-22 94 30 6 225 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 5.08e-22 94 30 6 225 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 5.08e-22 94 30 6 225 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 5.08e-22 94 30 6 225 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
Q97JB8 5.15e-22 95 29 4 213 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O84421 5.53e-22 94 33 7 221 3 CT_416 Probable metal transport system ATP-binding protein CT_416 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q63TY1 5.84e-22 96 31 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q7NX01 5.92e-22 96 31 5 233 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q62K82 6.02e-22 96 31 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q8XZQ4 7.1e-22 95 32 2 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5QU46 7.33e-22 94 35 7 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q74K65 7.35e-22 96 28 8 272 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q1J982 8.09e-22 95 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q0SRL2 8.62e-22 96 26 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q5NN23 9.07e-22 94 31 3 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q92VJ2 9.2e-22 96 30 5 233 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q58762 9.42e-22 95 33 8 193 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q160G4 9.44e-22 94 31 9 235 3 hmuV Hemin import ATP-binding protein HmuV Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q042G7 9.83e-22 96 28 8 272 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P45073 1.02e-21 94 29 6 238 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1CDR0 1.08e-21 94 31 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 1.08e-21 94 31 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 1.08e-21 94 31 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q8XIZ5 1.09e-21 95 27 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.09e-21 95 27 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q1MQ44 1.09e-21 96 30 7 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
P31134 1.15e-21 96 26 5 261 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q48QM2 1.28e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JJC9 1.28e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
P0C0E8 1.28e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
Q8GNH6 1.28e-21 95 33 2 180 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
O52618 1.36e-21 95 33 2 177 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q3B276 1.4e-21 93 31 5 207 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
O31427 1.4e-21 93 32 8 206 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
P0C0E9 1.41e-21 94 30 6 216 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0CZ29 1.41e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RH11 1.41e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J449 1.41e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JEC8 1.41e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7CMM7 1.41e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9B5 1.41e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ28 1.41e-21 94 30 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P45092 1.53e-21 93 33 9 230 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8U4K3 1.66e-21 95 31 6 208 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q3IL62 1.7e-21 93 32 5 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
Q0TJC1 1.76e-21 93 34 5 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1AS06 1.81e-21 95 30 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8UA73 1.86e-21 95 31 7 253 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1RDS4 1.97e-21 93 33 3 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 1.97e-21 93 33 3 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q02QT1 2.03e-21 94 33 2 196 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
P96605 2.14e-21 94 30 2 205 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
Q92N13 2.19e-21 93 30 7 248 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
P76027 2.62e-21 94 31 6 225 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
Q5HQ70 2.76e-21 95 29 7 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q65P77 2.89e-21 93 31 7 214 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P44656 2.95e-21 92 32 5 186 3 HI_0354 Uncharacterized ABC transporter ATP-binding protein HI_0354 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4ZQE3 3.03e-21 93 33 2 190 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. syringae (strain B728a)
Q9CN78 3.13e-21 92 32 3 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q2KBP5 3.13e-21 92 31 8 229 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q81GC1 3.21e-21 94 27 6 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0RKH4 3.24e-21 92 33 4 192 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q30V33 3.31e-21 94 31 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q82TL6 3.57e-21 94 29 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8U8D6 3.58e-21 93 30 3 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5FQN4 3.6e-21 91 40 2 150 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
Q82MV1 3.6e-21 92 31 1 191 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q1IGM2 3.69e-21 92 31 5 205 3 tauB Taurine import ATP-binding protein TauB Pseudomonas entomophila (strain L48)
Q93SH7 3.91e-21 92 30 5 217 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P57383 4.05e-21 92 29 4 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P33916 4.37e-21 95 31 8 237 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 2.59e-14 75 29 7 231 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
Q6MCV4 4.42e-21 94 30 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q2K8C8 4.5e-21 94 32 6 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P15031 4.67e-21 92 31 8 240 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q55EH8 4.79e-21 95 29 4 229 3 abcG23 ABC transporter G family member 23 Dictyostelium discoideum
Q6CYU2 5.18e-21 92 32 5 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6HLQ9 5.37e-21 93 27 6 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63E84 5.53e-21 93 27 6 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 5.53e-21 93 27 6 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 5.53e-21 93 27 6 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
P33982 5.97e-21 92 27 7 237 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9Z3I3 6.06e-21 93 32 5 212 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q13ZK7 6.07e-21 93 31 5 219 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q88XV1 7.08e-21 92 31 8 239 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q07LU3 7.18e-21 92 28 7 253 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q8X5I6 7.19e-21 92 29 6 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q9USH9 7.38e-21 95 33 6 192 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P74981 9.2e-21 92 30 7 250 1 hmuV Hemin import ATP-binding protein HmuV Yersinia enterocolitica
Q8KZQ6 9.46e-21 92 32 3 202 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q89UD2 9.61e-21 93 30 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9TKX3 9.88e-21 93 28 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q1MFL8 1.03e-20 92 29 3 203 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P37494 1.14e-20 90 28 5 203 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
Q84EY8 1.16e-20 91 28 6 251 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
Q0SFY5 1.16e-20 92 31 5 215 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodococcus jostii (strain RHA1)
O07016 1.19e-20 92 33 5 184 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
Q9CP06 1.23e-20 93 27 8 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q88R93 1.26e-20 91 32 3 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8UCD5 1.37e-20 92 28 5 225 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KUI0 1.49e-20 93 30 5 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1WVI7 1.58e-20 92 29 5 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q8DWR3 1.62e-20 91 30 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 1.62e-20 91 30 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 1.62e-20 91 30 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1LKJ2 1.66e-20 92 32 5 183 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q7MFA1 1.68e-20 91 31 8 236 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain YJ016)
P45247 1.71e-20 90 33 5 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 1.71e-20 90 33 5 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q325N3 1.85e-20 90 29 6 240 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q578K3 1.9e-20 92 32 5 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.9e-20 92 32 5 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q8N139 2.02e-20 94 33 5 183 1 ABCA6 ATP-binding cassette sub-family A member 6 Homo sapiens
P55662 2.04e-20 90 29 9 247 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8D3S8 2.14e-20 90 31 7 238 3 hmuV Hemin import ATP-binding protein HmuV Vibrio vulnificus (strain CMCP6)
Q8A883 2.15e-20 93 29 4 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8CPN0 2.22e-20 92 29 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q1B677 2.27e-20 92 33 6 212 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q0K9I2 2.38e-20 91 33 5 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q81TH8 2.43e-20 92 27 6 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q5LBT4 2.44e-20 93 28 6 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q3Z542 2.44e-20 90 29 6 240 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 2.44e-20 90 29 6 240 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q58129 2.46e-20 93 31 4 182 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58129 9.64e-09 59 25 5 184 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q64SQ6 2.61e-20 93 28 6 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q7VNG4 2.62e-20 92 24 5 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P39459 2.7e-20 90 31 4 212 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
Q8XXY9 2.78e-20 91 28 5 223 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q04FM1 2.81e-20 91 27 6 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q1M7W6 2.95e-20 91 35 6 181 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6NBT1 2.96e-20 92 30 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q32IZ6 2.96e-20 90 29 6 240 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
A1TXH7 3.1e-20 92 29 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q6D2F6 3.2e-20 91 29 5 227 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O51587 3.27e-20 91 25 5 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q660M8 3.34e-20 91 25 5 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q8E8K8 3.49e-20 91 27 6 266 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
O86751 3.55e-20 91 32 7 238 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8NR42 3.55e-20 89 30 5 228 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q2SVP3 3.59e-20 90 33 2 177 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2JGF5 3.6e-20 90 33 4 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q3M5J9 3.6e-20 90 32 3 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8FVV5 3.63e-20 91 31 6 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q87R20 3.79e-20 89 31 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P49938 3.89e-20 90 31 6 203 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
P23703 3.92e-20 91 32 3 182 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2YAD6 3.95e-20 91 28 4 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2J3T0 3.95e-20 90 29 7 249 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q8FJ95 4.07e-20 90 32 3 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P96063 4.1e-20 91 29 7 235 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P72335 4.26e-20 90 34 2 172 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q5PFQ7 4.48e-20 91 29 7 235 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1RFH8 4.56e-20 89 29 6 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 4.56e-20 89 29 6 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5WKG4 4.84e-20 89 31 1 191 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q8ETV6 4.88e-20 90 28 7 229 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5HC57 5.25e-20 89 29 6 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ehrlichia ruminantium (strain Welgevonden)
Q5FFC0 5.25e-20 89 29 6 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ehrlichia ruminantium (strain Gardel)
Q885N4 5.32e-20 90 33 2 190 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8Z8W8 5.36e-20 91 29 7 235 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q8FKF5 5.65e-20 89 29 6 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9JZW0 6.42e-20 91 30 6 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q39T41 6.47e-20 88 31 7 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q88YN5 6.57e-20 89 29 4 220 3 phnC Phosphonates import ATP-binding protein PhnC Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q217B2 6.68e-20 89 28 7 245 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q3JSQ0 6.85e-20 90 33 2 177 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 6.85e-20 90 33 2 177 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q07LQ4 6.89e-20 89 32 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q110U3 6.93e-20 91 28 6 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q63TX3 6.99e-20 90 33 2 177 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q9JUX4 7.02e-20 90 30 6 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P55453 7.06e-20 90 30 5 208 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q92WJ0 7.15e-20 90 31 5 215 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q0SML1 7.19e-20 90 25 5 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
P72479 7.24e-20 90 29 9 241 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9KL04 7.49e-20 91 28 5 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8TYV9 7.74e-20 89 27 4 225 3 MK0182 Putative ABC transporter ATP-binding protein MK0182 Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q87UH7 8.44e-20 89 30 5 213 3 tauB Taurine import ATP-binding protein TauB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q12R52 8.45e-20 89 28 4 232 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q5SSE9 8.53e-20 92 32 9 222 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5SSE9 4.44e-10 63 28 4 167 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
P0AAF9 8.79e-20 89 30 5 223 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 8.79e-20 89 30 5 223 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 8.79e-20 89 30 5 223 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 8.79e-20 89 30 5 223 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
O30144 9.1e-20 88 34 5 184 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A0PY57 9.23e-20 90 27 7 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q7VMV4 9.37e-20 88 32 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8EBC3 9.37e-20 90 30 5 232 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1TAI4 9.4e-20 90 28 6 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q83CV2 9.89e-20 88 32 5 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q11ID5 1.01e-19 89 30 9 239 3 hmuV Hemin import ATP-binding protein HmuV Chelativorans sp. (strain BNC1)
P21629 1.11e-19 89 25 6 248 3 braF High-affinity branched-chain amino acid transport ATP-binding protein BraF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47087 1.15e-19 89 28 4 223 3 cbrD Achromobactin transport ATP-binding protein CbrD Dickeya dadantii (strain 3937)
Q8RI39 1.27e-19 90 29 4 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q65UE1 1.28e-19 90 25 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q13ZJ1 1.35e-19 89 33 6 184 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
P42332 1.36e-19 89 31 4 218 3 bcrA Bacitracin transport ATP-binding protein BcrA Bacillus licheniformis
Q1BWI2 1.38e-19 89 32 2 177 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q8KZR4 1.52e-19 88 31 5 193 3 tauB Taurine import ATP-binding protein TauB Pseudomonas putida
Q9HZL7 1.55e-19 87 35 6 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q97KS6 1.55e-19 90 27 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q47C66 1.57e-19 87 32 4 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
P0AAI1 1.65e-19 88 33 3 200 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI2 1.65e-19 88 33 3 200 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
Q02R79 1.77e-19 90 29 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HY19 1.77e-19 90 29 5 231 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q65QT6 1.79e-19 90 25 4 270 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O83078 1.82e-19 87 32 4 204 3 TP_0035 Probable metal transport system ATP-binding protein TP_0035 Treponema pallidum (strain Nichols)
Q39GT7 1.82e-19 89 32 2 177 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0I3C2 1.85e-19 87 31 4 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q0S0Z3 1.93e-19 89 27 7 276 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q8U3E0 1.93e-19 88 30 7 219 3 PF0528 Putative ABC transporter ATP-binding protein PF0528 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q57SD6 1.96e-19 89 28 7 235 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q4ZTG9 1.98e-19 87 37 4 188 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. syringae (strain B728a)
P44513 2.03e-19 89 30 5 214 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q48FT0 2.06e-19 88 33 2 190 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q50801 2.25e-19 88 31 9 226 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q1LNM0 2.28e-19 88 33 5 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8VNL9 2.5e-19 88 27 8 236 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q73YZ5 2.55e-19 87 33 3 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 2.55e-19 87 33 3 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
Q12NL5 2.63e-19 87 31 9 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0I3Y9 2.99e-19 89 26 7 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q66FK0 2.99e-19 87 28 7 245 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 2.99e-19 87 28 7 245 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 2.99e-19 87 28 7 245 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 2.99e-19 87 28 7 245 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q88RA1 3.01e-19 87 28 6 234 3 tauB Taurine import ATP-binding protein TauB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8K441 3.02e-19 90 32 6 183 1 Abca6 ATP-binding cassette sub-family A member 6 Mus musculus
Q8K441 3.82e-07 54 27 5 158 1 Abca6 ATP-binding cassette sub-family A member 6 Mus musculus
Q8PC11 3.04e-19 89 30 4 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P19844 3.21e-19 88 36 5 187 1 nosF Probable ABC transporter ATP-binding protein NosF Stutzerimonas stutzeri

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04445
Feature type CDS
Gene znuC
Product zinc ABC transporter ATP-binding protein ZnuC
Location 939880 - 940689 (strand: -1)
Length 810 (nucleotides) / 269 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_711
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1121 Inorganic ion transport and metabolism (P) P ABC-type Mn2+/Zn2+ transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09817 zinc transport system ATP-binding protein [EC:7.2.2.20] ABC transporters -

Protein Sequence

MSTLIAVNDVSVTFGSNTVLEDISFALTPGKIITLLGPNGAGKSTIVRVVLGLIAPSSGSVTRTPGLTVGYVPQKLYLDPTMPLTVARFLHLKRGVSKADCLTALGRVNAAHLTDKPMQRLSGGEMQRVLLARALLARPQLLVLDEPTQGVDVNGQVVLYDLITQLRDELNCAVLMVSHDLHLVMAKTDTVLCINRHICCSGEPDIVAAHPEFTAMFGTRAATQIGVYRHHHNHSHENAAAVLSPSAPCCGNHSPVSGSPDTATECRHD

Flanking regions ( +/- flanking 50bp)

GTAATGTTATATTATAACGTTTCACTCATTCTGCAAGATAACAATTTCCCATGTCAACACTTATCGCGGTAAATGATGTATCCGTTACTTTCGGCAGCAATACCGTGCTGGAAGACATTTCATTTGCATTAACACCGGGTAAAATCATCACCCTTCTCGGCCCCAACGGCGCGGGAAAATCCACGATCGTCCGTGTTGTTCTCGGGCTTATCGCGCCGTCATCAGGGTCAGTAACCCGTACACCCGGGTTAACCGTCGGCTATGTTCCGCAAAAACTGTACCTTGACCCGACTATGCCCCTGACAGTTGCCCGTTTTCTGCATCTCAAACGCGGTGTCAGCAAAGCAGATTGCCTGACGGCACTCGGACGGGTAAACGCCGCACATCTGACGGACAAACCGATGCAGCGCCTCTCGGGCGGTGAAATGCAGCGTGTACTACTGGCACGGGCACTGTTAGCCCGCCCGCAGTTGCTGGTACTGGATGAGCCGACTCAGGGTGTGGATGTGAATGGCCAGGTGGTATTGTATGATTTAATCACACAACTGCGTGATGAACTAAACTGTGCCGTATTAATGGTTTCCCACGATCTGCATCTGGTGATGGCAAAAACAGATACCGTGCTCTGTATTAACCGCCATATCTGCTGCTCAGGTGAGCCGGATATTGTTGCGGCACATCCGGAATTTACGGCGATGTTCGGCACCCGCGCCGCCACACAAATCGGCGTTTACCGTCATCATCATAACCACAGTCATGAAAATGCCGCAGCGGTTTTATCCCCTTCAGCGCCCTGCTGCGGCAACCATTCACCTGTAAGCGGGTCACCGGATACTGCCACGGAGTGCCGTCATGATTGAGTTACTGTTACCCGGCTGGCTCGCCGGCATGTTACTGGCTATTGCTGCCG