Homologs in group_638

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02080 FBDBKF_02080 100.0 Morganella morganii S1 znuC zinc ABC transporter ATP-binding protein ZnuC
NLDBIP_00910 NLDBIP_00910 100.0 Morganella morganii S4 znuC zinc ABC transporter ATP-binding protein ZnuC
LHKJJB_01125 LHKJJB_01125 100.0 Morganella morganii S3 znuC zinc ABC transporter ATP-binding protein ZnuC
HKOGLL_01165 HKOGLL_01165 100.0 Morganella morganii S5 znuC zinc ABC transporter ATP-binding protein ZnuC
F4V73_RS04445 F4V73_RS04445 89.6 Morganella psychrotolerans znuC zinc ABC transporter ATP-binding protein ZnuC
PMI_RS05555 PMI_RS05555 71.4 Proteus mirabilis HI4320 znuC zinc ABC transporter ATP-binding protein ZnuC

Distribution of the homologs in the orthogroup group_638

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_638

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q1CJG3 8.83e-126 360 70 1 248 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 8.83e-126 360 70 1 248 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 8.83e-126 360 70 1 248 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 1.16e-125 360 69 1 248 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6D4A8 7.42e-124 355 69 0 237 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5PIA5 1.75e-122 352 70 1 244 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 1.75e-122 352 70 1 244 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q8ZNV7 1.6e-121 350 69 1 244 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q32HA3 1.8e-121 349 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2L6 2.86e-121 349 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 2.86e-121 349 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 2.86e-121 349 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 2.86e-121 349 69 1 244 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 2.86e-121 349 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 2.86e-121 349 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 2.86e-121 349 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 2.86e-121 349 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q8Z5W6 4.28e-121 348 69 1 244 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
A1JRI2 4.53e-121 348 73 0 232 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q83KR7 1.99e-119 344 68 1 244 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.99e-119 344 68 1 244 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q7N545 3.57e-117 339 71 0 229 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2NTI7 3.45e-115 334 62 2 269 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q89AJ0 2.14e-94 280 51 0 237 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A0KPH6 1.23e-93 279 59 1 228 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q4ZZS2 8.64e-93 277 54 2 265 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q3KKA1 1.17e-92 277 59 1 227 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q4KKK4 2.11e-92 276 58 1 227 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6LTB1 5.1e-92 275 57 0 228 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q5E6M2 1.12e-91 274 55 0 228 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MMN0 1.4e-91 274 57 0 228 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 1.4e-91 274 57 0 228 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q88RL1 3.02e-91 273 56 1 250 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87RE5 3.06e-91 273 57 0 228 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q1IGY7 1.49e-90 271 55 1 252 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q9HT73 6.3e-90 270 57 0 222 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 6.3e-90 270 57 0 222 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q87UN0 8.73e-90 270 57 1 227 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9KQB8 9.31e-90 270 57 0 229 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q48PV0 1.47e-89 269 54 3 265 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8K9M6 2.69e-87 262 51 0 237 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q21PQ7 1.75e-86 261 53 3 232 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0VTB6 2.07e-85 258 58 1 222 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P44692 2.21e-85 258 53 0 225 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65UG3 7.03e-85 257 53 0 225 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QND5 2.04e-84 256 53 0 225 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q2SPI3 4.44e-84 255 53 1 225 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2K6Q4 1.06e-83 256 47 0 254 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5LUR8 9.88e-82 249 51 0 235 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1MEG2 1.8e-81 250 48 0 233 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q0I4A9 2.46e-81 248 52 0 225 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q9CP24 2.63e-81 248 52 0 234 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q8UF79 5.6e-81 248 48 0 233 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8D385 9.04e-81 246 48 0 232 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q31I51 1.15e-80 246 48 2 243 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q160Y9 1.7e-80 246 48 0 227 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
P57403 2.41e-80 244 52 0 228 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q7VLS9 4.46e-80 245 52 0 225 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q576K0 4.62e-80 246 49 0 233 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 4.62e-80 246 49 0 233 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q8FUU5 1.8e-79 244 49 0 233 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q28VN1 1.95e-79 243 48 0 227 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q8YDJ8 4.25e-79 244 48 0 233 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q3IWB5 8.06e-79 241 50 0 227 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A1U776 1.17e-78 241 52 1 225 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A0LCH8 1.27e-78 241 50 0 228 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q92P76 2.28e-78 242 45 0 254 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q2W4W1 1.88e-77 238 48 4 268 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A1B9K8 7.87e-77 236 52 1 230 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q1GL85 1.27e-74 231 49 0 226 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q1R155 1.03e-73 228 47 0 233 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2SI12 1.26e-69 218 48 0 230 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Hahella chejuensis (strain KCTC 2396)
Q0A9E2 2.68e-68 215 46 1 233 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q11B53 6.8e-68 214 47 0 227 3 znuC Zinc import ATP-binding protein ZnuC Chelativorans sp. (strain BNC1)
A1WXT0 1.62e-67 213 45 2 234 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q92G36 1.19e-66 209 42 2 234 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UJW5 1.2e-66 209 41 2 234 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RGL1 1.14e-65 207 41 3 239 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q5E284 2.71e-64 204 45 0 239 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4FQ27 1.61e-63 202 42 4 257 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6FFL0 1.83e-63 202 43 3 236 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1Q889 5.84e-63 201 41 4 257 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q68Y13 1.2e-62 199 40 3 240 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCC4 4.88e-62 198 41 2 234 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q5HBR8 4.61e-55 180 37 1 220 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 4.61e-55 180 37 1 220 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q2GFZ6 4.14e-54 178 36 1 222 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q3YSK9 1.29e-53 177 37 2 223 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q2GJA5 8.15e-52 172 38 2 217 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q5PB72 1.9e-47 161 36 2 218 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q73GK9 2e-43 150 31 2 225 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q9WXX8 2.87e-43 150 35 3 214 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5GRS1 3.13e-41 145 30 2 224 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
P44662 9.1e-37 135 34 6 250 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9XDA6 2.96e-36 132 35 4 222 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q926D8 1.97e-35 130 35 5 222 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P48334 3.66e-33 124 32 7 234 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
Q7AH43 2.61e-32 124 33 5 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q9KD30 1.32e-31 120 33 7 232 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q92AF9 2.14e-31 119 32 5 213 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P37009 3.35e-31 121 33 5 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
O34946 1.8e-30 116 32 5 213 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q8Y651 2.77e-30 116 31 5 215 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q55281 3.68e-30 116 32 6 235 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q56953 4.77e-30 117 32 5 246 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
O34338 2.62e-29 114 33 6 233 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q6LKD4 3.1e-29 116 27 5 281 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q9Z8J5 5.16e-29 113 32 3 220 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
P0A2U7 3.02e-28 110 31 5 223 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 3.02e-28 110 31 5 223 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q7N8B9 3.06e-28 113 32 5 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9I6L0 6.28e-28 112 30 9 281 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9PKX1 8.69e-28 110 31 4 215 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q57293 9.35e-28 112 33 4 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q9HYF9 1.31e-27 109 35 3 209 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02QT6 1.31e-27 109 35 3 209 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1BWL4 1.44e-27 111 36 3 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 1.44e-27 111 36 3 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q7NIW1 2.15e-27 111 32 4 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q2SB47 2.47e-27 109 35 5 221 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
Q6D734 2.49e-27 111 32 5 233 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6F0V4 2.84e-27 111 27 8 280 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
O84071 2.9e-27 108 30 5 214 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P96117 3.69e-27 108 34 6 235 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q7N6Z2 4.06e-27 110 32 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q39GW5 4.09e-27 110 35 3 204 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9KLQ5 4.44e-27 110 29 6 258 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5X627 4.72e-27 110 31 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q65S66 6.11e-27 110 31 3 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q57554 6.68e-27 108 29 7 244 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q93DX8 8.7e-27 107 32 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q8ELR4 9.12e-27 110 30 7 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P44531 1.01e-26 109 32 4 210 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5ZWE4 1.02e-26 109 30 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P74548 1.29e-26 109 31 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2SSS4 1.52e-26 108 27 6 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q9CM80 1.63e-26 108 32 4 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q5L222 1.74e-26 108 31 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q0I2Z4 1.97e-26 108 31 4 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q6MU19 2.07e-26 108 27 6 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5WXF0 2.12e-26 108 30 6 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q0SK28 2.14e-26 106 34 3 198 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q830W6 2.71e-26 108 32 7 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q881U6 2.83e-26 105 35 1 182 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZLS1 3.48e-26 106 34 3 202 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q8D0W8 5.57e-26 107 31 5 256 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8Z0H0 7.58e-26 107 31 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q668K6 8.21e-26 107 31 5 256 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
P14788 9.68e-26 107 33 4 206 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q48CA0 9.96e-26 105 34 3 202 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q82WT5 1e-25 107 31 4 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q48IB9 1.04e-25 104 35 1 182 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8FFB3 1.08e-25 107 34 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8DZJ0 1.09e-25 107 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.09e-25 107 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.09e-25 107 33 8 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8XBJ8 1.15e-25 107 34 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q02Z10 1.2e-25 107 33 8 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q03JH1 1.23e-25 107 33 8 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q9CGD4 1.28e-25 107 33 8 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
P16676 1.31e-25 107 34 5 226 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q5M397 1.31e-25 107 33 8 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q7UC29 1.33e-25 106 33 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q5LYN4 1.35e-25 107 33 8 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q74K65 1.68e-25 106 31 6 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q81LM1 1.71e-25 104 28 4 236 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q87UI3 1.84e-25 104 34 3 202 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q21XJ9 1.88e-25 104 33 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q042G7 2.44e-25 106 31 6 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q14Q07 3.5e-25 105 30 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8XZP8 3.69e-25 105 32 4 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0BFQ0 3.9e-25 104 35 3 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q03PF2 4.45e-25 105 32 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P0A193 5.84e-25 102 28 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 5.84e-25 102 28 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
Q88ZJ6 7e-25 104 33 7 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P0CZ35 8.27e-25 105 30 9 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 8.27e-25 105 30 9 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 8.27e-25 105 30 9 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q7CN92 9.15e-25 104 30 10 282 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCA4 9.15e-25 104 32 7 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q99ZS8 9.15e-25 104 30 10 282 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q92N13 1.06e-24 102 31 7 248 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
Q1J6Q6 1.23e-24 104 29 9 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 1.23e-24 104 29 9 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 1.23e-24 104 29 9 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 1.23e-24 104 29 9 281 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q87G35 1.31e-24 105 30 9 254 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 1.44e-07 55 24 11 281 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8D653 1.38e-24 103 33 6 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q8F6Z1 1.52e-24 103 30 5 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.52e-24 103 30 5 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P0A9S9 1.64e-24 101 27 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 1.64e-24 101 27 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 1.64e-24 101 27 6 242 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
Q8PP41 1.64e-24 101 34 7 210 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
P45171 1.87e-24 103 27 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8DIA0 1.96e-24 103 30 4 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A3CMQ7 2.12e-24 103 32 8 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
O85818 2.24e-24 103 27 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q6D201 2.25e-24 102 29 5 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9Z810 2.36e-24 100 32 5 217 3 CPn_0542 Probable metal transport system ATP-binding protein CPn_0542/CP_0210/CPj0542/CpB0563 Chlamydia pneumoniae
Q58283 2.73e-24 102 27 5 255 3 MJ0873 Uncharacterized ABC transporter ATP-binding protein MJ0873 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9EYM2 2.94e-24 100 34 7 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q88AS5 3.25e-24 102 31 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q04G50 3.28e-24 103 30 7 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8DUF7 3.39e-24 103 33 8 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9K876 3.61e-24 102 32 7 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3KCC5 4.32e-24 102 33 9 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q57243 4.5e-24 100 32 6 198 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P40860 5.36e-24 102 30 7 280 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4V6 5.52e-24 102 33 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q7NX01 7.28e-24 102 32 5 233 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8DPC2 7.6e-24 102 32 9 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 7.6e-24 102 32 9 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 7.6e-24 102 32 9 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P96063 8.27e-24 102 31 7 235 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4QK57 8.93e-24 102 27 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q4K441 9.13e-24 100 33 3 202 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8UCD5 9.19e-24 101 31 5 225 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q57399 9.69e-24 99 26 4 241 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8U8D6 9.86e-24 100 32 2 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92DL6 1.02e-23 101 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O34314 1.14e-23 99 32 3 191 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q8XIZ5 1.14e-23 101 27 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.14e-23 101 27 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q88CL2 1.17e-23 100 30 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P42360 1.18e-23 99 27 5 239 1 scaC Manganese import ATP-binding protein ScaC Streptococcus gordonii
Q8KLG1 1.29e-23 100 35 2 179 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q03ZQ0 1.34e-23 101 28 8 267 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q722B1 1.43e-23 101 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
A0AGP9 1.48e-23 101 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5WBL0 1.49e-23 99 30 3 208 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q0BUR6 1.55e-23 98 33 2 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q9CP06 1.71e-23 101 29 8 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q62K82 1.76e-23 100 31 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q03AH0 1.77e-23 100 29 10 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8Y8T6 1.94e-23 100 29 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7VZE5 1.96e-23 100 31 4 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q63TY1 1.98e-23 100 31 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q3K506 2e-23 99 33 3 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q5PFQ7 2.05e-23 100 31 7 235 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q65M64 2.26e-23 98 30 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q63TW1 2.29e-23 100 37 5 191 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q8Z8W8 2.36e-23 100 31 7 235 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q3JSR6 2.45e-23 100 37 5 191 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q5JEB0 2.55e-23 100 33 6 208 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O57872 2.6e-23 98 32 8 231 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P44656 2.61e-23 98 33 4 184 3 HI_0354 Uncharacterized ABC transporter ATP-binding protein HI_0354 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q88XV2 2.73e-23 99 36 9 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9MUN1 2.86e-23 100 30 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q1QE80 3.2e-23 100 32 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q62K56 3.67e-23 99 37 5 191 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q12NL5 4.13e-23 97 33 8 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q3M5J9 4.17e-23 97 33 2 200 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q38VW6 4.41e-23 99 31 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q57SD6 4.64e-23 100 30 7 235 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q2SVN0 4.64e-23 99 35 5 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1B677 4.65e-23 99 32 4 211 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q8U6M1 4.67e-23 99 33 6 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
A3DDF6 4.95e-23 99 29 8 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q0SRL2 4.96e-23 99 26 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
P56344 5.14e-23 97 31 5 227 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q1RDS4 6.25e-23 97 34 3 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 6.25e-23 97 34 3 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q2NHA1 6.28e-23 98 32 7 225 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q8GNH6 7.94e-23 99 34 4 195 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q7W9U5 9.21e-23 99 31 4 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WGW1 9.4e-23 99 31 4 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VNG4 9.4e-23 99 25 5 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5HQ70 9.68e-23 99 30 7 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8U4L3 1.03e-22 97 36 5 194 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P9WQL3 1.07e-22 99 32 5 227 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 1.07e-22 99 32 5 227 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q0TJC1 1.1e-22 97 35 5 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P94440 1.15e-22 97 27 4 239 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q0S0X2 1.2e-22 97 35 2 192 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q9KUI0 1.21e-22 99 30 7 262 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CN78 1.38e-22 95 32 3 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q02R79 1.46e-22 98 30 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1IGL4 1.52e-22 96 32 3 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q92VJ2 1.54e-22 98 30 5 233 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q9HY19 1.57e-22 98 30 5 231 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9G4F5 1.6e-22 98 32 5 234 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
O52618 1.62e-22 97 34 4 192 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q3B276 1.69e-22 95 31 6 208 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8RGC8 1.75e-22 98 28 6 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q87R20 2.02e-22 95 32 5 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q160G4 2.1e-22 96 32 9 237 3 hmuV Hemin import ATP-binding protein HmuV Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1AS06 2.13e-22 98 33 7 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q44613 2.2e-22 95 34 4 185 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8KZQ6 2.3e-22 96 33 3 202 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q5FQN4 2.59e-22 94 40 2 150 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
Q2K8C8 2.84e-22 97 33 6 230 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P97027 3.07e-22 95 34 2 173 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
Q9PJX9 3.16e-22 95 31 5 216 3 TC_0697 Probable metal transport system ATP-binding protein TC_0697 Chlamydia muridarum (strain MoPn / Nigg)
O83078 3.23e-22 95 33 4 204 3 TP_0035 Probable metal transport system ATP-binding protein TP_0035 Treponema pallidum (strain Nichols)
Q8U4K3 3.24e-22 97 33 6 208 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q58429 3.43e-22 95 30 5 202 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P39459 3.73e-22 95 33 5 214 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
Q64SQ6 3.76e-22 98 27 8 282 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5LBT4 3.87e-22 98 27 8 282 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q4ZQE3 3.93e-22 95 34 2 190 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. syringae (strain B728a)
Q73XU8 3.94e-22 97 32 6 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
O31339 4.83e-22 97 29 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
P55476 4.93e-22 96 35 9 217 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6D2F6 4.97e-22 96 30 5 227 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q31GF5 5.66e-22 94 34 4 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q82TL6 5.71e-22 96 29 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q13ZK7 5.87e-22 96 33 6 225 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q88XV1 6.13e-22 95 33 7 219 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8CPN0 6.46e-22 96 29 7 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P04285 6.8e-22 96 30 5 226 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1M7W6 7.08e-22 95 35 5 192 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8XZQ4 7.1e-22 95 32 2 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9USH9 7.46e-22 98 33 6 189 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1TXH7 7.57e-22 96 30 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P0A9V4 7.76e-22 94 30 6 223 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 7.76e-22 94 30 6 223 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 7.76e-22 94 30 6 223 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 7.76e-22 94 30 6 223 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
Q1CDR0 8.05e-22 94 31 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 8.05e-22 94 31 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 8.05e-22 94 31 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q5WKG4 8.12e-22 94 32 2 193 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
O31427 8.62e-22 94 33 8 207 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
Q609Q1 8.77e-22 96 30 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q97JB8 8.79e-22 95 29 4 213 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q035B2 9.77e-22 94 30 6 231 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
O34631 1.01e-21 97 34 4 194 3 yvrA Uncharacterized ABC transporter ATP-binding protein YvrA Bacillus subtilis (strain 168)
O34510 1.06e-21 94 29 6 238 3 yfmF Fe(3+)-citrate import ATP-binding protein YfmF Bacillus subtilis (strain 168)
P94374 1.06e-21 95 31 6 212 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q1MFL8 1.14e-21 94 30 3 203 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P31134 1.15e-21 96 27 8 262 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q65UE1 1.17e-21 96 25 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q93SH7 1.18e-21 94 30 4 217 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9KL34 1.19e-21 94 30 6 245 3 hmuV Hemin import ATP-binding protein HmuV Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q81GU1 1.22e-21 95 29 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0RKH4 1.31e-21 94 33 4 192 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8FJ95 1.4e-21 94 34 3 200 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3IL62 1.44e-21 93 32 4 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
Q8A883 1.53e-21 96 29 4 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P33916 1.55e-21 97 34 8 219 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 3.83e-16 81 29 7 231 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
Q88R93 1.56e-21 94 32 3 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1J982 1.58e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q578K3 1.7e-21 95 32 6 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.7e-21 95 32 6 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q9HYG4 1.7e-21 94 32 2 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2KBP5 1.72e-21 92 31 8 229 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5FA19 1.79e-21 95 31 7 234 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9V2E4 1.79e-21 93 32 7 210 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q5QU46 1.81e-21 92 34 7 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
C0SPB4 1.84e-21 94 29 8 234 3 yhaQ Uncharacterized ABC transporter ATP-binding protein YhaQ Bacillus subtilis (strain 168)
Q55EH8 1.95e-21 97 30 5 228 3 abcG23 ABC transporter G family member 23 Dictyostelium discoideum
P0C0E2 2.05e-21 92 29 4 193 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 2.05e-21 92 29 4 193 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q07LQ4 2.06e-21 94 32 6 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q0K2U3 2.08e-21 93 34 9 234 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q48QM2 2.25e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JJC9 2.25e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
P0C0E8 2.25e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
Q6MCV4 2.31e-21 95 32 8 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q82MV1 2.32e-21 93 31 1 191 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P0C0E9 2.35e-21 94 31 6 216 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0CZ29 2.35e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RH11 2.35e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J449 2.35e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JEC8 2.35e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7CMM7 2.35e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9B5 2.35e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ28 2.35e-21 94 31 6 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8XXY9 2.37e-21 94 30 6 225 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1WVI7 2.47e-21 95 29 4 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q97KS6 2.78e-21 94 26 8 282 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q665B6 2.9e-21 93 31 2 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
A0PY57 2.96e-21 94 27 7 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q92CK1 2.96e-21 93 34 7 206 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q81GC1 2.99e-21 94 26 4 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2J3T0 3.01e-21 93 28 5 235 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
P33982 3.3e-21 93 27 6 233 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q8FVV5 3.47e-21 94 32 6 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
P55662 3.67e-21 92 29 6 246 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1GIE5 3.81e-21 94 32 10 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q6F9A8 3.91e-21 94 28 6 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P57383 4.05e-21 92 30 5 186 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A1TAI4 4.09e-21 94 30 9 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q58762 4.21e-21 93 34 8 193 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q2K4V4 4.69e-21 94 29 6 232 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q92WJ0 4.78e-21 94 32 6 234 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8X5I6 5.02e-21 92 29 6 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q5NN23 5.1e-21 92 32 3 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P0AAI1 5.73e-21 92 34 4 202 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI2 5.73e-21 92 34 4 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
Q9A7X1 6.12e-21 93 30 4 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8DWR3 6.6e-21 92 30 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 6.6e-21 92 30 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 6.6e-21 92 30 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E8K8 6.72e-21 94 28 5 250 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P9WQM1 7.55e-21 93 31 6 227 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 7.55e-21 93 31 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 7.55e-21 93 31 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8VNL9 7.61e-21 92 28 8 236 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
O84421 8.57e-21 91 31 5 214 3 CT_416 Probable metal transport system ATP-binding protein CT_416 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P26050 8.77e-21 92 32 6 217 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q217B2 8.84e-21 92 28 6 245 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q4ZTG9 9.02e-21 91 36 3 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. syringae (strain B728a)
Q8NR42 9.23e-21 91 32 6 220 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q5FL41 1.06e-20 93 29 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
P72479 1.12e-20 92 29 8 241 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q89UD2 1.12e-20 93 30 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P0AAF9 1.14e-20 91 33 8 226 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 1.14e-20 91 33 8 226 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 1.14e-20 91 33 8 226 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 1.14e-20 91 33 8 226 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q8EBC3 1.15e-20 93 31 5 232 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1RFH8 1.17e-20 91 30 7 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 1.17e-20 91 30 7 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q02QT1 1.18e-20 91 32 2 196 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3SQ65 1.2e-20 91 28 8 270 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P08720 1.24e-20 92 34 5 192 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q325N3 1.25e-20 91 29 6 240 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q3Z3I7 1.26e-20 91 34 4 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
Q73YZ5 1.29e-20 91 33 3 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 1.29e-20 91 33 3 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
Q82VL9 1.32e-20 90 34 7 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q4W575 1.35e-20 92 32 6 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.35e-20 92 32 6 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P96605 1.37e-20 92 30 2 205 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
Q6NBT1 1.37e-20 92 30 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q83CV2 1.4e-20 90 32 5 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q1MQ44 1.4e-20 93 29 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q2YAD6 1.42e-20 92 28 4 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q3KBH4 1.43e-20 92 27 8 283 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
P55453 1.48e-20 92 31 6 209 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q0I3Y9 1.49e-20 93 25 6 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q0S6U9 1.49e-20 90 34 4 196 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhodococcus jostii (strain RHA1)
O33570 1.52e-20 90 38 5 185 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3Z542 1.54e-20 91 29 6 240 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 1.54e-20 91 29 6 240 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q8FKF5 1.54e-20 91 30 7 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9JUX4 1.59e-20 92 27 4 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q839D5 1.62e-20 91 27 7 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q138A9 1.66e-20 91 29 6 230 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB5)
Q110U3 1.72e-20 92 26 6 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q9JZW0 1.76e-20 92 27 4 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P15031 1.85e-20 90 32 8 236 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q07LU3 1.88e-20 91 28 6 245 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q47T99 1.89e-20 92 33 8 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q1LKJ2 2.13e-20 91 31 5 196 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q24XJ2 2.15e-20 92 28 6 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q6HLQ9 2.18e-20 92 27 6 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63E84 2.18e-20 92 26 4 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 2.18e-20 92 26 4 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 2.18e-20 92 26 4 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q32IZ6 2.18e-20 90 29 6 240 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q8RI39 2.19e-20 92 29 4 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q6LQ77 2.21e-20 90 32 11 234 3 btuD Vitamin B12 import ATP-binding protein BtuD Photobacterium profundum (strain SS9)
A0A0H2ZLL3 2.38e-20 90 28 8 241 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P57066 2.4e-20 90 31 5 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5E0B3 2.66e-20 90 31 5 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q81P94 2.76e-20 90 29 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus anthracis
P54592 2.77e-20 91 29 2 191 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
Q0K9I2 2.8e-20 91 31 3 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O07016 2.81e-20 91 33 5 181 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
Q6HHI7 2.87e-20 90 29 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8Y7R4 2.96e-20 90 33 7 206 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P10346 3.16e-20 90 30 8 229 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
A3CVD3 3.34e-20 90 33 6 215 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
O51587 3.34e-20 91 25 5 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P72335 3.34e-20 91 33 5 210 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q8UA73 3.41e-20 91 31 7 254 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8YCG3 3.42e-20 91 32 6 234 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q39GT7 3.48e-20 90 33 4 192 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q664X5 3.53e-20 92 29 6 230 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 3.53e-20 92 29 6 230 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 3.53e-20 92 29 6 230 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 3.53e-20 92 29 6 230 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
P19566 3.61e-20 92 30 6 232 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 3.61e-20 92 30 6 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
A1B9H9 3.79e-20 89 28 1 218 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
Q8REG7 3.87e-20 89 27 4 221 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9YGA6 3.9e-20 92 29 5 232 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q63A38 3.99e-20 89 29 4 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ZK / E33L)
Q660M8 4.07e-20 91 25 5 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q58129 4.31e-20 92 32 4 183 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58129 5.93e-09 59 27 6 184 3 MJ0719 Uncharacterized ABC transporter ATP-binding protein MJ0719 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P45073 4.56e-20 89 28 6 238 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8Z1U0 4.57e-20 91 30 6 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
O86751 4.6e-20 91 32 6 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1B8V9 4.81e-20 91 29 4 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 4.81e-20 91 29 4 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q65QT6 4.9e-20 91 28 5 230 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5PKZ8 4.9e-20 91 30 6 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3ATY5 5.01e-20 89 31 5 187 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
P45769 5.09e-20 89 30 6 232 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q8FB37 5.3e-20 91 30 6 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q48FT0 5.36e-20 89 33 2 190 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7NWX3 5.42e-20 91 32 6 235 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q720M2 5.47e-20 89 33 7 206 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q8N139 5.52e-20 92 33 4 181 1 ABCA6 ATP-binding cassette sub-family A member 6 Homo sapiens
Q8N139 1.14e-08 59 25 7 206 1 ABCA6 ATP-binding cassette sub-family A member 6 Homo sapiens
Q3YUV0 5.52e-20 91 30 6 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 5.52e-20 91 30 6 232 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_02550
Feature type CDS
Gene znuC
Product zinc ABC transporter ATP-binding protein ZnuC
Location 491694 - 492503 (strand: -1)
Length 810 (nucleotides) / 269 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_638
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1121 Inorganic ion transport and metabolism (P) P ABC-type Mn2+/Zn2+ transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09817 zinc transport system ATP-binding protein [EC:7.2.2.20] ABC transporters -

Protein Sequence

MSTLIAVNDVSVAFGANTVLEDISFTLSPGKIITLLGPNGAGKSTIVRVVLGLTEPTSGTVTRTPGLTVGYVPQKLYLDPTMPLTVARFLRLKRGVSKGECLAALERVNAAHLTGKPMQRLSGGEMQRVLLARALLARPQLLVLDEPTQGVDVNGQVALYDLITRLRDELNCAVLMVSHDLHLVMAKTDTVLCINRHICCSGEPDVVAAHPEFTAMFGSRAATQIGVYRHHHNHSHENGSAVLSPSAPCCGNHAPADVSVKPAPECRHD

Flanking regions ( +/- flanking 50bp)

ATAATGTTATATTATAACGTTTCATTCATTCTGCAAGATAATAATTTGTCATGTCAACACTTATCGCGGTAAATGATGTTTCTGTCGCTTTTGGTGCCAATACGGTACTCGAGGACATTTCATTTACATTATCCCCCGGGAAAATCATCACCCTTCTCGGGCCGAACGGCGCGGGAAAATCCACTATTGTCCGTGTGGTACTCGGCCTTACCGAACCGACGTCCGGCACCGTCACCCGCACACCGGGTCTGACTGTCGGCTATGTTCCGCAAAAACTCTATCTCGACCCGACAATGCCGCTGACGGTGGCCCGTTTTCTGCGTCTGAAGCGCGGTGTCAGCAAGGGCGAGTGTCTCGCGGCGCTTGAGCGGGTCAATGCCGCGCATCTGACCGGAAAACCGATGCAACGGCTGTCCGGCGGTGAAATGCAGCGGGTGCTGCTGGCCCGTGCCCTGCTCGCCCGGCCGCAGTTACTGGTGCTGGATGAGCCGACTCAGGGTGTGGATGTCAACGGCCAGGTCGCGCTGTATGACCTGATCACCCGGCTGCGTGATGAACTGAACTGCGCGGTGCTGATGGTTTCTCACGATCTGCATCTGGTGATGGCAAAAACCGATACCGTGCTGTGTATCAACCGGCATATCTGCTGCTCCGGCGAGCCGGATGTGGTAGCCGCCCATCCGGAGTTTACCGCCATGTTCGGTAGCCGGGCCGCGACACAGATCGGCGTGTACCGTCATCATCACAACCACAGTCACGAGAACGGCAGTGCAGTGCTATCCCCTTCTGCACCCTGCTGCGGGAATCACGCCCCGGCAGATGTCTCTGTAAAACCCGCTCCGGAGTGCCGCCATGATTGAATTACTGTTACCGGGCTGGCTCGCCGGGATTTTACTGGCGATCGCGGCCG